A yeast strain producing sialic acid-modified human glycosylated proteins
Patent Information
- Application Number
- CN202610763238.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-05-29
- Publication Date
- 2026-08-21
AI Technical Summary
[0004]构建能够进行唾液酸化修饰的人源N-糖基化菌株是一项复杂的系统工程,目前仍存在一些技术缺陷和挑战
(1)本发明构建了新的法夫驹形氏酵母工程菌株ChJ-Sia,可高效制备糖链为Sia2Gal2GlcNac2Man3GlcNac2的唾液酸化N-糖基化蛋白,同时实现了降低重组蛋白的免疫原性和延长糖蛋白体内半衰期的效果,大幅提升药用及应用价值。
Smart Images

Figure CN122609392A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a yeast strain that produces sialic acid-modified human glycosylated proteins, belonging to the field of biomedical technology. Background Technology
[0002] Glycosylation is one of the most common post-translational modifications of proteins and a core component of the extracellular matrix. As a key biological regulatory mechanism, it participates extensively in physiological processes by regulating cytokine expression and activity. In the biopharmaceutical field, achieving humanized glycosylation can significantly optimize the physicochemical properties of drugs, playing a decisive role in safety and efficacy. Among them, sialylation-modified N-glycosylated recombinant protein drugs can effectively improve the physicochemical properties of therapeutic proteins, such as prolonging half-life, enhancing tissue penetration, and inhibiting inflammatory responses. However, the efficiency of N-glycosylation and sialylation is difficult to achieve 100%, posing challenges to the homogenization and large-scale production of sialylated recombinant proteins. Therefore, improving the homogenization of human-like N-glycosylated therapeutic recombinant proteins remains a core objective in the development of glycoprotein drugs.
[0003] Sialic acids (SAs) are a family of nine-carbon monosaccharides whose molecular structure includes a carboxyl group, typically located on the cell surface and at the N- or O-terminus of secreted glycoconjugates. They are linked to galactose (Gal) or N-acetylgalactosamine (GalNAc) via α-2,3 / α-2,6 bonds, or to another sialic acid unit via α-2,8 / α-2,9 bonds. Specific bonding patterns are regulated by specific glycosyltransferases. N-acetylneuraminic acid (Neu5Ac) and N-hydroxyacetylneuraminic acid (Neu5Gc) are the main types. The negative charge and terminal localization of sialic acids enable them to participate in various physiological and pathological processes, including cell-cell interactions, activation, differentiation, transformation, and migration, thereby enhancing molecular binding capacity and promoting intracellular transport of drugs and ions. Simultaneously, sialylation can enhance the resistance of glycoproteins to glycosidases and proteases, effectively prolonging their half-life and maintaining their biological activity. Glycans modified with different sialic acid glycan epitopes can also endow recombinant proteins with multiple biological functions: in vivo studies have shown that sialic acid modification can regulate the complement system, reduce immunogenicity, and play a key role in inflammation and tumor development.
[0004] Constructing human N-glycosylated strains capable of sialylation modification is a complex systems engineering project, and several technical limitations and challenges remain. Commonly used bacterial chassis cell factories (such as *E. coli* and *Bacillus*) do not possess the de novo synthesis capabilities for protein N-glycosylation and sialic acid under natural conditions. This means that a complex exogenous enzyme system must be introduced from scratch through genetic engineering, encompassing multiple stages including glycan synthesis, transport, protein linkage, and sialic acid synthesis and transfer—a highly technically challenging process. Animal cells, on the other hand, face issues such as high culture costs and stringent production environment requirements, limiting their large-scale, low-cost production. Existing engineered yeast cells struggle to achieve efficient and uniform glycosylation modification, with the most critical terminal sialylation step achieving only 60-70% efficiency. This can affect the efficacy of drugs in vivo.
[0005] Therefore, the efficient and homogenized production of sialylated N-glycosylated recombinant proteins through engineered cell factories is becoming a hot topic in the research and development of glycosylated therapeutic drugs, and has significant application prospects. Summary of the Invention
[0006] To address the above shortcomings, this invention provides a method for preparing sialylated N-glycosylated proteins from *Phaeocotyle phrysalis* Chj-Sia. The specific technical solution of this invention is as follows: This invention provides genetically engineered bacteria that express one or more of the following genes: galactose-1-phosphate uridine transferase gene, UDP-4-epimerase gene, and sialic acid transferase gene.
