Soybean root rot antagonistic bacteria jkdd4-3 strain and application thereof

Abstract

The application provides a soybean root rot antagonistic bacteria JKDD4-3 strain, the classification name of which is Meyerozyma guilliermondi, which is preserved in the China General Microbiological Culture Collection Center, and the preservation number is CGMCC NO.34756. The application determines that Fusarium commune and Fusarium armeniacum are pathogenic bacteria of soybean root rot, and the antagonistic bacteria JKDD4-3 with good inhibitory effect is screened by taking the pathogenic bacteria as a target bacteria, and the antagonistic bacteria JKDD4-3 has the potential to be developed into a special biocontrol agent.

Description

Technical Field

[0001] This invention relates to the field of microbial technology, specifically to a soybean root rot antagonist strain JKDD4-3 and its application. Background Technology

[0002] Soybean (Glycine max L.) is an important oilseed crop worldwide, playing a vital role in my country's economic development and widely welcomed as a nutritional supplement. Pests and diseases are significant factors affecting soybean production. Root rot is a soil-borne disease that primarily infects the base of the soybean stem and roots, causing root and stem decay. After emergence, the seedlings collapse, leading to slow growth, even complete plant death, and in severe cases, total crop failure. Reported pathogens causing soybean root rot mainly include Fusarium sp., Phytophthora sp., Pythium sp., and Rhizoctonia solani, with Fusarium being the predominant genus.

[0003] Currently, the control of soybean root rot in production mainly relies on chemical pesticides and seed dressing agents, which pollute soybeans and soil. While chemical pesticides help control soybean root rot to some extent, pathogen resistance is gradually increasing during pesticide use, and the large-scale use of chemical pesticides also causes a series of problems such as environmental pollution. Compared with chemical control, biological control, due to its advantages of being harmless to humans and animals and environmentally friendly, has become an important technology for sustainable agricultural development and represents the development trend of green control of plant diseases, with broad application prospects.

[0004] Biocontrol strains readily occupy ecological sites within the host, inhibiting the growth and reproduction of pathogens and improving the soil and rhizosphere microbial environment. Therefore, screening biocontrol strains with highly effective antagonistic effects against soybean root rot is of great significance. Summary of the Invention

[0005] To address the above technical problems, this invention isolated nine fungi from the diseased parts of soybean root rot and identified *Fusarium commune* and *Fusarium armeniacum* as the pathogens of soybean root rot. Meanwhile, the antagonistic bacterium JKDD4-3, obtained through plate confrontation screening, showed good antagonistic effects against these pathogens.

[0006] The technical solution adopted in this invention is as follows:

[0007] According to one aspect of this application, the present invention provides a soybean root rot antagonistic bacterium strain JKDD4-3, which was deposited on June 4, 2025, at the China General Microbiological Culture Collection Center (CGMCC, address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, 100101, China), classified as *Meyerozyma guilliermondis*, with accession number CGMCC No. 34756.

[0008] According to another aspect of this application, the present invention also provides that the sole active ingredient of the biocontrol agent is the JKDD4-3 strain.

[0009] In one specific embodiment, the biocontrol agent is a bacterial solution of strain JKDD4-3.

[0010] In one specific embodiment, the OD value of the bacterial solution is 0.2 to 0.6.

[0011] In one specific embodiment, the bacterial culture was obtained by inoculating JKDD4-3 strain into NA liquid medium and culturing it.

[0012] According to another aspect of this application, the present invention also provides the application of the described strains and any of the described biocontrol agents in the prevention and control of soybean root rot.

[0013] In one specific embodiment, the soybean root rot is caused by Fusarium communeh and / or Fusarium armeniacum.

[0014] According to another aspect of this application, the present invention also provides a method for preventing soybean root rot by applying the strain or any of the biocontrol agents described herein to the roots of soybeans.

