A method for improving monascus protein yield and essential amino acid content

Abstract

The present application belongs to the technical field of microorganisms, and particularly relates to a method for improving protein yield and essential amino acid content of monascus. The specific technical scheme comprises the following steps: a novel transcription factor MpTFA alpha is found, and the transcription factor is closely related to protein synthesis and essential amino acid synthesis of monascus. By means of gene editing technology, the transcription factor MpTFA alpha is knocked out, inhibited or overexpressed, so that the expression of key genes for protein synthesis in monascus can be strengthened or weakened in a directional manner, and monascus with high or low protein yield is constructed.

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, specifically relating to a method for increasing the protein yield and essential amino acid content of Monascus purpureus. Background Technology

[0002] Monascus spp., a traditional filamentous fungus used in both food and medicine, has a long history of application in food fermentation and the preparation of natural pigments and functional factors. With its high biocompatibility, broad substrate adaptability, and ability to ferment agricultural waste, it has become an important candidate strain for microbial single-cell proteins (SCPs), possessing the potential to be developed into novel alternative proteins in the context of global protein resource shortages. Existing research mainly focuses on the accumulation of Monascus spp. mycelium proteins, amino acid composition, and fermentation regulation. It has been confirmed that Monascus spp. mycelium contains a variety of amino acids, covering all essential amino acids for humans, with relatively high levels of lysine and valine, demonstrating basic nutritional value and showing promising application prospects in the fields of feed and food additives.

[0003] Current research focuses on optimizing fermentation conditions, aiming to increase biomass and protein content by adjusting the carbon-to-nitrogen ratio, adding trace elements, or using exogenous regulators. However, the metabolic network of wild-type Monascus purpureus naturally favors the synthesis of secondary metabolisms such as pigments, resulting in insufficient protein synthesis flux and total protein production that cannot meet the demands of industrial-scale protein production. Furthermore, fermentation exhibits significant fluctuations and poor stability. While exogenous additions of arginine and nitric oxide donors can stimulate protein synthesis in the short term, these methods suffer from high costs, unstable intracellular signal concentrations, and a tendency to induce oxidative stress and exacerbate secondary metabolic diversion, thus failing to achieve sustained and efficient protein accumulation.

[0004] At the amino acid composition level, essential amino acids are those that the human body cannot synthesize and must obtain from food. These include isoleucine, leucine, lysine, methionine (methionine), phenylalanine, threonine, tryptophan, and valine. Red yeast rice protein contains only about 30% essential amino acids, with tryptophan and methionine being the main limiting amino acids. Its essential amino acid index and biological value do not meet the standards for high-quality protein, and the unbalanced amino acid profile directly limits its nutritional value as a single protein source.

[0005] In summary, traditional process optimization and exogenous regulation cannot fundamentally overcome the core bottlenecks of low protein yield and essential amino acid imbalance in Monascus purpureus. While the molecular mechanisms of Monascus purpureus protein synthesis and nitrogen metabolism pathways, as well as key regulatory genes, are being gradually elucidated, providing a theoretical basis for metabolic reprogramming, gene modification targeting protein synthesis and amino acid balance is still in its early stages. Summary of the Invention

[0006] The purpose of this invention is to provide a method for increasing the yield of Monascus purpureus protein and the content of essential amino acids.

[0007] To achieve the above-mentioned objective, the technical solution adopted by the present invention is: a method for increasing protein production in Monascus purpureus, or a method for increasing the proportion of essential amino acids in Monascus purpureus to the total amino acids, wherein the method is to knock out the Monascus purpureus transcription factor MpTFAα, or to inhibit the expression of the transcription factor MpTFAα, and the nucleotide sequence of MpTFAα is shown in SEQ ID NO: 1.

[0008] Accordingly, a method for reducing Monascus purpureus protein production, or a method for reducing the proportion of essential amino acids in the total amino acids of Monascus purpureus, is provided by overexpressing the Monascus purpureus transcription factor MpTFAα, the nucleotide sequence of which is shown in SEQ ID NO: 1.

[0009] Accordingly, a Monascus purpureus in which the transcription factor MpTFAα is knocked out or suppressed. Or; a Monascus purpureus in which the transcription factor MpTFAα is overexpressed.

