Marine pseudomonas alginovora degrading PAEs and application thereof

Abstract

The application discloses a marine Pseudoalteromonas lipolytica strain capable of degrading PAEs and an application thereof, and belongs to the technical field of microorganisms. The strain is Pseudoalteromonas lipolytica HJ01, and the preservation number is GDMCC NO: 66827. The strain has obvious advantages in environmental adaptability and PAEs pollutant degradation activity, can efficiently degrade various PAEs and metabolic intermediates, and maintains good growth kinetic characteristics in a 0-120 h culture period. When the initial concentration of di-2-ethylhexyl phthalate (DEHP) is 300 mg / L, the strain can significantly reduce the residual content of DEHP in a culture system after culture, and the 24 h degradation rate reaches 86.7 %. The application has the advantages of simple operation, safety and economy, provides efficient and stable microbial resources for PAEs pollution remediation, and has important practical value.

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, specifically relating to a marine pseudoalterniosum strain that degrades phthalic acid esters (PAEs) and its applications. Background Technology

[0002] Phthalate esters (PAEs), also known as phthalic acid esters, are widely used as plasticizers and additives in plastic products such as polyvinyl chloride (PVC), coatings, adhesives, personal care products, and packaging materials. Because PAEs are non-covalently bonded to the polymer matrix, they easily migrate, leach, and enter the environmental media during use and aging. They are commonly detected in various environments, including water bodies, sediments, soil, and crops, and are recognized as one of the typical emerging pollutants in urban wastewater. Daily ingestion of agricultural products or drinking water containing PAEs leads to long-term low-concentration exposure, seriously threatening human health. PAEs are important endocrine disruptors with potential health risks related to development, reproduction, metabolism, and immunity. Typical PAEs include diethyl phthalate (DEP), dimethyl phthalate (DMP), di(2-ethylhexyl) phthalate (DEHP), and dibutyl phthalate (DBP). DEHP is a PAE compound with a high detection rate and concentration in the environment, and its toxicological effects and pollution remediation have been extensively studied. How to eliminate PAE pollution in the environment and reduce the threat of PAEs to the ecological environment and human health is a critical issue that urgently needs to be addressed.

[0003] Bioremediation offers advantages such as low cost, safety, and environmental friendliness. Microbial degradation is the primary pathway for the reduction of PAEs in the environment. Currently, over 80 degrading bacteria (covering 36 genera) have been screened from environmental samples including farmland soil, activated sludge, and plant rhizosphere, and have been studied and reported in detail. These mainly include *Pseudomonas*, *Arthrobacter*, *Pseudomonas*, *Bacillus*, and *Rhodococcus*. Most degrading bacteria possess highly efficient PAE degradation capabilities and environmental adaptability. Since multiple PAEs often coexist in the environment, bacteria such as *Bacillus subtilis* 3C3, *Gordonia* sp. Dop5, and *Pseudomonas fluorescens* FS1 can efficiently degrade multiple PAEs. However, these highly efficient degrading strains with multi-substrate degradation capabilities and resistance to abiotic stress are only a minority. Further efforts are needed to isolate and screen new high-performance degrading bacteria from the natural environment to enrich the resources of PAE-degrading strains and enhance the potential for bioremediation of PAE pollution. The ocean contains a large number of microorganisms capable of degrading organic pollutants. Currently known PAE-degrading bacteria isolated from the marine environment include *Arthrobacter* sp., *Sphingomonas yanoikuyae*, *Mycobacterium* sp., and *Cupriavidus oxalaticus*. Marine microorganisms are widely distributed, have enormous biomass, and are rich in genetic resources, making the search for PAE-degrading bacteria originating from the ocean even more promising.

[0004] The existing PAEs-degrading bacteria still have the following shortcomings: (1) Limited environmental adaptability of strains to PAEs: Some known PAEs-degrading bacteria have difficulty maintaining stable growth under high concentration pollution or complex substrate conditions (such as polluted soil, sediment or saline environment), resulting in unstable remediation effect. (2) The removal capacity of high molecular weight PAEs needs to be improved: High molecular weight PAEs, represented by di(2-ethylhexyl) phthalate (DEHP), have the characteristics of strong hydrophobicity and low bioavailability. Currently, the microbial resources that can effectively transform such compounds are still relatively limited. (3) The continuity and stability of the remediation process need to be improved: Some microorganisms can only survive for a short period of time or have their growth inhibited under the presence of PAEs, making it difficult to play a continuous role in the remediation cycle, thus affecting the overall remediation efficiency.

