A composite microbial agent, a preparation method thereof and application thereof in synergistic promotion of antibiotic degradation and humification in pig manure aerobic composting

Abstract

The present application relates to a kind of composite microbial inoculant and its preparation method and its application in the antibiotic degradation-humification synergistic promotion of pig manure aerobic compost, belong to the field of livestock breeding waste resource utilization and environmental microorganism technology.The composite microbial inoculant described in the present application is composed of antibiotic degradation function bacteria and humification promotion function bacteria, wherein antibiotic degradation bacteria includes Candida OXB-5 and glutamic acid bacillus Z-1, humification promotion bacteria includes Bacillus subtilis GJ231, white cyst Lopharia GJ243 and Trichoderma longibrachiatum NT241;Preferably, solid composite microbial inoculant is prepared by taking biochar as carrier.The present application realizes the simultaneous intensification of antibiotic removal and maturity promotion in the process of pig manure aerobic compost by constructing "antibiotic degradation-organic matter decomposition-humification formation" synergistic system.Compared with prior art, the present application can improve the removal efficiency of tetracycline and quinolone antibiotics, promote the rapid heating of pile and prolong the high-temperature maintenance time, while improving the humus accumulation level and the stability of compost product, with the advantages of strong functional complementarity, high treatment efficiency and suitability for engineering application, etc.

Description

Technical Field

[0001] This invention relates to the field of resource utilization of livestock and poultry breeding waste and environmental microbiology technology, and in particular to a compound microbial agent and its preparation method, and its application in the synergistic promotion of antibiotic degradation and humification in aerobic composting of pig manure. Background Technology

[0002] In pig farming, antibiotics such as tetracyclines and quinolones are widely used. Some of these antibiotics, after being absorbed and metabolized by the animals, are still excreted in the feces as either maternal remains or metabolites, resulting in antibiotic residues in pig manure. If pig manure is returned to the fields without effective treatment, it may not only cause soil-crop system pollution but also increase the risk to the ecological environment of farmland.

[0003] Aerobic composting is an important technical route for the harmless and resource-based utilization of pig manure. Existing research shows that aerobic composting can reduce the antibiotic content in livestock and poultry manure to a certain extent and improve the stability and agricultural value of organic waste. However, traditional composting still has shortcomings in terms of efficient antibiotic removal and simultaneous enhancement of rapid composting and humification, especially for relatively difficult-to-degrade antibiotics such as quinolones. Relying solely on natural composting often makes it difficult to balance removal efficiency and composting quality.

[0004] Currently available technologies mostly focus on single degrading bacteria, single immobilized carriers, or single organic waste composting promoting bacteria. However, for the complex system of pig manure composting, it is usually difficult to achieve simultaneous antibiotic-directed degradation, organic matter decomposition, humus formation, and high-temperature process enhancement if relying solely on a single strain.

[0005] Therefore, it is necessary to develop a compound microbial agent that combines antibiotic degradation and humification promotion functions to solve the problems of low antibiotic removal efficiency, unstable heating process and slow composting process in traditional aerobic composting of pig manure. Summary of the Invention

[0006] To address the above technical problems, this invention provides a compound microbial agent, its preparation method, and its application in the synergistic promotion of antibiotic degradation and humification in aerobic composting of pig manure. This invention constructs a synergistic system of "antibiotic degradation - organic matter decomposition - humification formation," achieving simultaneous enhancement of antibiotic removal and composting promotion during aerobic composting of pig manure. Compared with existing technologies, this invention can improve the removal efficiency of tetracycline and quinolone antibiotics, promote rapid temperature rise in the compost pile and prolong the high-temperature maintenance time, while simultaneously improving the humus accumulation level and compost product stability. It has advantages such as strong functional complementarity, high treatment efficiency, and suitability for engineering applications.

[0007] The first objective of this invention is to provide a compound microbial agent comprising antibiotic-degrading bacteria and humification-promoting bacteria; The antibiotic-degrading bacteria include Candida albicans OXB-5 and / or Bacillus glutamate Z-1; The humification-promoting bacteria include one or more of Bacillus subtilis GJ231, Trichoderma spp. GJ243, and Trichoderma longifolia NT241.