[0010] This invention offers the following advantages: It is the first to discover a novel transcription factor, MpTFAα, in fungi, and reveals its close relationship with protein synthesis and essential amino acid synthesis in Monascus purpureus. Utilizing gene editing technology, this invention knocks out or inhibits the expression of the MpTFAα transcription factor in Monascus purpureus, thereby achieving targeted enhancement of key protein synthesis gene expression, reconstructing nitrogen metabolism flux, and precisely improving the ability to synthesize limiting amino acids. This invention achieves a synergistic increase in protein yield and essential amino acid content through gene technology, significantly enhancing the competitiveness of Monascus purpureus as an industrial protein source and providing a new, safe, efficient, and sustainable high-quality protein supply solution for the food and feed industries.

[0011] Furthermore, by overexpressing the transcription factor MpTFAα, it is also possible to construct red Monascus purpureus with lower protein yield and a lower proportion of essential amino acids, thus achieving dual applications in scientific research and industry. In scientific research, constructing low-protein red Monascus purpureus allows for better study of the function of key genes involved in protein synthesis and the elucidation of metabolic flux competition. In industrial applications, since there is competition between protein synthesis and secondary metabolite synthesis, inhibiting protein synthesis allows more precursors to be used to synthesize other metabolites such as red Monascus pigments and monacolin K. Additionally, if the goal of fermenting red Monascus purpureus is to extract intracellular small molecule functional substances, reducing protein yield can also reduce the difficulty of subsequent separation and improve product purity. Attached Figure Description

[0012] Figure 1 A graph showing the amino acid differences between MpTFAα and the protein with the closest homology;

[0013] Figure 2 The image shows the PCR verification results of the wild-type strain and ΔMpTFAα.

[0014] Figure 3 A comparison of crude protein content in the mycelium of wild-type strain and ΔMpTFAα;

[0015] Figure 4 A comparison of the proportion of essential amino acids in the total amino acids of wild-type strains and ΔMpTFAα mycelia.

[0016] Figure 5 This is a comparison of gene expression levels of essential amino acid synthesis genes in wild-type strains and ΔMpTFAα. Detailed Implementation

[0017] This invention provides a method to increase the protein yield and essential amino acid content of Monascus spp., specifically by knocking out the Monascus transcription factor MpTFAα. The method provided by this invention is applicable to all Monascus spp. strains; the following examples use a specific purple Monascus strain as an example and are not limited to that strain.

[0018] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art, and the data obtained are all average values ​​obtained after at least three repetitions, and each repetition yields valid data.

[0019] Example 1: Bioinformatics analysis and sequence determination of the transcription factor gene MpTFAα

[0020] Bioinformatics prediction of the genome of Monascus purpureus ATCC 16360 identified a transcription factor containing a conserved Zn(II)2Cys6 zinc finger domain, named MpTFAα, whose nucleotide sequence is shown in SEQ ID NO: 1 and whose encoded amino acid sequence is shown in SEQ ID NO: 2.

[0021] The amino acid sequence of MpTFAα was compared with proteins in known databases using the NCBI-BLAST function. The results are as follows: Figure 1 As shown, the results indicate that MpTFAα has less than 30% amino acid homology with all currently known functional transcription factors, making it a novel transcription factor with unknown function discovered for the first time in fungi.

[0022] Example 2: Construction of MpTFAα gene knockout strain based on CRISPR / Cas9 system

[0023] This embodiment utilizes CRISPR / Cas9 gene editing technology to precisely knock out the MpTFAα gene in Monascus purpureus. The specific steps include:

[0024] 1. Construction of the knockout plasmid pFC332-Cas9-sgRNA

[0025] sgRNA target site design and synthesis: Highly specific sgRNA target sites with low off-target rates were designed using online design software targeting the coding region of the MpTFAα gene (SEQ ID NO: 1). To increase the success rate of the experiment, three sgRNAs were designed:

[0026] (1)5'-GTCCGTATCCCATCCGCCGCA-3' (SEQ ID NO: 3)

[0027] (2)5'-GCCCCAGGAGGAATGGGACCA-3' (SEQ ID NO: 4)