[0015] The beneficial effects of the present invention include, but are not limited to:

[0016] This invention identifies Fusarium commune and Fusarium armeniacum as pathogens of soybean root rot through screening. Using the pathogens as target bacteria, it screens and obtains antagonistic bacteria JKDD4-3 with good inhibitory effects, which has the potential to be developed into a dedicated biocontrol agent. Attached Figure Description

[0017] Figure 1 Nine fungi were isolated from the diseased parts of soybean root rot;

[0018] Figure 2 Soybean plants infected with soybean root rot pathogen strains DD-1 and DD-2;

[0019] Figure 3 Inoculate the roots of diseased soybeans with the pathogenic bacteria strains DD-1 and DD-2 for soybean root rot;

[0020] Figure 4 Culture and morphological characteristics of soybean root rot pathogens DD-1 and DD-2; A: Colony morphology of DD-1; B: Colony morphology of DD-2; C: Conidial morphology of DD-1; D: Conidial morphology of DD-2;

[0021] Figure 5 Phylogenetic trees constructed based on the ITS sequences of strains DD-1 and DD-2;

[0022] Figure 6 The plate inhibition of strains JKDD4-3 and sg14 against the pathogen of soybean root rot is shown in the following: A: DD-1 control, B: JKDD4-3 antagonizing DD-1, C: sg14 antagonizing DD-1, D: DD-2 control, E: JKDD4-3 antagonizing DD-2, F: sg14 antagonizing DD-2.

[0023] Figure 7 Phylogenetic tree constructed based on the 16S rDNA sequence of strain JKDD4-3;

[0024] Figure 8 Images of bean sprouts emerging from the ground;

[0025] Figure 9 Images of diseased plants;

[0026] Figure 10 Images of potted plants from each treatment group;

[0027] Figure 11 Images of plants from each treatment group; Detailed Implementation

[0028] The present invention will be described in detail below with reference to specific embodiments. The following embodiments are only for the purpose of enabling those skilled in the art to understand the technical solutions of the present invention, implement or use the present invention, and are not intended to limit the scope of protection of the present invention.

[0029] In this invention, unless otherwise specified, all raw materials and equipment used can be purchased from the market or are commonly used in the field. Unless otherwise specified, the methods in the embodiments are conventional methods in the field.

[0030] Example 1: Isolation and Pathogenicity Determination of Pathogens

[0031] Sample collection from diseased plants: Five typical soybean root rot diseased plants were collected from replanted soybean fields in Groups 2 and 6 of Buzhan Village, Chabuchar Xibe Autonomous County, Ili Kazakh Autonomous Prefecture, using the "Z" shaped sampling method, with three replicates for each sample. At the same time, five samples of rhizosphere soil from healthy soybeans were collected, with three replicates for each sample, and placed in the laboratory of the collection area.

[0032] Isolation of pathogens: Wash the surface of diseased plants with tap water to remove dirt and sand. In a clean bench, disinfect the surface with 75% alcohol for 30 seconds, wash once with sterile water, disinfect with 3% NaClO for 3 minutes, and then wash three more times with sterile water. Take tissue from the junction of diseased and healthy tissue, cut it into 3mm × 3mm pieces, place them on PDA medium, and incubate at 28℃. Perform multiple purifications, number the pieces, and store them in a refrigerator at 4℃ for later use.

[0033] Pathogenicity assay: From the purified colonies of 9 fungi, a small amount of mycelial fragments were picked up with an inoculation loop and inoculated into PDA liquid medium. After incubation at 28℃ and 180 rpm / min for 5–7 days with shaking, the culture medium was filtered through 3 layers of sterile gauze to remove impurities, yielding 2.5 × 10⁻⁶ fungal colonies. 3 CFU / mL spore suspension. For the spore suspension root injection inoculation method, Xinong 9 soybean was used as the pot test variety. After 5-7 days of soybean growth, the soybean roots were punctured with a sterile syringe, and 0.2 mL of spore suspension was injected through the sterile syringe. Sterile water was used as a control. Ten plants were inoculated for each treatment. After inoculation, the plants were irrigated once with 100 mL of water. On the 7th day after inoculation, the disease status of the plants was photographed and recorded. After the plants developed symptoms, they were removed from the pots and the pathogen was re-isolated.