[0008] A second objective of the present invention is to provide a solid composite microbial agent, comprising a carrier and a composite microbial agent loaded on the surface of the carrier.

[0009] In some embodiments of the present invention, the carrier includes one or more of biochar, edible fungi residue, crop straw, and wood chips.

[0010] A third objective of this invention is to provide a method for preparing the aforementioned solid composite microbial agent, comprising the following steps: (1) Activate Candida albicans OXB-5, Bacillus glutamate Z-1, Bacillus subtilis GJ231, Trichoderma truncatula GJ243 and Trichoderma longifolia NT241 respectively; and culture them to the target concentration to obtain bacterial solutions; (2) Mix and combine the various bacterial solutions to obtain a liquid compound bacterial agent; (3) The sterilized biochar is mixed with the liquid composite microbial agent to obtain a solid composite microbial agent.

[0011] In some embodiments of the present invention, in step (1), the target concentrations are: the concentration of bacterial culture is OD600 1.0~1.2, and the concentration of fungal culture is OD520 1.0~1.2.

[0012] In some embodiments of the present invention, in step (2), the volume ratio of *Candida OXB-5* culture, *Glutamicinus Z-1* culture, *Bacillus subtilis* DW251 culture, *Alternaria alternata* GJ243 culture, and *Trichoderma longifolia* NT241 culture is (0.8~1.2):(0.8~1.2):(0.8~1.2):(0.8~1.2):(0.8~1.2). Preferably, the volume ratio is 1:1:1:1:1.

[0013] In some embodiments of the present invention, in step (3), the liquid-to-solid ratio of the liquid composite bacterial agent to the biochar is 2-4 L / kg.

[0014] In some embodiments of the present invention, step (3) further includes low-temperature drying: the temperature is 30-40°C, and the product is dried to constant weight. During the drying process, the temperature is controlled not to exceed 40°C in order to reduce the impact of drying treatment on the activity of the cells.

[0015] A fourth objective of this invention is to provide the application of the aforementioned compound bacterial agent and the aforementioned solid compound bacterial agent in the removal of tetracycline and quinolone antibiotics.

[0016] The fifth objective of this invention is to provide the application of the aforementioned compound microbial agent and the aforementioned solid compound microbial agent in aerobic composting of pig manure.

[0017] In some embodiments of the present invention, the composite microbial agent or the solid composite microbial agent is added to an aerobic composting system with pig manure as the main component and microbial residue to adjust the carbon-nitrogen ratio and moisture content, so as to promote the removal of tetracycline and quinolone antibiotics and improve the degree of humification.

[0018] In some embodiments of the present invention, the compound microbial agent or the solid compound microbial agent is added at 1% to 4% of the dry weight of the compost substrate.

[0019] The technical solution of the present invention has the following advantages compared with the prior art: Firstly, by combining antibiotic-degrading bacteria with humification-promoting bacteria, a synergistic enhancement of antibiotic removal, pile heating, and decomposition promotion was achieved.

[0020] Secondly, an application pathway coupling targeted degradation and composting processes was established for tetracycline and quinolone antibiotics.

[0021] Third, the preparation of solid bacterial agents using biochar loading is beneficial for the fixation, preservation, and engineered application of bacterial cells.

[0022] The compound microbial agent of this invention is suitable for the aerobic composting process of pig manure. It can improve the removal rate of target antibiotics, enhance the ability to maintain high temperature, and promote the accumulation of humus and the improvement of seed germination index, thereby improving the quality of compost products. Attached Figure Description

[0023] To make the content of this invention easier to understand, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings, wherein... Figure 1 The figure shows the results of the antagonistic experiment among various functional strains.

[0024] Figure 2 The images show the actual strains of each functional strain of this invention.

[0025] Figure 3 This is a temperature change diagram showing the application of the biochar-based solid composite microbial agent of the present invention in the aerobic composting process of pig manure.