[0028] (3)5'-GGTCTACGGGCCCAGTGCTC-3' (SEQ ID NO: 5)

[0029] To achieve efficient transcription and precise release of these sgRNAs in Monascus purpureus, a complete transcriptional structure containing self-cleaving ribozymes, HH-sgRNA-HDV, was designed flanking the sgRNA. This complete transcriptional structure is generated by the promoter P. tef1 It regulates transcription levels. The HH ribozyme is located at the 5' end of the sgRNA sequence, and the HDV ribozyme is located at the 3' end of the sgRNA backbone sequence. This structure utilizes the promoter P... tef1 The high transcriptional activity of the Cas9 / sgRNA allows for precise removal of the 5' transcription initiation modification and the 3' Poly-A tail via the in vivo autocatalytic cleavage mechanism of HH and HDV after transcription. This results in the release of a structurally intact, mature sgRNA without additional base extensions within *Monascus purpureus* cells, significantly improving the cleavage efficiency and large fragment deletion success rate of the Cas9 / sgRNA complex on the target transcription factor gene MpTFAα. Therefore, three corresponding complete transcription structures (TS) were designed for the three sgRNA sequences mentioned above:

[0030] TS1: 5'-ACGGACGTCCGTATCCCATCCGCCGCAACGGACCTGATGAGTCCGTGAGGACGAAACGGTAAAGCCCGTATCCTCGACCGAA-3' (SEQ ID NO: 6);

[0031] TS2: 5'-TGGGGCGCCCCAGGAGGAATGGGACCA GGCCTCTTGCCGAAAAGTGAGGCCGGTACCGCTGATCGTGGAGCCTTGGTGGGGTCACAAAACCCCAACCGGTGG-3' (SEQ ID NO: 7);

[0032] TS3: 5'-TAGACCGGTCTACGGGCCCAGTGCTCGGCCTCTTGCCGAAAAGTGAGGCCGGTACCGCTGATCGTGGAGCCTTGGTGGGGTCACAAAACCCCAACCGGTGG-3' (SEQ ID NO: 8).

[0033] These three complete transcriptional structures are connected to the commonly used promoter P. tef1 (The sequence is shown in SEQ ID NO: 9) and the terminator T trp C (sequence shown in SEQ ID NO: 10) forms three expression cassettes: Ptef1-TS1-TtrpC, Ptef1-TS2-TtrpC, and Ptef1-TS3-TtrpC. The DNA fragments of these three expression cassettes were synthesized by General Biotechnology (Anhui) Co., Ltd., and used to construct three knockout vectors respectively.

[0034] Construction of the pFC332-Cas9-sgRNA knockout plasmid: The universal fungal CRISPR expression vector pFC332 was selected as the backbone plasmid. This plasmid contains the hygromycin B resistance gene (hph) and the Cas9 expression cassette (commercially available, https: / / www.addgene.org / 87845 / ). DNA fragments of the three expression cassettes were cloned using the upstream primer (ATCGAGATCTTATCACATAGGAAGCAACAGGC, SEQ ID NO:11) and the downstream primer (ATCGTTAATTAACTAGAAAGAAGGATTACCTCTAAAC, SEQ ID NO:12) for vector construction. Since the promoters and terminators of the three expression cassettes are identical, the primers were the same.

[0035] The pFC332 vector and three expression cassette fragments were digested using restriction endonucleases BglII and PacI. The digestion reaction system (50 μL) consisted of 2.0 μg of purified pFC332 plasmid or expression cassette DNA fragment, 5 μL of 10 × Buffer, 1.5 μL of BglII restriction endonuclease, 1.5 μL of PacI restriction endonuclease, and finally 50 μL of sterile double-distilled water. The digestion system was incubated at 37°C for 6 h. After the reaction, the system was heated at 65°C for 20 min to completely inactivate the restriction endonucleases. The digestion products were separated by 1.0% agarose gel electrophoresis. The large pFC332 vector backbone fragment and expression cassette fragment were recovered using a DNA gel recovery kit. The concentration and purity of the recovered products were determined using a micro-spectrophotometer to ensure A… 260 / A 280 It is between 2.0 and 2.2.