[0034] Through research, nine fungal strains were isolated and screened from soybean root rot samples, such as... Figure 1 As shown. The pathogenicity of these nine fungal strains was determined according to Koch's postulates, and the results are as follows. Figures 2-3 As shown, 7 days after inoculation with 9 fungi, large brown and dark brown spots appeared on the main roots of DD-1 and DD-2 plants. Above-ground growth was weak, leaves were yellow and small, plants were stunted, and branching was reduced.

[0035] like Figure 4 As shown, pure cultures of strain DD-1 on PDA exhibit abundant cottony white to pale purple hyphae. Conidia are sickle-shaped with blunt, rounded apical cells, spaced 3–4 times, and measure (10–20) μm × (3.5–5.8) μm. DD-2 on PDA exhibits abundant cottony yellow hyphae on the upper surface and orange hyphae on the lower surface. Conidia are sickle-shaped with blunt, rounded apical cells, spaced 3–7 times, and measure (12–30) μm × (3.08–5.40) μm.

[0036] Pathogen identification: Genomic DNA was extracted from the strain using a fungal genomic DNA extraction kit. ITS sequence PCR amplification system: 2.5 μL 10x PCR Buffer, 2 μL dNTPs (10 mmol / L), 1 μL ITS1, 1 μL ITS4, 0.25 μL Taq enzyme, 1 μL DNA template, 17.25 μL ddH2O. Amplification program: 94℃ for 4 min, 94℃ for 1 min, 55℃ for 1 min, 72℃ for 1 min, 33 cycles, 72℃ for 10 min, stored at 4℃. The synthesis of the universal ITS sequence primers ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) and the sequencing of the PCR products were performed by Chengdu Luoning Biotechnology Co., Ltd.

[0037] like Figure 5 As shown, pathogenic bacteria DD-1 and DD-2 were isolated from the diseased parts of soybean root rot. ITS sequencing results showed that DD-1 was Fusarium commune and DD-2 was Fusarium armeniacum.

[0038] Example 2 Isolation and Screening of Growth-Promoting Strains

[0039] Preparation of spore suspension: Pathogens DD-1 and DD-2 were activated on PDA medium. Activated mycelial blocks were inoculated into PDA liquid medium and cultured at 180 rpm and 28℃ for 5 days. The cultured suspension was filtered through two layers of gauze to obtain spore suspension, and its concentration was adjusted to 1×10⁻⁶ with distilled water. 7 CFU / mL.

[0040] Spray the pathogenic spore suspension onto solid NA medium that has already grown single colonies using a small spray bottle, and incubate at 28°C for 3 days. Pick up single colonies that show inhibition zones with an inoculation loop, streak them on NA plates, and culture them in pure culture until single colonies grow.

[0041] Screening was carried out using the plate confrontation method. A 1 cm diameter block of soybean root rot pathogen mycelium was inoculated in the center of a PDA plate, and a single colony was inoculated 2 cm away from the mycelium block. The plates were incubated at 28°C for 3-5 days, and the presence and size of inhibition zones were recorded.

[0042] like Figure 6As shown in Table 1, the antibacterial activity of the two bacteria against DD-1 and DD-2 was determined by the plate confrontation method. The inhibition rates of strain JKDD4-3 against DD-1 and DD-2 were 64.75% and 57.81%, respectively, while the inhibition rates of strain sg14 against DD-1 and DD-2 were 62.35% and 51.56%, respectively.

