Lactococcus lactis and application thereof in preparation of fragrant acid bamboo shoots

Abstract

The application discloses a lactis lactis PM13 strain and application of the lactis lactis PM13 strain in preparation of fragrant acid bamboo shoots. Lactococcus cremoris The strain is classified and named as Lactococcus cremoris , is preserved in the China Center for Type Culture Collection, and has a preservation number of CCTCC No:M20242014. The strain is used for fermentation of bamboo shoots, and fragrant acid bamboo shoots with rich flower fragrance and fresh fragrance can be prepared in 48-96 hours. The product has significant advantages of crispness and hardness over traditional fermentation products. The preparation steps include the following steps: fresh bamboo shoot slicing, hot water treatment and cooling; dissolving sucrose and salt in water and inoculating the strain seed liquid to obtain a fermentation liquid; mixing the bamboo shoot slices and the fermentation liquid and then carrying out constant temperature fermentation at 28-37 DEG C. The application provides a specific strain specially used for bamboo shoot flavor enhancement, and has the advantages of simple process, short period, unique product flavor, excellent product texture and suitability for industrial production.

Description

Technical Field

[0001] This invention belongs to the field of microbial fermentation technology, specifically relating to a strain of Lactococcus lactis and its application in the preparation of fragrant sour bamboo shoots. Background Technology

[0002] Pickled bamboo shoots are a traditional food product with a unique sour and fragrant flavor, transformed from fresh bamboo shoots through natural fermentation dominated by lactic acid bacteria or artificial inoculation fermentation. The core of this process lies in the organic acids, flavor compounds, and microbial community succession produced by lactic acid bacteria metabolism. Traditional lactic acid bacteria fermentation of bamboo shoots essentially relies on the natural enrichment and metabolism of wild lactic acid bacteria (such as Leuconostoc mesenteroides, Lactobacillus plantarum, and Lactobacillus brevis) attached to the surface of the bamboo shoots under anaerobic or facultative anaerobic conditions. Typically, cooked or fresh bamboo shoots are cut, salt, spices, and cooled boiled water are added, and the mixture is sealed and soaked at room temperature. The nutrients that seep out provide nutrients for the growth of lactic acid bacteria, producing acid, which lowers the pH value, inhibits spoilage bacteria, and creates the unique sour and fragrant flavor. Currently, the aroma of bamboo shoots mainly comes from added spices or food additives.

[0003] First, natural fermentation relies on the slow accumulation and dominance of lactic acid bacteria in the environment and raw materials. Initially, the lactic acid bacteria population is low, and acid production starts slowly, typically requiring 5-10 days or even longer to reach the ideal acidity, which is insufficient for the rapid turnover demands of industrial production. Second, differences in the origin of raw materials, harvesting season, processing methods, and even the microbial environment of the workshop directly lead to significant variations in the types and proportions of lactic acid bacteria in the fermentation system. This makes it difficult to maintain consistency in total acidity, pH, crispness, color, and aroma between different batches of products, severely restricting branding and large-scale production. Third, in the early stages of fermentation, before lactic acid bacteria have established an absolute dominance, nitrates present in bamboo shoots are easily reduced to nitrites by other bacteria, forming a noticeable "nitrite peak." Improper control of the fermentation process (such as low salinity, high temperature, or fermentation interruption) can lead to excessive nitrite residues, posing a food safety hazard. Fourth, traditional open or semi-open fermentation environments are prone to the invasion of film-forming yeasts, molds, and spoilage bacteria. Common "flowering yeasts" (film-producing yeasts) consume acidity and produce off-flavors. In severe cases, the material becomes sticky, tastes off, or even rots, resulting in raw material loss. Fifth, the pectinase naturally present in bamboo shoots, as well as pectinase and cellulase secreted by certain bacteria, continuously degrade cell wall components during the slow fermentation process, causing the bamboo shoot tissue to become soft and mushy, losing its crisp texture and seriously affecting product quality. Finally, the organic acids, amino acids, and volatile flavor compounds produced by natural fermentation are relatively monotonous, mostly characterized by simple sourness, making it difficult to form a rich, harmonious, and layered aroma, leading to severe product homogenization.

[0004] Although existing research has attempted to enhance the fermentation process by artificially inoculating lactic acid bacteria (such as using pure cultures of *Lactobacillus plantarum*, *Lactobacillus casei*, and *Pediococcus pentosaceus*, or direct-inoculation starter cultures), the adaptability, acid production rate, and flavor output of single bacterial strains in bamboo shoot substrates are often unsatisfactory due to the presence of specific antibacterial components in bamboo shoots (such as cyanogenic glycoside degradation products and tannins). Furthermore, compound microbial agents suffer from problems such as inter-strain antagonism and difficulty in precisely balancing their proportions. In addition, the high cost of commercial starter cultures and the requirements for cold chain storage also limit their widespread adoption in the bamboo shoot primary processing industry.