[0007] In one embodiment, the genetically engineered bacteria is *Phaeodactylum fafesumi* (…). Komagataella phaffii ChJ0010 is the starting strain; the *Phaeocotyledon* ChJ0010 was deposited on December 19, 2025, at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: M 20252965, located at Wuhan University, Wuhan, China.
[0008] In one embodiment, the genetically engineered bacteria expresses a galactose-1-phosphate uridine transferase derived from Drosophila, enabling the constructed genetically engineered bacteria to ferment and prepare a glycoprotein with N-glycosyl sugar chains GalGlcNac2Man3GlcNac2; the encoding gene of the galactose-1-phosphate uridine transferase is shown in SEQ ID NO.2.
[0009] In one embodiment, the galactose-1-phosphate uridine transferase gene is integrated into the PNS IV-4 site, and the N20 sequence recognizing PNS IV-4 is TGTCAAATGAAAAAGATACG.
[0010] In one embodiment, the genetically engineered bacteria also expresses a UDP-4-epimerase gene derived from Bacillus anthracis, which can be fermented to prepare a glycoprotein with N-glycosyl sugar chains Gal2GlcNac2Man3GlcNac2; the nucleotide sequence of the UDP-4-epimerase gene is shown in SEQ ID NO.3.
[0011] In one embodiment, the UDP-4-epimerase gene is integrated into the PNSⅣ-7 site, and the N20 sequence recognizing PNSⅣ-7 is TCTCGATGGACGGATAACAG.
[0012] In one embodiment, the genetically engineered bacteria also expresses a sialyl transferase derived from Campylobacter jejuni, which can be fermented to prepare a glycoprotein with sialylated N-glycosyl sugar chains Sia2Gal2GlcNac2Man3GlcNac2; the encoding gene of the sialyl transferase is shown in SEQ ID NO.4.
[0013] In one embodiment, the gene encoding the sialyl transferase is integrated into the PNS IV-11 site; the N20 sequence recognizing the PNS IV-11 site is TATAAGTTGATCAAAACCTG.
[0014] In one embodiment, the genetically engineered bacteria can express proteins with N-glycosylation modifications; the N-glycosylation modifications include, but are not limited to, at least one of GalGlcNac2Man3GlcNac2, Gal2GlcNac2Man3GlcNac2, or Sia2Gal2GlcNac2Man3GlcNac2.
[0015] In one embodiment, the protein used to demonstrate the changes in the glycan chain is glucose oxidase; the nucleotide sequence of the gene encoding glucose oxidase, aGOD, is shown in SEQ ID NO: 1.
[0016] In one embodiment, the genetically engineered bacteria is *Phaeodactylus fafelicis* (…). Komagataella phaffii ChJ-Sia; The *Phaeodactylum phalloides* ChJ-Sia was deposited at the China Center for Type Culture Collection on April 20, 2026, with accession number CCTCC NO: M 2026737; The *Phaeodactylum phalloides* ChJ-Sia can modify the produced protein with sialylation N-glycosylation, prolonging the half-life of the drug protein in the human body and reducing the corresponding immune response, showing good application prospects in the production of related food, drug and cosmetic raw materials.
[0017] This invention also provides a method for introducing sialylated N-glycan modification into a target protein, wherein one or more of the following enzymes are expressed in a host cell expressing the target protein: (1) Galactose-1-phosphate uridine transferase derived from Drosophila; the gene encoding the galactose-1-phosphate uridine transferase is shown in SEQ ID NO.2; (2) UDP-4-epimerase derived from Bacillus anthracis; the gene sequence of the UDP-4-epimerase is shown in SEQ ID NO.3.
[0018] (3) Sialidase derived from Campylobacter jejuni; the gene encoding the sialidase is shown in SEQ ID NO.4.
[0019] In one embodiment, the protein used to demonstrate changes in the glycan chain includes, but is not limited to, glucose oxidase.
[0020] In one embodiment, the host cell includes, but is not limited to, *Phaefokomata* yeast.
[0021] In one embodiment, the host cell is *Phaeodactylum fafelicis* (…). Komagataella phaffii ChJ0010 is the starting strain; the *Phaeocotyledon* ChJ0010 was deposited on December 19, 2025, at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: M 20252965, located at Wuhan University, Wuhan, China.
[0022] The present invention also provides the application of the genetically engineered bacteria in the preparation of glycoproteins.
[0023] In one embodiment, the genetically engineered bacteria include, but are not limited to, *Phaeodactylogyrus fafelicis* ChJ-Sia.