[0005] *Pseudoalteromonas* is a common Gram-negative bacterial group in marine environments, widely distributed in seawater, sediments, and marine microenvironments. Recent studies have also isolated strains of this genus from the endophytic / rhizosphere of halophyte roots, demonstrating their potential application in polluted environments. *Pseudoalteromonas rhizosphaerae*, derived from the endophytic roots of halophytes, exhibits growth-promoting phenotypes and can tolerate high concentrations of heavy metals. Several *Pseudoalteromonas* strains capable of degrading polycyclic aromatic hydrocarbons (PAHs) have been isolated from polluted environments, indicating that this genus may participate in the biotransformation and removal of hydrophobic organic pollutants in complex environmental media.

[0006] However, overall, research on Pseudoalteromonas in environmental remediation mainly focuses on marine ecological adaptability, heavy metal tolerance, and transformation of some hydrophobic organic pollutants. There are relatively few reports on the remediation of PAE pollution, especially the application of Pseudoalteromonas lipolytica in PAE degradation. Summary of the Invention

[0007] To overcome the shortcomings and deficiencies of existing technologies, the present invention aims to provide a marine pseudoalternating monoclonal bacterium that degrades PAEs and its applications. The pseudoalternating monoclonal bacterium HJ01 of the present invention has a clearly defined origin and is capable of degrading PAEs and their metabolic intermediates. It can serve as a novel resource for the remediation of PAE contamination and has significant application value.

[0008] The objective of this invention is achieved through the following technical solution:

[0009] This invention provides a marine pseudoalteromonas lipolytica strain that degrades PAEs, named pseudoalteromonas lipolytica HJ01, which was isolated and purified from coral reef sediments in the Beibu Gulf of Guangxi near Weizhou Island.

[0010] Preservation information for Pseudoalteromonas lipolytica HJ01: Depository institution: Guangdong Provincial Microbial Culture Collection Center (GDMCC), deposit date: September 12, 2025, deposit address: Institute of Microbiology, Guangdong Academy of Sciences, 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Province, accession number: GDMCC NO: 66827.

[0011] The colony morphology of *Pseudomonas lipolyticis* HJ01 is as follows: the bacteria are short rods or elliptical rods with smooth surfaces and uniform size, which conforms to the typical morphological characteristics of bacteria of the genus *Pseudomonas*.

[0012] The present invention provides a biological agent comprising at least one of the above-mentioned *Pseudomonas lipolytica* HJ01, *Pseudomonas lipolytica* HJ01 bacterial solution, and *Pseudomonas lipolytica* HJ01 powder.

[0013] Furthermore, the *Pseudomonas lipolytica* HJ01 powder is obtained by centrifuging the *Pseudomonas lipolytica* HJ01 bacterial solution, collecting the bacterial cells, adding a protectant, mixing thoroughly, and then freeze-drying.

[0014] Preferably, the protective agent includes at least one of trehalose, sucrose, and glycerol.

[0015] Preferably, the mass ratio of the bacterial cells to the protectant is 1:1 to 3.

[0016] The present invention also provides the application of the above-mentioned pseudoalternating lipophilic bacteria HJ01 or biological agents in the degradation of PAEs and / or PAE metabolic intermediates.

[0017] Preferably, the PAEs include at least one of di(2-ethylhexyl) phthalate (DEHP), dimethyl phthalate (DMP), dibutyl phthalate (DBP), and diethyl phthalate (DEP);

[0018] Preferably, the PAEs metabolic intermediates include at least one of phthalic acid (PA) and protocatechuic acid (PCA).

[0019] The present invention also provides the application of the above-mentioned pseudoalteromonas lipophila HJ01 or biological agents in the remediation of environmental media contaminated with PAEs and / or PAE metabolic intermediates.

[0020] Preferably, the environmental medium includes soil or water.

[0021] As a preferred embodiment, *Pseudomonas lipolyticis* HJ01 or a biological agent is inoculated into soil contaminated with PAEs and / or PAE metabolic intermediates to degrade PAEs in the soil.

[0022] As a preferred embodiment, *Pseudomonas lipophila* HJ01 or a biological agent is inoculated into water bodies polluted with PAEs and / or PAE metabolic intermediates to degrade PAEs in the water.

[0023] Preferably, the degradation time is 12–120 h; more preferably 12–36 h.