[0026] Figure 4 This is a graph showing the changes in humus (HS) and seed germination index (GI) during the composting process of the biochar-based solid composite microbial agent of this invention.

[0027] Figure 5 This is a graph showing the changes in the total concentration and removal rate of the target antibiotics at each stage of composting with the biochar-based solid composite microbial agent of this invention. Detailed Implementation

[0028] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.

[0029] The main culture media and reagents involved in this application include: 1. LB liquid medium: 5.0 g yeast extract, 10.0 g tryptone, 10.0 g sodium chloride, 1.0 L ultrapure water, pH 7.0~7.5, sterilized at 121 ℃ for 20 min.

[0030] 2. LB solid medium: 5.0 g yeast extract, 10.0 g tryptone, 10.0 g sodium chloride, 20.0 g agar, 1.0 L ultrapure water, pH 7.0±0.1, sterilized at 121 ℃ for 20 min.

[0031] 3. PDB medium: 200.0 g potato, 20.0 g glucose, 1.0 L ultrapure water, pH 7.0~7.5, sterilized at 121 ℃ for 20 min.

[0032] 4. PDA medium: 200.0 g potato, 20.0 g glucose, 20.0 g agar, 1.0 L ultrapure water, pH at rest, sterilized at 121 ℃ for 20 min.

[0033] 5. Inorganic salt culture medium: 1.0 g sodium chloride, 2.0 g sodium sulfate, 2.0 g potassium dihydrogen phosphate, 0.6 g magnesium chloride hexahydrate, 0.3 g ammonium chloride, 0.5 g potassium chloride, 0.1 g calcium chloride, 1.0 L ultrapure water, pH 7±0.1, sterilized at 121 ℃ for 20 min.

[0034] 6. Antibiotic-containing inorganic salt culture medium: Take 1 L of sterilized inorganic salt culture medium and place it in a laminar flow hood to cool to room temperature; then, under aseptic conditions, accurately weigh the required dose of antibiotic powder and add it to the culture medium. If the target antibiotic dosage is low and direct weighing has a large error, a high-concentration stock solution can be prepared first, and then quantitatively transferred to the basal culture medium, followed by sonication for 30 min to ensure uniform dissolution of the antibiotic.

[0035] 7. Information on the strain used in this invention: Trichoderma longibrachiatum NT241 is deposited at the China General Microbiological Culture Collection Center (CGMCC) on April 7, 2024, with accession number CGMCC No. 41139.

[0036] The aforementioned *Irpex lacteus* GJ243 is deposited at the China General Microbiological Culture Collection Center (CGMCC) on April 7, 2024, with accession number CGMCC No. 41281.

[0037] The Bacillus subtilis GJ231 strain is deposited at the China General Microbiological Culture Collection Center (CGMCC) on August 4, 2023, with accession number CGMCC No. 28101.

[0038] The Candida pseudoglaebosa strain OXB-5 is deposited at the China General Microbiological Culture Collection Center (CGMCC), classified as Candida pseudoglaebosa, with accession number CGMCC No. 38559, and deposited on May 6, 2026.

[0039] The *Glutamicibacter mysorens* strain Z-1 is deposited at the China General Microbiological Culture Collection Center (CGMCC), classified and named as *Glutamicibacter mysorens*, with accession number CGMCC No. 38560, and deposited on May 6, 2026.

[0040] Table 1. Degradation effect of degrading bacteria on antibiotics after 7 days

[0041] Example 1: Isolation and Purification of Strains 1. Acclimation: Appropriate amounts of pig manure and pig manure organic fertilizer were collected from Pingba District, Anshun City, Guizhou Province as screening samples. The target antibiotic was used as the sole carbon source to acclimate the microorganisms in the environmental samples. 10 g of each environmental sample (screening sample) was weighed and placed in 90 mL of ultrapure water into a 250 mL Erlenmeyer flask. The flask was then shaken at 30 ℃ and 150 r / min for 3 h. After standing for 30 min, 5 mL of the supernatant was transferred to 45 mL of inorganic salt medium containing 100 μg / L tetracycline or ciprofloxacin and cultured at 30 ℃ and 150 r / min for 7 days. Subsequently, the culture was serially transferred at a 10% volume ratio to higher concentrations of antibiotic medium, with concentration gradients of 100, 200, 300, 500, 800, 1000, 2000, and 5000 μg / L.