[0024] In one embodiment, the application involves fermenting the engineered *Phaeodactylum fafesumi* strain in YPD medium.
[0025] In one embodiment, the application involves fermenting the engineered *Phaeodactylum faecium* strain in an inorganic salt culture medium; the inorganic salt culture medium uses methanol as a carbon source and ammonia as a nitrogen source.
[0026] In one implementation, fermentation is carried out at 28-30°C.
[0027] In one embodiment, the glycoprotein has at least one glycan form selected from GalGlcNac2Man3GlcNac2, Gal2GlcNac2Man3GlcNac2, or Sia2Gal2GlcNac2Man3GlcNac2.
[0028] The present invention also provides the application of the engineered strain of *Phaeodactylum phalloides* and *Phaeodactylum phalloides* ChJ-Sia in the preparation of recombinant engineered strains that synthesize humanized N-glycan chains or sialylated N-glycan chains.
[0029] The present invention has achieved the following beneficial effects: (1) The present invention constructs a new engineered strain of Phaeocotyle pyrocotyle ChJ-Sia, which can efficiently prepare sialylated N-glycosylated proteins with glycan chains of Sia2Gal2GlcNac2Man3GlcNac2, while achieving the effects of reducing the immunogenicity of recombinant proteins and prolonging the in vivo half-life of glycoproteins, thus greatly improving their medicinal and application value.
[0030] (2) The method provided by the present invention effectively reduces the immunogenicity of the protein by introducing Gal2GlcNac2Man3GlcNac2 modification, and by expressing a specific sialyltransferase, introduces sialylation modification at the end of the dual-antenna Gal2GlcNac2Man3GlcNac2 type glycan to protect the glycan, so that the sialylation modification rate of the N-glycan of the glycoprotein is as high as 85%, which avoids the degradation of the glycoprotein by glycosidase or protease in the body, increases the retention time of the drug or exogenous protein in the body, and enhances the binding ability of the drug to the cell, thereby achieving the purpose of enhancing the efficacy of N-glycosylated protein.
[0031] (3) This invention breaks through the technical bottleneck of traditional yeast strains being unable to efficiently synthesize highly sialylated human N-glycosyl proteins. It can be stably applied to the large-scale fermentation production and preparation of human sialylated N-glycosyl proteins, with a wide range of applications and outstanding prospects for industrial application.
[0032] Preservation of biological materials Komagataella phaffii ChJ0010, classified as Komagataella phaffii Chj0010, was deposited on December 19, 2025, at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: M 20252965, located at Wuhan University, Wuhan, China.
[0033] Komagataella phaffii ChJ-Sia, taxonomically named Komagataella phaffii ChJ-Sia, was deposited on April 20, 2026, at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: M 2026737, located at Wuhan University, Wuhan, China. Attached Figure Description
[0034] Figure 1 This is a schematic diagram of the galactose-1-phosphate uridine transferase (GalT) catalytic reaction; Figure 2 MALDI-TOF detection results of the sugar chains of GalGlcNac2Man3GlcNac2 produced by strain ChJ0011; Figure 3 This is a schematic diagram of the catalytic reaction of galactose-1-phosphate uridine transferase (GalT) and UDP-4-epimerase (GalE); Figure 4 MALDI-TOF detection results of the sugar chains of GalGlc2Nac2Man3GlcNac2 produced by strain ChJ0012; Figure 5 This is a schematic diagram of the catalytic reaction of sialyl transferase (SiaT). Figure 6 MALDI-TOF detection results of Sia2GalGlc2Nac2Man3GlcNac2 sugar chains produced by ChJ-Sia strain; Figure 7 This is a comparison of the in vivo half-life of N-glycosylated proteins modified with sialic acid and those not modified with sialic acid; Figure 8 Results of fed-batch fermentation of strains for producing sialic acid-modified N-glycosylated proteins. Detailed Implementation
[0035] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially. The features and performance of the present invention will be further described in detail below with reference to the embodiments.
[0036] 1. Reagents and culture media Yeast extract and peptone were purchased from Sigma-Aldrich; various analytical grade reagents were purchased from Sinopharm Reagent Company; plasmid extraction kits, gene fragment recovery kits and kits were purchased from Sangon Biotech (Shanghai) Co., Ltd.; DNA polymerase and DNA markers were purchased from Takara.
[0037] LB medium: 10 g / L NaCl, 10 g / L tryptone, 5 g / L yeast extract.
[0038] YPD medium: 10 g / L yeast extract, 20 g / L tryptone, 20 g / L glucose.