[0024] Preferably, the degradation temperature is 28±2℃;

[0025] Preferably, the degradation rotation speed is 120-180 rpm; more preferably 150 rpm.

[0026] The present invention has the following advantages and effects compared with the prior art:

[0027] Compared with commonly used degrading strains in existing PAEs bioremediation technologies, the *Pseudomonas lipophila* HJ01 provided in this invention exhibits significant advantages in environmental adaptability and PAEs pollutant degradation activity. In existing technologies, some reported PAEs-degrading bacteria are prone to growth inhibition or reduced metabolic activity in the presence of PAEs, affecting the sustainability of the remediation process. According to the experimental results of this invention, in a culture system containing multiple phthalates and their metabolic intermediates (including DMP, DBP, PA, PCA, DEHP, and DEP), the strains can maintain stable growth. Figure 3 ), and maintained good growth kinetics during the 0-120 h culture period ( Figure 4 The results show that the present invention is simple, safe, and economical. The strain HJ01 can survive for a long time in the presence of PAEs and continue to exert its degradation function, providing an efficient and stable microbial resource for the remediation of PAEs pollution, and has important practical value.

[0028] Furthermore, compared to existing technologies with limited removal capabilities for high molecular weight PAEs, this invention demonstrates superior application potential in the treatment of di(2-ethylhexyl) phthalate (DEHP), a representative high molecular weight PAE. Under conditions of an initial DEHP concentration of 300 mg / L, strain HJ01 significantly reduced the residual DEHP content in the culture system after cultivation, achieving a degradation rate of 86.7% after 24 hours. Figure 5 Based on the experimental results showing that strain HJ01 can maintain good growth even in the presence of DEHP, it can be inferred that this strain can simultaneously achieve growth and pollutant transformation under high pollution load conditions, avoiding the contradictory problem of "degradation ability exists but growth is limited" in existing technologies. Therefore, this invention has better stability and practical value in the bioremediation of PAEs, especially DEHP-contaminated environments. Attached Figure Description

[0029] Figure 1 This is a scanning electron microscope (SEM) image of the bacterial cell morphology of strain HJ01.

[0030] Figure 2 This is a phylogenetic tree of strain HJ01 based on the 16S rRNA gene sequence.

[0031] Figure 3 This is a graph showing the phthalate substrate profile analysis results of *Pseudomonas lipophila* HJ01 (300 mg / L, cultured at 28°C and 150 rpm for 24 h).

[0032] Figure 4 This is a growth curve of *Pseudomonas lipophila* HJ01 in 300 mg / L DEHP-inorganic salt medium.

[0033] Figure 5 This is a graph showing the degradation effect of Pseudomonas lipophila HJ01 on DEHP (300 mg / L). Detailed Implementation

[0034] The present invention will be further described in detail below with reference to embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto. Test methods in the following embodiments that do not specify specific experimental conditions are generally performed under conventional experimental conditions or according to the manufacturer's recommended experimental conditions. Unless otherwise specified, the materials and reagents used are commercially available.

[0035] Example 1: Obtaining and Identifying Strain HJ01

[0036] 1. Obtaining strain HJ01

[0037] Coral reef sediment samples were collected from the Weizhou Island area of ​​the Beibu Gulf in Guangxi. Surface sediment samples were collected from the nearshore coral reef area at a depth of 0–10 cm below the sediment surface. Sterile sampling tools were used to collect the samples, which were then stored in sterile sampling bags or sterile centrifuge tubes and transported to the laboratory at 4°C. Strains were isolated within 24 hours.

[0038] Weigh 1.0 g of sediment sample and add it to 9 mL of sterile physiological saline (0.85% NaCl). Shake thoroughly to mix and prepare 10 -1 Diluent. Further 10-fold serial dilutions (10... -2 ~10 -6 ), 100 μL of samples at different dilutions were evenly spread on solid culture medium plates and incubated at 28℃ for 24–72 h to obtain single colonies of different morphologies.

[0039] Single colonies with different morphological characteristics were picked from the plates and subjected to multiple streak purification cultures until a pure strain with consistent morphology was obtained. The obtained pure strains were then inoculated into liquid culture medium for culture and preliminary screening was performed.

[0040] During the strain screening process, the obtained pure strains were inoculated into a screening medium using phthalic acid esters (PAEs) as the sole carbon source. This screening medium was an inorganic salt medium supplemented with 200 mg / L DEHP as the sole carbon source. The growth and pollutant removal capabilities of the strains in this culture system were observed, and strains with good growth capacity and degradation potential were further screened.