[0036] Then, the expression cassette fragment was ligated into the vector using T4 DNA ligase. The ligation reaction system was prepared at a 1:3 molar ratio of vector to insert fragment: 2 μL of 10× T4 DNA Ligase Buffer, 1.0 μL of T4 DNA Ligase, and 20 μL of ddH2O added to make up the difference. After mixing the ligation system thoroughly, it was placed in a 16°C water bath overnight (12–16 h) to allow complete covalent binding between the fragment and the vector, thus constructing the recombinant plasmid.

[0037] Transform *E. coli* DH5α competent cells. Add the ligation product to freshly thawed *E. coli* DH5α competent cells (on ice), gently tap to mix, and incubate on ice for 30 min. Immediately afterward, heat shock the tubes in a 42°C water bath for 90 s, then quickly return them to the ice bath and incubate for 2 min. Add 800 μL of antibiotic-free sterile SOC liquid medium (Invitrogen, catalog number 15544034) to the transformation tubes and incubate in a shaker at 37°C and 120 rpm for 1 h. After revival, centrifuge at 4000 rpm for 3 min to concentrate the cells, discard some of the supernatant, and resuspend the cells completely in approximately 100 μL of the suspension. Spread the resuspended cells evenly onto LB agar plates containing 100 μg / mL ampicillin. Invert the plates in a 37°C incubator for 12–16 h until visible single colonies appear.

[0038] Validation was performed by colony PCR and sequencing. Single colonies on the plates were expanded in liquid LB medium, and recombinant plasmids were extracted using a plasmid extraction kit. The plasmid samples were then sent to a sequencing company (Shanghai Sangon Biotech Co., Ltd.) for bidirectional Sanger sequencing. Sequencing primers covered the adapter and full-length expression cassette sequences. The sequencing results were compared with the theoretically assembled sequences to screen for the correct recombinant plasmid pFC332-Cas9-sgRNA, which had completely identical bases and no mutations, deletions, or mismatches, for subsequent fungal transformation experiments.

[0039] 2. Construction of donor plasmid pUC-Donor

[0040] Construction of donor DNA repair homologous arms: To achieve precise knockout and disruption of open reading frames, approximately 1500 bp fragments upstream and downstream of the MpTFAα gene were amplified as templates for homologous recombination. The donor gene fragment sequence was: Uparm-P tef1 -hph-T trpC -Downarm. Uparm and Downarm are sequences completely identical to the upstream and downstream sequences of the MpTFAα gene in *Monascus purpureus*, obtained through gene cloning. Their purpose is to induce homologous recombination with the genome, thereby completely replacing the original MpTFAα gene sequence and achieving gene knockout. tef1 -hph-T trpC It is the function of expressing the hygromycin resistance gene. The recombinant transformant will express the hph gene, which will enable the strain to produce hygromycin resistance, and thus be used for screening recombinant transformants.

[0041] The upstream homologous arm primers include:

[0042] Uparm-F (P1): 5'-ATCGGGTACCGATCGATCGATCGACTG-3' (SEQ ID NO: 13);

[0043] Uparm-R (P2):5'-GCCTGTGTTGCTTCCTATGTGATCGGGATCCCGTAGCTAGC -3' (SEQ IDNO:14);

[0044] Ptef1-F (P3):5'- TATCACATAGGAAGCAACAGGC -3' (SEQ ID NO:15);

[0045] Ptef1-R (P4):5'-GGTGAGTTCAGGCTTTTTCATTTGTAATTAAAACTTAGATTAGATTGC -3' (SEQ ID NO:16);

[0046] hygR-F (P5):5'-ATGAAAAAGCCTGAACTCACCGCG -3' (SEQ ID NO:17);

[0047] hygR-R (P6):5'- ACTAGAAGGCACTCTTTGCTCTATTCCTTTGCCCTCGGACG -3' (SEQ IDNO:18);

[0048] TtrpC-F (P7):5'- AGCAAAGAGTGCCTTCTAGT -3' (SEQ ID NO:19);

[0049] TtrpC-R (P8):5'-GCTAGCTAGCTAGCGTCGACCTAGAAAGAAGGATTACCTCTAAAC -3' (SEQ ID NO: 20);

[0050] Downarm-F (P9):5'-ATCGGTCGACGCTAGCTAGCTAGCTAGC-3' (SEQ ID NO:21);

[0051] Downarm-R (P10): 5'-ATCGGCGGCCGCTAGCTAGCTAGCTAGC-3' (SEQ ID NO: 22).