[0039] BMGY medium: 13.4 g / L YNB (containing ammonium sulfate and inorganic salts), 9.08 g / L KH2PO4, 9.82 g / L K2HPO4, 10 mL / L glycerol, 10 g / L yeast extract, 20 g / L tryptone, 0.4 mg / L biotin.
[0040] BMMY medium: 13.4 g / L YNB (containing ammonium sulfate and inorganic salts), 9.08 g / L KH2PO4, 9.82 g / L K2HPO4, 0.5% methanol (v / v), 10 g / L yeast extract, 20 g / L tryptone, 0.4 mg / L biotin.
[0041] BSM medium: 26.7 mL / L H3PO4; 0.93 g / L CaSO4·2H2O; 18.2 g / L K2SO4; 14.9 g / L MgSO4·7H2O; 4.13 g / L KOH; 40.0 mL / L glycerol; 2 g / L SiA; 0.2 mg / L biotin; 4.35 mL / L LPTM1.
[0042] PTM1: 6 g / L CuSO4·5H2O; 0.09 g / L KI; 3 g / L MnSO4·H2O; 0.02 g / L H3BO3; 0.2g / L MoNa2O4·2H2O; 0.5 g / L CoCl2; 20 g / L ZnCl2; 65 g / L FeSO4·7H2O; 5.0 mL / L H2SO4.
[0043] 2. Main Instruments and Equipment The main instruments and equipment used in this invention are shown in Table 1.
[0044] Table 1 Equipment Information
[0045] 3. Operating procedures for the yeast cell CRISPR-Cas system The specific implementation steps of the CRISPR-Cas system involved in this application are as follows: 3.1 Target Selection Obtain the DNA sequence of the target gene from the NCBI database, select the fragment to be knocked out, and find the appropriate PAM site using the online website https: / / chopchop.cbu.uib.no / .
[0046] 3.2 Construction of CRISPR plasmids Based on the PAM site identified in the previous step, primers were designed, and the Crisper-Hygr-H-Cas9 plasmid was mutated so that it could express gRNA that recognizes the target gene and guide the pCas protein to destroy the target gene.
[0047] 3.3 Amplified Fragments The upstream and downstream sequences of the knockout portion of the target gene were amplified to construct a gene repair template. The fragment was then amplified using the pDonor-PNSI-8 plasmid for scarless knockout of the target gene.
[0048] 3.4 Transformation Plasmids and Fragments The constructed plasmids and fragments were transferred into competent cells via electroporation. The plasmids were then plated on YPD plates containing hygromycin B resistance and incubated upside down at 30°C for 3-5 days.
[0049] 3.5 Screening and Validation Colony PCR was performed on the transformants grown on the plate, and the fragment length was verified by nucleic acid gel electrophoresis. The colonies with the correct amplified fragment length were then subjected to gene sequencing to verify the knockout effect.
[0050] 4. Methods for preparing yeast electrocompetent cells The method for preparing yeast electrocompetent cells involved in the specific embodiments of this application is as follows: 4.1 Cell Culture Seed culture: Pick a single colony from a fresh plate and inoculate it into 5 mL of YPD liquid medium. Incubate at 30°C and 200 rpm for 16-20 hours until the logarithmic growth phase (OD600≈2.0-3.0).
[0051] Expanded culture: Transfer the seed culture to 500 mL of fresh YPD at a ratio of 1:50, and continue to culture at 30℃ and 200 rpm until OD600≈1.0-1.5 (mid-log phase, about 4-6 hours).
[0052] 4.2 Cell Collection and Pretreatment Centrifugation collection: Transfer the culture medium to a pre-cooled centrifuge tube, centrifuge at 4°C and 3000×g for 5 minutes, and discard the supernatant.
[0053] Washing cells: Resuspend cells in pre-cooled sterile water, gently agitate to mix, centrifuge at 3000×g for 5 minutes at 4°C, and discard the supernatant (repeat once). Resuspend cells again in pre-cooled 1 M sorbitol solution, centrifuge, and discard the supernatant (repeat once).
[0054] DTT treatment: Resuspend cells in 1 M sorbitol solution containing 20 mM DTT and incubate at 30°C for 10 minutes (to weaken the cell wall and improve transformation efficiency).
[0055] Centrifuge and discard the supernatant, then wash once with 1 M sorbitol.