[0041] After multiple rounds of screening, a strain capable of stable growth and degradation in the presence of PAEs and their metabolic intermediates was obtained, designated as HJ01.

[0042] 2. Identification of strain HJ01

[0043] Morphological identification of strain HJ01: such as Figure 1 As shown, when observed under a scanning electron microscope, the bacteria are short rod-shaped or elliptical rod-shaped, with smooth surfaces and uniform size, consistent with the typical morphological characteristics of bacteria in the genus *Pseudomonas*.

[0044] Physiological and biochemical characteristics of strain HJ01 were identified: The results of the physiological and biochemical experiments are shown in Table 1.

[0045] Table 1. Physiological and biochemical characteristics of strain HJ01

[0046]

[0047] Molecular biological identification of strain HJ01: According to Bergey's Manual of Systematic Bacteria (9th Edition), and based on a BLAST comparison of the 16S rDNA sequence of strain HJ01 (as shown in SEQ ID NO: 1), the comparison results showed that strain HJ01 had the highest sequence similarity to strain Pseudoalteromonas lipolytica, with a sequence coverage of 100% and a sequence similarity of 100.00%. A phylogenetic tree was constructed using the 16S rDNA sequence of strain HJ01, and the results are as follows: Figure 2 As shown, strain HJ01 clustered with the type strain of *Pseudoalteromonas lipolytica*, exhibiting high phylogenetic similarity and indicating a clear taxonomic position.

[0048] In summary, based on the comprehensive morphological characteristics, physiological and biochemical characteristics, and 16S rDNA sequence analysis results, strain HJ01 is classified as *Pseudoalteromonas lipolytica*, and named *Pseudoalteromonas lipolytica* HJ01. Preservation information: Guangdong Provincial Microbial Culture Collection Center (GDMCC); deposit date: September 12, 2025; deposit address: Institute of Microbiology, Guangdong Academy of Sciences, 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Province; accession number: GDMCC NO: 66827.

[0049] The 16S rDNA sequence of *Pseudoalteromonas lipolytica* HJ01 is shown in SEQ ID NO: 1.

[0050] GTCGAGCGGTAACAGAGAGTAGCTTGCTACTCTGCTGACGAGCGGCGGACGGGTGAGTAATGCTTGGGAATGTACCTTATGGTGGGGGACAACAGTTGGAAACGACTGCTAATACCGCATAATGTCTTCGGACCAAAGCGGGGGACCTTCGGGCCTCGCGCCATAAGATCAGCCCAAGTGGGATTAGCTAGTTGGTGAGGTAATGGCTCACCAAGGCGACGATCCCTAGCTGGTTTGAGAGGATGATCAGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTGTGAAGAAGGCCTTCGGGTTGTAAAGCACTTTCAGTAAGGAGGAAAGGTTGGATGTTAATAGCATTCAGCTGTGACGTTACTTACAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTACGCAGGCGGTTTGTTAAGCGAGATGTGAAAGCCCCGGGCTCAACCTGGGAACTGCATTTCGAACTGGCAAACTAGAGTGTGATAGAGGGTGGTAGAATTTCAGGTGTAGCGGTGAAATGCGTAGAGATCTGAAGGAATACCGATGGCGAAGGCAGCCACCTGGGTCAACACTGACGCTCATGTACGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGTCTACTAGAAGCTCGGTTCCTCGGAACTGTTTTTCAAAGCTAACGCATTAAGTAGACCGCCTGGGGAGTACGGCCGCAAGGTTAAAACTCAAATGAATTGACGGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGATGCAACGCGAAGAACCTTACCTACACTTGACATA。

[0051] Example 2 Substrate spectrum analysis of Pseudomonas lipolytica HJ01

[0052] To evaluate the growth ability of strain HJ01 in the presence of PAEs and their metabolic intermediates, strain HJ01 was inoculated into culture systems containing different carbon sources, including DMP, DBP, PA, PCA, DEHP, and DEP.

[0053] *Pseudomonas lipolyticis* HJ01 was activated by streaking from preservation slant or glycerol preservation tubes and cultured at 28°C for 24 h. Single colonies were picked and inoculated into liquid LB medium and cultured at 28°C and 150 rpm with shaking for 12 h to obtain seed culture. The liquid LB medium consisted of: 10 g / L tryptone, 5 g / L yeast extract, and 10 g / L sodium chloride, with a pH of 7.0–7.2.