[0043] Table 1. Plate inhibition effect of antagonistic bacteria on soybean root rot diseases DD-1 and DD-2

[0044]

[0045] 16S rDNA Sequencing: Bacterial DNA was extracted using the freeze-thaw method. A small number of single colonies of purified bacteria cultured on NA solid medium were picked up with a sterile inoculation loop and placed into a sterile centrifuge tube containing 30 μL of sterile water. The tube was shaken to thoroughly mix the bacteria and sterile water. The centrifuge tube containing the bacterial culture was then frozen in liquid nitrogen for 10 min, immediately placed on a floating tray, and incubated in boiling water for 5 min. Afterward, it was centrifuged at 12000 r / min for 2 min. The supernatant in the centrifuge tube was the DNA template. The main instruments and equipment used were as follows: DNA was extracted using the bacterial genomic DNA kit from Sangon Biotech (Shanghai) Co., Ltd. as the template. PCR amplification was performed using universal bacterial primers 27F and 1492R. The PCR reaction system was 30 μL: 15 μL LiX, 2 μL template, 11 μL dd H2O, 1 μL upper primer, and 1 μL lower primer. The PCR products were detected by 1.0% agarose gel electrophoresis (Table 2). Completed by Luo Ning Biotechnology Co., Ltd.

[0046] Table 2. Strain identification and related primer sequences

[0047] 16S rDNA 27F1492R 5'-AGAGTTTGATCCTGGCTCAG-3'5'-GGTTACCTTGTTACGACTT-3' 1500

[0048] The 16S rRNA fragment of the genome of the antagonistic bacterium JKDD4-3 was amplified by PCR and sequenced, yielding a fragment approximately 1500 bp in length. Homology alignment of the sequencing results was performed, and a phylogenetic tree was constructed. Figure 7 As shown, 16S rDNA sequencing results indicate that the antagonistic bacterium JKDD4-3 is Meyerozyma guilliermondii.

[0049] Strain JKDD4-3 was deposited on June 4, 2025, at the China General Microbiological Culture Collection Center (CGMCC, address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, 100101, China), and classified as *Meyerozyma guilliermondii*, with accession number CGMCCNo. 35756.

[0050] Example 3: Biocontrol Bacteria Experiment for Soybean Root Rot

[0051] Experimental location: Urumqi Comprehensive Experimental Station, Xinjiang Uygur Autonomous Region Academy of Agricultural Sciences

[0052] Experimental crop: soybean seedlings, obtained from planting before the experiment.

[0053] Test bacterial agents: pathogenic bacterium DD-1 and antagonistic bacterium JKDD4-3. The pathogenic bacterium and antagonistic bacterium were laboratory-preserved strains.

[0054] Test methods: Four treatments were set up as follows: the biocontrol group was treated with only antagonistic bacteria JKDD4-3; the pathogen group was treated with only pathogen DD-1; the treatment group was treated with pathogen DD-1 first, followed by antagonistic bacteria JKDD4-3 one week later; and the control group was treated with antagonistic bacteria JKDD4-3 first, followed by pathogen DD-1 one week later. 20 mL of pathogen DD-1 and 40 mL of antagonistic bacteria JKDD4-3 were inoculated, and the concentration of each bacterial suspension was adjusted to 1×10⁻⁶. 8 CFU / mL, 10 soybean seedlings per treatment, 3 replicates per treatment, see Table 3 for details of each treatment group.

[0055] Table 3. Potted Plant Experiment Groups

[0056] Biological control group JKDD4-3 Pathogen group DD-1 Treatment group DD-1+JKDD4-3 Prevention and control group JKDD4-3+DD-1

[0057] Investigation and statistical methods: During the experiment, the growth and disease changes of bean seedlings were observed by taking photos. At the end of the experiment (April 4th-April 24th), the plant height, root length, and disease incidence of bean seedlings in different experimental groups were measured and statistically analyzed. Finally, the peroxidase (POD) content in the root tissue of each treatment group was detected.

[0058] Experimental results:

[0059] 1. Growth status of bean sprouts

[0060] Sowing was carried out on April 4th. Before sowing, pathogen DD-1 from the pathogen group and treatment group, and antagonistic bacteria JKDD4-3 from the biocontrol group and prevention group were applied to the soil respectively, followed by sowing; soybean seedlings emerged on April 8th; germination occurred on April 10th; on April 11th, antagonistic bacteria JKDD4-3 from the treatment group and pathogen DD-1 from the prevention group were applied to the soil of the corresponding treatment groups; a large number of seedlings emerged on April 13th. Figure 8 The overall growth rhythm was normal; on April 15th, some potted plants showed obvious disease, mainly manifested as almost no fine root hairs at the base. Figure 9 This is consistent with the characteristics of root rot or damping-off. By April 24th, the plants had generally entered the four-leaf stage and begun internode elongation. Figure 10 At this point, the final number of plants was recorded and various indicators were measured.