[0056] 4.3 Preparation of competent cells Resuspend the cells in pre-chilled 1 M sorbitol solution and adjust the final concentration to approximately 1 × 10⁹ cells / mL (typically, when OD600 = 1, 1 mL of culture medium contains approximately 1 × 10⁹ cells / mL). 7 cell).
[0057] Aliquot into pre-chilled 1.5 mL centrifuge tubes (50-100 μL per tube) and immediately use for electroporation or store at -80°C.
[0058] 5. Yeast electroporation procedure The method for performing electroconversion in yeast cells according to the specific embodiments of this application is as follows: 5.1 Electroporation Mixture Take 80 μL of competent cells, add 1-5 μg of plasmid DNA and 50 μg of replacement gene fragment, mix gently, and incubate on ice for 5 minutes.
[0059] 5.2 Electric Shock Parameters Transfer the mixture to a pre-cooled electroporator cup (2 mm gap). Set the electroporator parameters: voltage: 2000 V, capacitance: 25 μF, resistance: 200 Ω. Initiate the electric shock (typically 5-5.5 ms).
[0060] 5.3 Resuscitation and Cultivation Immediately add 800 μL of pre-cooled 1 M sorbitol solution to the electroporation vessel and gently mix by pipetting. Transfer to a sterile centrifuge tube and incubate at 30°C for 0.5–1 h to recover.
[0061] 5.4 Screening of coated plates Spread an appropriate amount of resuscitation solution onto YPD medium containing hygromycin B. Incubate at 30°C upside down for 2-5 days and observe the transformants.
[0062] 6. Detection Methods 6.1 Determination of strain protein expression ability: 6.1.1 Protein collection: The strain was inoculated into YPD medium and cultured at 30℃ for 120 h. The supernatant was collected by centrifugation. The supernatant was purified using a nickel column to obtain the purified protein.
[0063] 6.1.2 Concentration determination: The absorbance value was measured at a wavelength of 595 nm by measuring the color change (reddish-brown → blue) after the dye binds to the protein using the Coomassie Brilliant Blue G250 method (Bradford method), and the protein concentration was calculated by combining the absorbance value with the standard curve.
[0064] 6.1.3 Calculation of protein expression capacity of strains: The ratio of protein concentration to fermentation supernatant obtained in the previous step is the value for measuring the protein expression capacity of the corresponding strain.
[0065] 6.2 Detection of sugar chains: 6.2.1 Introduction and Expression of Reporter Proteins A glucose oxidase (aGOD) derived from Aspergillus niger (nucleotide sequence shown in SEQ ID NO: 1) was introduced as a reporter protein to characterize changes in protein glycosylation. The specific steps are as follows: (1) Cloning of glucose oxidase: The codon-optimized glucose oxidase DNA sequence was amplified using the following primer pair: F: CGAGGAATTCGCCTTAGAATGCAAACTCTGC; R: CAACTTGAACTGAGGAACAGTCATGTTAGTGGGTGGTGGTGG2; (2) Cloning of pAOX815 plasmid framework: The pAOX815 plasmid was amplified using the following pair of primers as a framework for constructing the plasmid.
[0066] F: CCACCACtaaCATGACTGTTCCTCAGTTCAAGTTG; R: CAGAGTTTGCATTCTAAGGCGAATTCCTCGTTTCG; (3) After obtaining the glucose oxidase fragment and the pAOX815 plasmid framework, 2 μL of each fragment was added to 16 μL of Taiji buffer and reacted at 40°C for 20 min to combine the gene fragment and the plasmid framework. After obtaining the plasmid pAOX815-aGOD, the plasmid was digested with the restriction enzyme SacⅠ and transformed into the corresponding strain. The obtained strain was cultured in BMGY medium at 30°C and 220 r / min for 24 h, and then transferred to BMMY medium and cultured at 30°C and 220 r / min for 96 h. The fermentation broth was then collected.