[0054] Seed culture was inoculated into 100 mL Erlenmeyer flasks containing 20 mL of inorganic salt medium at a 1% (v / v) inoculation rate. The target compound was added to the medium as the sole carbon source, with a final concentration of 300 mg / L. The culture was incubated at 28 °C with shaking at 150 rpm. Odionation precipitates were measured every 6 hours over 120 h. 600 .

[0055] Using the blank control group (CK) as a reference, the cell growth was measured after a certain period of culture (expressed as optical density OD). 600 Characterization) was used to analyze the growth status of strain HJ01. For example... Figure 3 As shown, strain HJ01 was able to maintain growth in the presence of various PAEs and their metabolic intermediates after 24 hours of culture. It showed better growth under PA, PCA and DEHP conditions, indicating that strain HJ01 has a good degradation ability for PAEs and their key metabolic intermediates.

[0056] Further analysis was performed on the growth curve of strain HJ01 in the presence of PAEs. The results are as follows: Figure 4 As shown, during the 0-120 h culture period, the growth curve of strain HJ01 exhibited obvious characteristics of the adaptation period, growth period and stationary period.

[0057] Example 3: Application of *Pseudomonas lipolyticis* HJ01 in the degradation of di(2-ethylhexyl) phthalate

[0058] DEHP, which is widely used and poses a high risk of pollution in the environment, was selected as a representative PAE to verify the degradation ability of strain HJ01. The blank control group (CK) was used as a reference.

[0059] A single colony of HJ01 was inoculated into 20 mL of LB liquid medium and cultured at 28°C and 150 rpm for 12 h with shaking to obtain a seed culture. The seed culture was then inoculated at a 10% (v / v) inoculation rate into a 100 mL Erlenmeyer flask containing 20 mL of inorganic salt medium. DEHP was added to the medium to a final concentration of 300 mg / L. The flask was then cultured at 28°C and 150 rpm with shaking for 24 h. After culture, the supernatant was collected by centrifugation, extracted with an organic solvent, and the residual DEHP content was determined by GC-MS. The degradation rate was then calculated.

[0060] Strain HJ01 was inoculated into a culture system with an initial DEHP concentration of 300 mg / L, and the residual DEHP in the system was detected to calculate its removal ratio. Figure 5 As shown, the DEHP degradation rate was 86.7%, indicating that *Pseudomonas lipophila* HJ01 was able to efficiently degrade DEHP.

[0061] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A marine pseudoalternating monoclonal strain that degrades PAEs, characterized in that, The specimen, named *Pseudoalteromonas lipolytica* HJ01, was deposited on September 12, 2025, at the Guangdong Provincial Microbial Culture Collection Center, Institute of Microbiology, Guangdong Academy of Sciences, 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Province, with accession number GDMCC NO: 66827.

2. A biological agent, characterized in that, It contains at least one of the following: *Pseudomonas lipolyticis* HJ01, *Pseudomonas lipolyticis* HJ01 bacterial suspension, and *Pseudomonas lipolyticis* HJ01 powder as described in claim 1.

3. The use of the *Pseudomonas lipolyticis* of claim 1 or the biological agent of claim 2 in the degradation of PAEs and / or PAE metabolic intermediates.

4. The application of the *Pseudomonas lipophila* of claim 1 or the biological agent of claim 2 in the remediation of environmental media contaminated with PAEs and / or PAE metabolic intermediates.

5. The application according to claim 4, characterized in that: The environmental media mentioned include soil or water.

6. The application according to claim 5, characterized in that: Inoculate soil contaminated with PAEs and / or PAE metabolic intermediates using PAE-altering bacteria or biological agents to degrade PAEs in the soil.

7. The application according to claim 5, characterized in that: Pseudomonas lipophila or biological agents are inoculated into water bodies contaminated with PAEs and / or PAE metabolic intermediates to degrade PAEs in the water.

8. The application according to claim 7, characterized in that: The degradation time is 12–120 h; And / or, the degradation temperature is 28±2℃; And / or, the degradation rotation speed is 120-180 rpm.

9. The application according to any one of claims 3 to 8, characterized in that: The PAEs include at least one of di(2-ethylhexyl) phthalate, dimethyl phthalate, dibutyl phthalate, and diethyl phthalate.

10. The application according to any one of claims 3 to 8, characterized in that: The metabolic intermediates of PAEs include at least one of phthalic acid and protocatechuic acid.

Images