[0061] In summary, the bean sprouts are growing normally, but there are signs of disease. Figure 10 It can be seen that there are differences between the different treatment groups, and further analysis can be carried out.

[0062] 1. Physiological indicator analysis

[0063] The initial and final number of plants in each treatment group were statistically analyzed (see Table 4) to determine the disease incidence during the growth period; plant height and root length in each treatment group were also statistically analyzed (Table 5). Seedling growth in each treatment group is shown below. Figure 11 .

[0064] As shown in Table 4, regarding plant height: the biocontrol group was the tallest (20.12 cm), followed by the control group (19.42 cm), and the treatment group was the shortest (17.91 cm). The treatment group showed the most significant growth inhibition due to root damage from early disease onset. Regarding root length: the biocontrol group had the longest (11.78 cm), followed by the control group (10.83 cm), the treatment group (10.37 cm), and the pathogen group had the shortest (10.22 cm). This indicates that antagonistic bacteria promote root development, while pathogens inhibit root growth. The pathogen group had the largest standard deviation and variance in plant height and root length, indicating uneven disease severity and severe damage to some plants; the control group had the smallest variance, showing the most uniform plant growth and reflecting the stable effectiveness of early prevention.

[0065] Table 4 Plant height and root length of each treatment group

[0066]

[0067] Note: The number of dead plants is the difference between the number of plants on day 24 and the number of plants on day 15. A positive number indicates positive growth, and a negative number indicates the number of dead plants.

[0068] Table 5. Incidence of disease in each treatment group

[0069] Biological control group 30 13 43.33 13 0 Pathogen group 30 14 46.67 9 -5 Treatment group 30 20 66.67 15 -5 Prevention and control group 30 17 56.67 16 -1

[0070] As shown in Table 5, there were no deaths in the biocontrol group, indicating that the antagonistic bacteria themselves are safe for the plants and may even promote growth. Five plants died in the pathogen group, confirming the strong pathogenicity of DD-1. Five plants died in the treatment group, the same number as in the pathogen group, indicating that applying antagonistic bacteria after the onset of disease is unlikely to reverse the damage already caused. Only one plant died in the control group, showing the lowest mortality rate, indicating that early application of antagonistic bacteria significantly reduced the mortality rate.

[0071] In summary, preventive inoculation with the antagonistic bacterium JKDD4-3 can significantly reduce the mortality rate of root rot and promote plant height and root length growth, with better results than treatment after the onset of the disease.

[0072] Pot experiments have shown that the antagonistic bacterium JKDD4-3 is effective in preventing soybean root rot.

Claims

1. A soybean root rot antagonistic bacterium strain JKDD4-3, characterized in that, Its classification name is Meyerozyma guilliermondi, and it is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.34756.

2. A biocontrol agent, characterized in that, The sole active ingredient of the biocontrol agent is the JKDD4-3 strain as described in claim 1.

3. The biocontrol agent according to claim 2, characterized in that, The biocontrol agent is a bacterial solution of strain JKDD4-3.

4. The biocontrol agent according to claim 2, characterized in that, The OD value of the bacterial solution is 0.2 to 0.

6.

5. The biocontrol agent according to claim 4, characterized in that, The bacterial culture was obtained by inoculating JKDD4-3 strain into NA liquid medium and culturing it.

6. The application of the strain according to claim 1 and the biocontrol agent according to any one of claims 2-5 in the control of soybean root rot.

7. The application according to claim 6, characterized in that, The soybean root rot is caused by Fusarium communeh and / or Fusarium armeniacum.

8. A method for preventing and controlling soybean root rot, characterized in that, Apply the strain described in claim 1 or the biocontrol agent described in any one of claims 2-5 to the roots of soybeans.

Images