[0067] 6.2.2 Extraction and Pretreatment of Glycoproteins Centrifuge the fermentation broth at 4000×g for 10 min and collect the supernatant. Purify the glycoprotein using affinity chromatography. Place the purified glycoprotein in a 10 kD ultrafiltration tube (pre-washed with 500 μL of NH4HCO3 buffer), add 150 μL of urea buffer, mix thoroughly, and centrifuge at 14000×g for 15 min. To open disulfide bonds, add dithiothreitol (DTT) solution to a final concentration of 10 mM, react at 56℃ for 1 h, centrifuge at 14000×g for 15 min, and discard the filtrate. To prevent disulfide bond re-closure, add iodoacetamide (IAM) solution to a final concentration of 20 mM, react at room temperature in the dark for 1 h, centrifuge at 14000×g for 15 min, and discard the filtrate. Add 150 μL of ddH2O, centrifuge at 14000×g for 15 min, discard the filtrate, and repeat twice more (adjusting the 8M urea to 1M). 6.2.3 Release and purification of N-glycans Transfer the ultrafiltration tube to a clean collection tube, add 40 mM NH4HCO3 buffer to adjust the pH to approximately 8.5, add 1 μL PNGase F, react at 37℃ for 12 h, centrifuge at 14000×g for 15 min, and collect the eluent. Add 150 μL ddH2O to the ultrafiltration tube, centrifuge at 14000×g for 15 min, repeat once more, and combine the eluents to obtain the glycan solution. Adjust the sample pH to approximately 2-3 using 50% trifluoroacetic acid (TFA), and then purify and enrich the glycans using a PGC column, following these steps: column washing and activation: 3×1 mL pure acetonitrile (CAN), 3×1 mL 0.1% TFA / 80% ACN, 3×1 mL 0.1% TFA; sample loading; washing: 3×1 mL 0.1% TFA; elution: 400 μL 0.1% TFA / 80% ACN. After lyophilizing the eluted sugar chain solution, store it at -80℃ for later use. 6.2.4 MALDI-TOF-MS Detection of Glycan Chains The lyophilized N-glycan was dissolved in 5 μL of 50% methanol. 2 μL of the sample was placed on a target plate, and then 1 μL of DHB-Na was added and mixed with the sample. The sample was allowed to dry before being analyzed. The composition of N-glycosylated glycans on the glycoprotein was determined by analyzing the glycan detection chromatogram.
[0068] 6.2.5 Calculation of Modification Rate: Protein sialylation modification rate: (G2S1+G2S2) / Glycan; The protein sialylation modification rate is obtained by adding the abundance of glycans modified by one sialic acid to the abundance of glycans modified by two sialic acid and dividing by the total N-glycan abundance.
[0069] 6.2.6 Calculation of metabolic clearance rate Healthy male SD rats aged 7-9 weeks (approximately 2 months) and weighing 250-300g were housed under standardized conditions. All rats were housed in an SPF-grade barrier environment (temperature 22±2℃, humidity 50±10%, 12h / 12h light / dark cycle), with free access to sterile drinking water and standard rat feed throughout the experiment. After 3 days of acclimatization, rats were injected intravenously via tail vein with purified rEPO proteins modified with different N-glycans at a dose of 500 IU / kg. Peripheral blood was collected via the orbital venous plexus or tail vein at designated time points of 1 h, 6 h, 24 h, 48 h, and 72 h post-administration. After static coagulation, serum was separated by centrifugation, and 0.1 mL of serum was used for subsequent cold ethanol treatment and gamma counting quantification analysis.
[0070] Example 1: Introduction of galactose-1-phosphate uridine transferase and synthesis of GalGlcNac2Man3GlcNac2 glycans The *Phaeodactylum fafelicis* strain ChJ0010 (accession number CCTCC NO: M 20252965), which can produce N-glycosylated modified proteins with the glycosylation form GlcNac2Man3GlcNac2, was used as the starting strain. Based on this strain, the galactose-1-phosphate uridine transferase gene (nucleotide sequence shown in SEQ ID NO.2) from *Drosophila* was introduced.
[0071] The experiment was conducted following the operating procedures of the yeast cell CRISPR-Cas system. Specific information is shown in Tables 2 and 3.
[0072] Table 2. Introduction of gene-related information
[0073] Table 3 Primers required for constructing CRISPR plasmids
[0074] The constructed gene integrated at PNS IV-4 site GalT The strain was named ChJ0011. Following method 6.2.1, the recombinant plasmid pAOX815-aGOD was introduced into strain ChJ0011, and the resulting recombinant strain was named ChJ0011-GOD. Similarly, following method 5.1, the recombinant plasmid pAOX815-aGOD was introduced into strain ChJ0010, and the strain was named ChJ0010-GOD. Strains ChJ0011-GOD and ChJ0010-GOD were cultured according to method 6.2.1, and the glycans on the reporter protein were collected and detected according to method 6.2. The results showed ( Figure 1 , Figure 2 The protein produced by strain ChJ0011-GOD has a glycan type of GalGlcNac2Man3GlcNac2, which is different from the GlcNac2Man3GlcNac2 type of strain ChJ0010-GOD. This demonstrates that the introduction of galactose-1-phosphate uridine transferase adds a galactose glycoside to the original glycan type of the N-glycan.