[0042] 2. Isolation and Purification: The bacterial strain was isolated using the dilution-spreading method. After acclimatization, the bacterial suspension was serially diluted with sterile water to 10⁻⁶. -8Dilution: 100 μL of bacterial suspension at different dilution ratios was spread onto corresponding agar plates and incubated at suitable temperatures. Single colonies with significant morphological differences were picked and streaked multiple times for purification to obtain pure culture strains, namely OZB-1, OZB-2, OXB-1, OXB-2, OXB-3, OXB-4, OXB-5, OXB-6, OXB-7, and TZB-1, TXB-1, Z-1, TXB-3.

[0043] Example 2 Functional Validation of a Single Strain 1. Functional Validation: The selected bacteria were expanded using LB medium, and the selected fungi were expanded using PDB or PDA medium, culturing until the OD600 and OD520 of both bacterial and fungal cultures were approximately 1.0. Under aseptic conditions, 1 mL of bacterial culture was added to 49 mL of 5 mg / L tetracycline or ciprofloxacin inorganic salt medium to construct degradation systems; three parallel samples and one blank control group were also set up. After 7 days of culture, the residual concentration of the target antibiotic was measured and the degradation rate was calculated.

[0044] Table 2 Cellulase activity of cellulose-degrading bacteria

[0045] 2. Detection of antibiotics in liquid inorganic salt culture medium: Take 1 mL of culture system solution and dilute it to 50 mL with sterile water; add 0.1 g EDTA-2Na, let it stand at room temperature for 1 h, adjust the pH of the water sample to 3.0 with dilute hydrochloric acid, filter it through a 0.22 μm filter membrane, and determine the concentration of the target antibiotic using liquid chromatography-tandem mass spectrometry.

[0046] Based on the comparison of degradation performance, Candida albicans OXB-5 showed high degradation activity against ciprofloxacin, with a degradation rate of 77.74% after 7 days; Bacillus glutamate Z-1 showed better degradation effect against tetracycline, with a degradation rate of 89.73% after 7 days. The results are shown in Table 1.

[0047] Example 3 Preparation of Liquid Compound Microbial Agent To meet the requirements for promoting organic matter decomposition and humification, *Bacillus subtilis* GJ231, *Trichoderma harzianum* GJ243, and *Trichoderma longicornis* NT241, which exhibit good cellulose degradation performance, were selected as compound strains and combined with *Candida albicans* OXB-5 and *Bacillus glutamate* Z-1. Inter-strain antagonism experiments verified that there was no significant antagonistic effect among the functional bacteria, making them suitable for constructing a compound bacterial agent. The five functional bacteria were cultured separately to their target absorbance values ​​(OD600 or OD520, after subtracting the blank value, approximately 1), and then mixed in equal volume ratios to prepare a liquid compound bacterial agent.

[0048] Example 4: Antibiotic Degradation Effect of Liquid Compound Microbial Agent A 7-day antibiotic degradation experiment was conducted using a liquid compound microbial agent to test its degradation effects on tetracycline (TET) and ciprofloxacin (CIP). The results showed that the compound microbial agent achieved a degradation rate of 89.15% for tetracycline and 89.32% for ciprofloxacin within 7 days. Compared to single strains, the compound microbial agent exhibited a more significant synergistic enhancement effect in the degradation of ciprofloxacin, indicating that the combination of multifunctional strains is beneficial for improving the overall degradation performance of the compound system.