[0052] Uparm fragment: amplified using primers P1 + P2. Ptef1 fragment: amplified using primers P3 + P4.

[0053] hygR fragment (SEQ ID NO:23): amplified using primers P5 + P6. TtrpC fragment: amplified using primers P7 + P8.

[0054] Downarm fragment: Amplified using primers P9 + P10.

[0055] A homologous recombination donor fragment (Donor DNA fragment) was constructed using Gibson Assembly in vitro multi-fragment recombination technology. Five fragments were maintained in a molar ratio of 1:1:1:1:1 (0.05 pmol each). The fragment mixture was added to 10 μL of 2X Gibson Assembly Master Mix on ice, and the volume was brought to 20 μL with nuclease-free water. The mixture was then gently pipetted and aspirated. The reaction tube was then placed in a PCR instrument and incubated precisely at 50 °C for 60 min to ensure sufficient annealing and covalent ligation of the overlapping homologous arms of the five fragments. After the reaction, the tube was immediately placed on ice for 5 min to terminate enzyme activity. 1 μL of the assembled product was used as a template for 20 cycles of high-fidelity PCR enrichment and amplification using the outermost primers Uparm-F and Downarm-R. The amplified product was verified by 0.8% agarose gel electrophoresis, showing a target large fragment consistent with the theoretical splicing length. The Donor DNA fragment was obtained by gel extraction and purification.

[0056] Double digestion and ligation of the donor fragment with the cloning vector: Utilizing the KpnI (in primer Uparm-F (P1)) and NotI (in primer Downarm-R (P10)) restriction endonuclease sites reserved at both ends of the Uparm and Downarm primers, the Donor DNA fragment obtained in the previous step was cloned into the plasmid vector pUC19 through the principle of enzyme digestion and ligation. Details are as follows:

[0057] (A) Take 2.0 μg of the purified Donor DNA fragment and 2.0 μg of the cloning vector plasmid pUC19 bone, add 10 X T4 DNA Ligase Buffer compatible enzyme digestion buffer, 1.5 μL of KpnI and NotI restriction endonucleases, and add ddH2O to make up to 50 μL. Incubate in a 37℃ constant temperature water bath for 2.5 h for digestion.

[0058] (B) After the enzyme digestion products were subjected to agarose gel electrophoresis, the linearized vector backbone and Donor DNA fragment were recovered by gel excision. A 20 μL ligation system was prepared according to the molar ratio of vector plasmid to Donor DNA fragment = 1:3: 1.0 μL of T4 DNA ligase was added, and the mixture was ligated in a water bath at 16℃ for 14 h to obtain the ligation product.

[0059] (C) The ligation product obtained in step (B) was transformed into *E. coli* DH5α competent cells using the heat shock method described above, and plated on LB agar plates containing ampicillin (50 μg / mL). Single colonies were selected the next day for colony PCR screening. Positive clones were sequenced correctly by Sanger sequencing and then subjected to liquid amplification culture. High concentrations of donor plasmid were extracted and named pUC-Donor.

[0060] 3. Transformation and screening of purple Monascus protoplasts

[0061] Wild-type strain of *Monascus purpureus* (WT, ATCC 16360) was inoculated into PDB medium and cultured at 30°C and 150 rpm for 24 h to collect fresh mycelia. A compound enzymatic hydrolysate was prepared using 1.5% lysozyme (Shanghai Yuanye Biotechnology Co., Ltd.) and 1.5% snailase (Shanghai Yuanye Biotechnology Co., Ltd.), and hydrolyzed at 30°C and 80 rpm for 6 h. The protoplasts were washed with sterile STC buffer, filtered through sterile filter paper, and collected by centrifugation at 4°C and 4000 rpm. The protoplast concentration was finally adjusted to 1 x 10⁻⁶ with STC buffer. 6 Cells / mL, ready for use. STC buffer: 0.25M sucrose + 50mM Tris-HCl + 10mM CaCl2.