[0075] Example 2: Introduction of UDP-4-epomerase and synthesis of Gal2GlcNac2Man3GlcNac2 glycans Based on the strain ChJ0011 constructed in Example 1, the UDP-4-epimerase gene (nucleotide sequence shown as SEQ ID NO: 3) derived from Bacillus anthracis was introduced.
[0076] The CRISPR operation was performed according to the method in Example 1, and specific information is shown in Tables 4 and 5. The constructed [material] was integrated at PNS IV-7 sites. GalE The strain that produced the gene was named ChJ0012.
[0077] Table 4. Introduction of gene-related information
[0078] Table 5 Primers required for constructing CRISPR plasmids
[0079] The recombinant plasmid pAOX815-aGOD was introduced into the constructed strain ChJ0012 according to the method in 6.2.1, and the strain was named ChJ0012-GOD. Fermentation was carried out according to the method in 6.2.1. Reporter proteins were collected and glycans were detected. The results showed that after the introduction of UDP-4-epimerase, the N-glycans modified the protein under the action of galactose-1-phosphate uridine transferase and UDP-4-epimerase. The N-glycan form of the modified protein was modified by adding one galactose to the GalGlcNac2Man3GlcNac2 type, synthesizing an N-glycan modification of Gal2GlcNac2Man3GlcNac2. The strain culture process was the same as in Example 1. The conformational changes of the glycans are as follows: Figure 3 As shown, the test results are as follows Figure 4 As shown.
[0080] Example 3: Introduction of sialyl transferase and synthesis of Sia1Gal2GlcNac2Man3GlcNac2 and Sia2Gal2GlcNac2Man3GlcNac2 glycan chains Based on the strain ChJ0012 constructed in Example 2, a sialic acid transferase gene (nucleotide sequence as shown in SEQ ID NO: 4) derived from Campylobacter jejuni was introduced.
[0081] The CRISPR operation was performed according to the method in Example 1, and the specific information is shown in Tables 6 and 7. The strain that integrates the SiaT gene at the PNS IV-11 site was named ChJ-Sia.
[0082] Table 6. Introduction of gene-related information
[0083] Table 7 Primers required for constructing CRISPR plasmids
[0084] The recombinant plasmid pAOX815-aGOD was introduced into the constructed strain ChJ-Sia according to the method in 6.2.1, and the strain was named ChJ-Sia-GOD. Fermentation was carried out according to the method in 6.2.1. Reporter proteins were collected and glycans were detected. The results showed that after the introduction of sialyltransferase, two sialic acids were added to the N-glycans based on the Gal2GlcNac2Man3GlcNac2 type, synthesizing proteins modified by the Sia2Gal2GlcNac2Man3GlcNac2 type N-glycans. The strain culture process was the same as in Example 1. The conformational changes of the glycans are as follows: Figure 5 As shown, the test results are as follows Figure 6 As shown. (Through) Figure 6 The data were used to calculate the sialic acid modification rate of N-glycosylated proteins produced by ChJ-Sia-GOD according to the method in 6.2.5. It can be seen that after the introduction of sialyltransferase, the sialic acid modification rate of N-glycan dual antennas exceeded 85%, reaching a high level, which ensured good consistency of products produced by cell factories and has high application prospects.
[0085] Example 4: Metabolic clearance rate of sialic acid-modified proteins in vivo Following the method described in 7.2.6, the metabolic clearance rates of aGOD proteins modified with Gal2GlcNac2Man3GlcNac2, Sia1Gal2GlcNac2Man3GlcNac2, and Sia2Gal2GlcNac2Man3GlcNac2 glycans were statistically analyzed in vivo. The results are as follows: Figure 7As shown, the proportion of aGOD protein modified with Sia1Gal2GlcNac2Man3GlcNac2 and Sia2Gal2GlcNac2Man3GlcNac2 significantly increased in vivo, with half-lives of 7.8 hours and 8.5 hours, respectively, which is 3.3 times longer than the 2.6-hour half-life of the unmodified aGOD protein with Gal2GlcNac2Man3GlcNac2. This indicates that sialylation modification can improve the half-life and biological activity of proteins in animals, reduce immune responses, and decrease the frequency of injection.