[0049] Example 5: Strain Identification

[0050] Molecular biology sequencing techniques were used to identify strains OXB-5 and Z-1. Genomic DNA was extracted from strain OXB-5, and PCR amplification, sequencing, and sequence alignment were performed using fungal primers ITS1 and ITS4. The results showed high homology with the sequence of the type strain of *Candida* sp. Genomic DNA was extracted from strain Z-1, and PCR amplification, sequencing, and sequence alignment were performed using universal primers for the bacterial 16S rRNA gene. The results showed high homology with the sequence of the type strain of *Glutamicibacter* sp.

[0051] The sequence of the OXB-5 genomic DNA is shown in SEQ ID NO 1: GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGTATTCTATTGCCTGCGCTTAATTGCGCGGCGATAAACCTTACACAACGTGTTTTTTTAATATAAACTATTACTTTGGTTTGGCTAAGAAATTAGTTGAGCCAGAGGTGATTTAAACTTCAATTTTATTGAATTGTTATTTTAATTTTATGTCAATTTGTTGATTAAATTCAAAACAATCTTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATATGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCACCCTCTGGTATTCCAGAGGGTATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCTTTGGGTTTGGTATTGAGTGATACTCTTAGTCGAACTAGGCGTTTGCTTGAAATATATTGGCACGAGTAGTGTTGAACAGTGTTGTCTGAACATCAATGTATTAGGTTTATCCAACTCGTTGAAGCGTTTAGGTATTACTATTCTTCATTAGGCTTTGCCTTATAAAACACAAACAAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAA。

[0052] The sequence of the Z-1 genomic DNA is shown in SEQ ID NO 2:

[0053] Example 6: Optimization of growth conditions and preparation of solid compound microbial agent Based on the selection of suitable ranges for each variable through single-factor experiments, a response surface methodology was designed using Design-Expert 13.0 software. Using strain growth as the response value, the effects and interactions of three key variables—temperature, initial pH, and inoculum size—on strain growth were systematically investigated. By establishing regression models and analyzing response surfaces, the optimization results for the culture conditions of each core strain were obtained, as shown in Table 3.

[0054] Before optimizing the experiment, seed culture needs to be prepared to ensure that the inoculated bacterial cells have consistent activity and uniform concentration. The specific operation is as follows: the target bacteria are inoculated into LB liquid medium and the fungi are inoculated into PDB liquid medium, and then cultured with shaking until the logarithmic growth phase, while controlling the OD600 of the bacterial culture and the OD520 of the fungal culture to be approximately 1.0.

[0055] Table 3 Results of optimization of culture conditions for each core strain

[0056] After completing the strain antagonism test and fermentation process optimization, the target strains were cultured to achieve bacterial OD600 of 1.0-1.2 and fungal OD520 of 1.0-1.2, respectively. Separately, biochar (purchased commercially from "Tanluzhe" - Gongyi Shengxiang Activated Carbon Business Department) was sterilized at 121 ℃ and 0.1 MPa for 20 min and cooled for later use. The sterilized biochar was thoroughly mixed with the liquid composite bacterial agent at a solid-liquid ratio of 1 g: 2 mL, and stirred evenly in a sterile container to ensure complete adsorption of the bacteria onto the biochar surface. Subsequently, it was dried at 35 ℃ to constant weight to obtain the biochar-based solid composite bacterial agent.

[0057] Example 7: Effect of compound microbial agent on aerobic composting of pig manure An aerobic composting system was constructed using pig manure as the main raw material and microbial residue as an auxiliary material, with a carbon-to-nitrogen ratio adjusted to 20-25:1 and a moisture content of 55%-60%. A blank control group, a group with 1% biochar-based solid compound microbial agent (experimental group 1), and a group with 4% biochar-based solid compound microbial agent (experimental group 2) were set up for a 45-day composting experiment. Temperature, humification indicators, and antibiotic concentration changes were monitored during the composting process. Experimental results are shown below. Figures 3-5 .

[0058] Depend on Figure 3It is evident that the microbial treatment of the present invention can significantly improve the composting temperature rise characteristics and promote decomposition. Compared with the blank control group, both the 1% and 4% biochar-based solid composite microbial agent addition groups showed faster temperature rise rates and stronger high-temperature maintenance capabilities; among them, the 4% biochar-based solid composite microbial agent addition group had the highest peak temperature, and both the 1% and 4% biochar-based solid composite microbial agent addition groups met the relevant hygienic requirements of GB / T 36195-2018.