[0062] PEG-mediated co-transformation of Monascus purpureus protoplasts: 100 μL of protoplast suspension was placed in a sterile centrifuge tube. 10 μg of pFC332-Cas9-sgRNA plasmid and 15 μg of pUC-Donor plasmid were added sequentially, and the mixture was gently tapped to mix. The tube was then incubated on ice for 30 min. Subsequently, 1 mL of 60% PEG4000 solution was slowly added in three separate portions, gently inverting to mix after each addition. The mixture was incubated for 25 minutes. o Incubate at room temperature for 20 min. Dilute with 2 mL of STC buffer to the transformation system, centrifuge at 4000 rpm for 3 min to collect protoplasts. Resuspend in 1 mL of regeneration liquid medium and statically resuscitate at 30°C for 4 h. After resuscitation, mix the protoplasts with molten (approximately 45°C) regeneration liquid solid agar (containing 50 mg / mL hygromycin B), then pour into plates and incubate at 30°C for 5-7 days. Regeneration liquid: Potato glucose broth (PDB) powder 24 g / L, sorbitol 218.6 g / L, yeast extract 5 g / L, peptone 5 g / L, adjust pH to 6.5, autoclave at 121°C for 20 min before use.

[0063] After single colonies grew on the plates, they were transferred to fresh PDA plates containing 50 mg / mL hygromycin B for resistance confirmation. Approximately 200 mg of fresh hyphae from the plates were placed in a pre-chilled mortar and rapidly ground into a fine powder using liquid nitrogen. This powder was then transferred to 800 μL of 2X CTAB lysis buffer preheated to 65°C and supplemented with 1% β-mercaptoethanol, and lysed in a 65°C water bath for 60 min. After cooling to room temperature, an equal volume of a phenol-chloroform-isoamyl alcohol mixture (25:24:1) was added, and the mixture was gently inverted for 10 min. The mixture was then centrifuged at 12000 rpm for 15 min at 4°C to separate the phases. The upper aqueous phase containing nucleic acids was carefully transferred, and 2 μL of LRNase A (10 mg / mL) was added. The mixture was then digested at 37°C for 30 min to remove RNA. Next, add an equal volume of chloroform-isoamyl alcohol (24:1) for extraction and centrifuge at 12000 rpm for 10 min. Transfer the supernatant to a new tube and add 0.7 volumes of frozen isopropanol and 0.1 volumes of 3 mol / L sodium acetate solution. Incubate at -20°C for 30 min to precipitate. Finally, centrifuge at 4°C and 12000 rpm for 10 min to collect the DNA precipitate. Wash the precipitate twice with 75% sterile ethanol, air dry in a clean bench for 5-10 min, and then add 50 μL of sterile TE buffer to completely dissolve it. The obtained high-purity genomic DNA is used for subsequent PCR molecular verification. 2X CTAB lysis buffer formulation (100 mL): contains 2.0 g CTAB, 1.4 mol / L NaCl, 100 mmol / L Tris-HCl (pH=8.0), 20 mmol / L EDTA (pH 8.0), and 1% (vlv) β-mercaptoethanol added just before use. TE buffer formulation (100 mL): Contains 10 mmol / L Tris-HC1 (pH=8.0) and 1 mmol / L EDTA (pH=8.0).

[0064] PCR was performed using primers P1 / P10 to amplify the entire Uparm-P10 protein. tef1 -hph-T trpC The size of the Downarm fragment in the PCR product on agarose gel electrophoresis was consistent with the theoretical value, but larger than the Uparm-MpTFAa-Downarm fragment in the original Monascus purpureus genome, indicating that Uparm-P tef1 -hph-T trpC The Downarm fragment replaced the Uparm-MpTFAa-Downarm fragment. PCR was performed using primers P5 / P6 to amplify the entire hyg gene, confirming that the hyg resistance gene from the donor plasmid was inserted into the genome. The PCR amplification products were sent to a sequencing company for sequencing. The PCR verification results of the original strain and ΔMpTFAa are as follows... Figure 2 As shown. The comparison results confirmed that the open reading frame of the MpTFAα gene in the *Monascus purpureus* genome had been completely knocked out and precisely replaced with a P gene from the donor. tef1 -hyg-T trpC Expression cassette. A genetically stable MpTFAa gene knockout mutant was obtained and named △MpTFAa.