[0086] Example 5: Preparation of sialic acid-modified protein by fed-batch fermentation The recombinant strain ChJ-Sia-GOD constructed in Example 3 was used for fermentation. The specific steps are as follows: (1) Primary seed culture Single colony selection: Pick a well-grown single colony from a fresh YPD plate (containing the appropriate antibiotic such as G418 or Zeocin to maintain plasmid stability) and inoculate the single colony into a 250 mL Erlenmeyer flask containing approximately 30 mL of YPG liquid medium. Incubate in a constant temperature shaker at 30°C and 200-300 rpm for approximately 24 hours to obtain a primary seed culture with an OD600 between 2 and 6.
[0087] (2) Secondary seed culture Inoculate at a rate of 1%-2%, taking an appropriate amount of primary seed culture and transferring it to a 500 mL Erlenmeyer flask containing 100 mL of YPG liquid medium. Continue incubation at 30°C and 200-300 rpm on a shaker until the bacterial concentration reaches a high level (OD). 600 (Reaching around 10), as a secondary seed solution.
[0088] (3) Feeding and fermentation in batches Four bottles of secondary seed culture, totaling 400 mL, were inoculated into the bioreactor to allow the fermentation broth to reach its OD value. 600 The reactor contained approximately 5 liters of BMGY medium or BSM medium containing PTM1. Throughout the fermentation process, the pH was maintained at 5, and the temperature was controlled at 30°C. The fermentation process consisted of two main phases: the first phase was a glycerol batch addition phase, which ended when the glycerol was depleted; the second phase was a glycerol fed-batch phase, initiated by pumping in a 50% concentration glycerol solution containing 4.4 mL / L PTM1, lasting 120 hours. The feeding rate was adjusted according to the dissolved oxygen (DO) level to maintain DO within the range of 25%–35%. aGOD yield was measured over 120 hours of fermentation, and the results are as follows: Figure 8As shown, the yield of sialic acid-modified aGOD reached 3.58 g / L after 108 h.
[0089] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.
Claims
1. A genetically engineered bacterium, characterized in that, With Fabry japonicus ( Komagataella phaffii Using this host, the following genes were expressed: galactose-1-phosphate uridine transferase gene, UDP-4-epimerase gene, and sialic acid transferase gene.
2. The genetically engineered bacterium according to claim 1, characterized in that, The gene for galactose-1-phosphate uridine transferase, as shown in SEQ ID NO.2, is expressed, enabling the constructed genetically engineered bacteria to ferment and produce a glycoprotein with N-glycosyl sugar chains GalGlcNac2Man3GlcNac2.
3. The genetically engineered bacterium according to claim 1, characterized in that, The UDP-4-epimerase gene shown in SEQ ID NO.3 is expressed, enabling the constructed genetically engineered bacteria to ferment and produce glycoproteins with N-glycosyl sugar chains Gal2GlcNac2Man3GlcNac2.
4. The genetically engineered bacterium according to claim 1, characterized in that, The sialyl transferase gene shown in SEQ ID NO.4 is expressed, enabling the constructed genetically engineered bacteria to ferment and produce a glycoprotein with sialylated N-glycosyl sugar chains Sia2Gal2GlcNac2Man3GlcNac2.
5. The genetically engineered bacteria according to any one of claims 1 to 4, characterized in that, The starting strain was *Phaeodactylogyrus fafelicis* ChJ0010.
6. Phaffia colima ( Komagataella phaffii ChJ-Sia was deposited at the China Center for Type Culture Collection on April 20, 2026, with accession number CCTCC NO: M 2026737.
7. A method for introducing sialylated N-glycan modification into a target protein, characterized in that, Express one or more of the following enzymes in host cells that express the target protein: (1) Galactose-1-phosphate uridine transferase derived from Drosophila; the gene encoding the galactose-1-phosphate uridine transferase is shown in SEQ ID NO.2; (2) UDP-4-epimerase derived from Bacillus anthracis; the gene sequence of the UDP-4-epimerase is shown in SEQ ID NO.3; (3) Sialidase derived from Campylobacter jejuni; the encoding gene of the sialidase is shown in SEQ ID NO.
4.
8. The genetically engineered bacteria according to any one of claims 1 to 5 or the *Phaeodactylum phagnum* yeast according to claim 6 ( Komagataella phaffii Application of ChJ-Sia in the preparation of glycoproteins.
9. The application according to claim 8, characterized in that, The glycoprotein has at least one glycan form selected from GalGlcNac2Man3GlcNac2, Gal2GlcNac2Man3GlcNac2, or Sia2Gal2GlcNac2Man3GlcNac2.