[0059] Depend on Figure 4 It can be seen that the seed germination rate (GI) decreased in the early stage and increased significantly in the later stage, indicating that as composting progresses, low-molecular-weight organic acids, free ammonia, and some intermediate metabolites are gradually degraded or transformed, reducing phytotoxicity and continuously improving compost maturity. The continuous increase in HS indicates that organic matter is continuously transformed into more stable humic substances during pig manure composting. The treatment with 4% biochar-based solid composite microbial agent had the highest endpoint value, indicating that a higher addition amount is more conducive to promoting humic accumulation.

[0060] Depend on Figure 5 It can be seen that the total removal rates of the target antibiotics in experimental groups 1 and 2 reached 95.23% and 94.82% respectively, which were significantly higher than the 78.41% of the blank group. This indicates that the biochar-based solid composite microbial agent of the present invention can effectively enhance the removal of antibiotics during the aerobic composting process of pig manure and improve the stability and application value of compost products.

[0061] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. A compound microbial agent, characterized in that, Including antibiotic-degrading bacteria and humification-promoting bacteria; The antibiotic-degrading bacteria include Candida albicans OXB-5 and / or Bacillus glutamate Z-1; The humification-promoting bacteria include one or more of Bacillus subtilis GJ231, Trichoderma spp. GJ243, and Trichoderma longibranch NT241. The Candida pseudoglaebosa strain OXB-5 is deposited at the China General Microbiological Culture Collection Center (CGMCC), classified and named as Candida pseudoglaebosa, with accession number CGMCC No. 38559 and deposit date of May 6, 2026. The *Glutamicibacter mysorens* strain Z-1 is deposited at the China General Microbiological Culture Collection Center (CGMCC), classified and named as *Glutamicibacter mysorens*, with accession number CGMCC No. 38560, and deposited on May 6, 2026.

2. A solid compound microbial agent, characterized in that, It includes a carrier and the composite microbial agent of claim 1 loaded on the surface of the carrier.

3. The solid composite microbial agent according to claim 2, characterized in that, The carrier includes one or more of biochar, edible fungus residue, crop straw, and wood chips.

4. A method for preparing the solid composite microbial agent as described in claim 2 or 3, characterized in that, Includes the following steps: (1) Activate Candida albicans OXB-5, Bacillus glutamate Z-1, Bacillus subtilis DW251, Trichoderma truncatula GJ243 and Trichoderma longifolia NT241 respectively; and culture them to the target concentration to obtain bacterial solutions; (2) Mix and combine the various bacterial solutions to obtain a liquid compound bacterial agent; (3) The sterilized biochar is mixed with the liquid composite microbial agent to obtain a solid composite microbial agent.

5. The preparation method according to claim 4, characterized in that, In step (1), the target concentrations are: OD600 1.0~1.2 for bacterial culture and OD520 1.0~1.2 for fungal culture.

6. The preparation method according to claim 4, characterized in that, In step (2), the volume ratio of Candida OXB-5, Bacillus glutamate Z-1, Bacillus subtilis DW251, Trichoderma gracilis GJ243, and Trichoderma longifolia NT241 is (0.8~1.2):(0.8~1.2):(0.8~1.2):(0.8~1.2):(0.8~1.2).

7. The preparation method according to claim 4, characterized in that, In step (3), the liquid-to-solid ratio of the liquid compound microbial agent to biochar is 2-4 L / kg.

8. The preparation method according to claim 4, characterized in that, Step (3) also includes low-temperature drying: the temperature is 30~40℃.

9. The use of the compound microbial agent according to claim 1, or the solid compound microbial agent according to claim 2 or 3, in the removal of tetracycline and quinolone antibiotics.

10. The application of the compound microbial agent according to claim 1, or the solid compound microbial agent according to claim 2 or 3, in aerobic composting of pig manure.

Images