[0065] Example 3: Comparison of fermentation and performance between the original red yeast rice strain and the ΔMpTFAα strain

[0066] 1. Fermentation culture

[0067] The original purple Monascus strain (WT) and the transcription factor knockout mutant strain (ΔMpTFAa) preserved on slant culture were inoculated separately onto PDA solid plates and incubated upside down in a 30°C incubator for 7 days to activate the strains. Conidia were collected by rinsing the plate surface with sterile saline, filtering with sterile absorbent cotton to remove hyphae, and preparing a spore suspension from the filtrate. The spores were counted using a hemocytometer, and the spore concentration was adjusted to 2.0 x 10⁻⁶. 5 spores / mL. Subsequently, at an inoculation rate of 5% (vv), the spore suspension was inoculated into 250 mL Erlenmeyer flasks containing 30 mL of seed culture medium (30 g / L glucose, 10 g / L peptone, 2 g / L KH2PO4, 1 g / L MgSO4·7H2O), and cultured at 30 °C and 120 rpm for 24 h with shaking to obtain the fermentation seed liquid.

[0068] The prepared seed cultures of the original strain and the mutant strain were transferred at an inoculation rate of 3% (v) into mCD liquid fermentation medium (g / L, glucose 30, NaNO3 10, KH2PO4 5, Na2HPO4 3, MgSO4 0.1, CaCl2 0.1, ZnSO4·7H2O 0.1, FeSO4·7H2O 0.1, CoSO4·7H2O 0.05, CuSO4·5H2O 0.02, MnSO4·H2O 0.01) and cultured in shake flasks at 30℃ and 200 rpm for 7 days. During fermentation, on the 4th day of fermentation, a portion of mycelium was taken out for transcriptome sequencing and RT-qPCR molecular mechanism analysis. After fermentation, all mycelium was collected by filtration with a filter cloth, and the surface of the mycelium was rinsed three times with deionized water to completely remove residual fermentation broth components. The washed mycelium was then dried in a 90℃ vacuum drying oven to constant weight for subsequent biomass (mycelium dry weight) assessment and determination of protein and amino acid related parameters.

[0069] 2. Differences in mycelial protein content between wild-type strain (WT) and knockout mutant strain (△MpTFAα) after fermentation

[0070] (1) Determination of crude protein content in mycelium

[0071] Accurately weigh 0.2g of dried mycelium, grind it into a uniform powder, add 2g of copper sulfate and 2g of potassium sulfate as catalysts, and inject approximately 15mL of concentrated sulfuric acid into a digestion furnace for high-temperature digestion. After complete digestion, the total nitrogen content of each sample was determined using an automated Kjeldahl nitrogen analyzer (NKY6180), and the crude protein mass was calculated by multiplying it by a conversion factor of 6.25. This crude protein mass was then divided by the dry weight of the mycelium to obtain the proportion of crude protein in the mycelium. The experiment was repeated three times in parallel, and the average value was taken.

[0072] The results are as follows Figure 3 As shown, the results indicate that the crude protein content of the mycelium of the wild-type strain was 36.2%, while the crude protein content of the mycelium of ΔMpTFAα was significantly increased to 47.3%, achieving a relative increase of approximately 23.7%.

[0073] (2) Analysis of amino acid composition and the proportion of essential amino acids

[0074] To further clarify the changes in protein quality, an automated amino acid analyzer (Agilent 1260 Infinity III) was used to quantitatively detect the types and contents of amino acids in the mycelium. 100 mg of dried mycelium powder was weighed and placed in a hydrolysis tube, and 6 mol / L concentrated hydrochloric acid solution was added. Hydrolysis was carried out at 110℃ under vacuum for 24 h. After precise dilution and filtration, the solution was injected into a high-performance liquid chromatograph for analysis.

[0075] The results are as follows Figure 4 As shown, the results indicate that ΔMpTFAα contains 51% of the total essential amino acids, while the proportion in the original strain is only 37.1%. Specifically, knocking out the MpTFAα gene significantly increased the content of threonine, isoleucine, leucine, and valine in the mycelium.

[0076] Example 4: Transcriptomics Analysis and Transcriptional Response of Key Genes in the Amino Acid Synthesis Pathway

[0077] To elucidate the molecular mechanism by which protein content significantly increases after MpTFAα gene knockout, transcriptome sequencing (RNA-seq) analysis was performed on the mycelia of wild-type strain (WT) and knockout mutant strain (△MpTFAα) fermented on day 4 according to the method in Example 3.

[0078] 1. Transcriptome sequencing and differentially expressed gene analysis

[0079] The original wild-type strain (WT) and the mycelium of ΔMpTFAα were rapidly frozen in liquid nitrogen on day 4 of fermentation and then sent to Shanghai Meiji Biotechnology Co., Ltd. for sample processing and transcriptome sequencing. Sequencing results were used as the screening criteria for differentially expressed genes, with |log2(Fold Change)>1.0 and P-value <0.05. The results are shown in Table 1.

[0080] Table 1. Comparison of differentially expressed genes between WT strain and ΔMpTFAα strain

[0081]

[0082] In Table 1, FPKM is a relative quantitative indicator used in transcriptome sequencing to correct gene length and sequencing depth, providing an intuitive biological interpretation in differential gene expression analysis. Transcriptome data show that, within ΔMpTFAα, the expression levels of a series of core rate-limiting enzyme genes regulating cellular carbon and nitrogen flow, branched-chain amino acid biosynthesis pathways, and related essential amino acid biosynthesis pathways are strongly upregulated.

[0083] 2. Transcriptional responses in the synthesis pathways of threonine, isoleucine, leucine, and valine.

[0084] To validate the transcriptome sequencing results, the expression levels of relevant genes in the two strains were determined using qRT-PCR technology.

[0085] The results are as follows Figure 5 As shown, the results revealed that in the threonine and isoleucine synthesis pathway, the transcriptional levels of the aspartate kinase gene, homoserine dehydrogenase gene, and threonine synthase gene, which encode key rate-limiting enzymes, were significantly upregulated, directly accelerating the flow from aspartate to threonine. Simultaneously, activation of the threonine deaminase gene promoted the efficient conversion of threonine to α-ketobutyrate, which then entered the branched-chain amino acid synthesis network. In the downstream common branched-chain amino acid synthesis pathway, the expression levels of key acetylhydroxy acid synthase genes, isomer reductase genes, and dihydroxy acid dehydratase genes were simultaneously and significantly increased, directly enhancing the condensation and reduction efficiency of pyruvate to branched-chain amino acid precursors. Finally, at the terminal branch, the upregulated expression of the α-isopropylmalate synthase gene and branched-chain amino acid transaminase genes comprehensively enhanced the synthesis of leucine, valine, and isoleucine, leading to the accumulation of these four specific amino acids.

[0086] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Any modifications, alterations, alterations, or substitutions made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A method for increasing protein yield in Monascus purpureus, characterized in that: Knockout of Monascus transcription factor MpTFAα or inhibition of its expression, the nucleotide sequence of MpTFAα is shown in SEQ ID NO:

1.

2. A method for increasing the proportion of essential amino acids in the total amino acids of Monascus purpureus, characterized in that: Knockout of Monascus transcription factor MpTFAα or inhibition of its expression, the nucleotide sequence of MpTFAα is shown in SEQ ID NO:

1.

3. A method for reducing Monascus protein production, characterized in that: Overexpression of Monascus transcription factor MpTFAα, the nucleotide sequence of which is shown in SEQ ID NO:

1.

4. A method for reducing the proportion of essential amino acids in the total amino acids of Monascus purpureus, characterized in that: Overexpression of Monascus transcription factor MpTFAα, the nucleotide sequence of which is shown in SEQ ID NO:

1.

5. A type of Monascus purpureus, characterized in that: The transcription factor MpTFAα in the red yeast rice was knocked out or its expression was suppressed.

6. A type of red yeast rice, characterized in that: The transcription factor MpTFAα in the red yeast rice was overexpressed.

Images