[0005] In conclusion, there is an urgent need to develop a new bamboo shoot lactic acid bacteria fermentation process that can shorten the fermentation cycle, inhibit nitrite formation, enhance crispness retention and enrich flavor, while also possessing good economic and industrial applicability. Summary of the Invention

[0006] To address the problems of existing bamboo shoot fermentation methods, such as producing a sour and rancid odor, lack of aroma, long fermentation cycles, monotonous flavor, and poor crispness, this invention aims to provide a novel strain of *Lactococcus lactis* specifically for bamboo shoot fermentation, as well as a method for preparing fragrant and sour bamboo shoots using this strain. After fermentation, this strain imparts a unique floral and refreshing aroma to bamboo shoots while effectively maintaining their crispness and firmness, achieving a dual improvement in both flavor and texture.

[0007] This invention provides a lactococcus faecium PM13 specifically for bamboo shoot fermentation, with the Latin name... Lactococcus cremoris It is deposited at the China Center for Type Culture Collection, accession number: CCTCC No: M20242014.

[0008] The colony characteristics of *Lactococcus lactis* PM13 preserved in this invention are as follows: on MRS agar plates, the colonies are milky white, round, opaque, with a small diameter (1 mm ± 0.5 mm), raised in a hemispherical shape, smooth surface, moist texture, and neat edges. The cell shape is spherical or oval. The optimal growth temperature is 25℃~37℃, and it is a facultative anaerobe. *Lactococcus lactis* PM13 belongs to the kingdom Bacteria, phylum Bacillota, class Bacilli, order Lactobacillales, family Streptococcaceae, and genus *Lactococcus*. Lactococcus .

[0009] The present invention further provides the application of the aforementioned *Lactococcus lactis* PM13, specifically its use in bamboo shoot fermentation to prepare fragrant and sour bamboo shoots. During fermentation, this strain produces rich floral and fresh aromas and effectively maintains the crispness and firmness of the bamboo shoots.

[0010] The present invention also provides a method for preparing fragrant sour bamboo shoots using the strain, comprising the following steps: (1) Slice the fresh bamboo shoots, blanch them, and then cool them; (2) Dissolve sucrose and salt in water, inoculate with seed culture of Lactococcus lactis PM13, and prepare fermentation broth; (3) Mix the cooled bamboo shoot slices with the fermentation liquid and ferment them under constant temperature conditions to obtain fermented fragrant sour bamboo shoots.

[0011] In the above method, the preferred process parameters are: bamboo shoot slice thickness 1–10 mm, hot water blanching temperature 90–95℃, blanching time 0.2–3 minutes, and final cooling temperature 4–30℃. The final sucrose concentration in the fermentation broth is 1.8%–2.2% (w / w), and the final salt concentration is 3.52%–3.87% (w / w). The seed liquid inoculation amount is 1%–8% of the fermentation broth volume. The mass ratio of bamboo shoot slices to fermentation broth is 1:2–3:1. The constant temperature fermentation temperature is 28–37℃, and the fermentation time is 48–96 hours. Beneficial effects

[0012] Currently, lactic acid bacteria commonly used in food fermentation (such as *Lactobacillus plantarum* and *Lactococcus lactis*) typically lack the ability to directly synthesize terpenoid aromatic compounds like linalool. Linalool is a monoterpene compound. In nature, it is primarily synthesized by plants via the mevalonate pathway (MVA) or the methyl erythritol phosphate pathway (MEP). Classical lactic acid bacteria lack the genes for synthesizing terpene skeletons. Their genomes are simplified, primarily used for glycolysis to produce acid, and lack the complete enzyme system for synthesizing terpenoids from precursors such as acetyl-CoA. Therefore, it is difficult to detect the "spontaneous" production of linalool, citronellol, and other terpenoid alcohols in the simple sugar-salt-water system of pure lactic acid bacteria fermentation.

[0013] The lactic acid bacteria preserved in this invention can produce abundant aroma compounds, such as linalool, octanal, and nonanal, in an environment containing bamboo shoots, but do not produce aroma compounds in MRS medium. Analysis suggests that bamboo shoots are rich in glycoside-bound precursors of various monoterpenes (such as linalool and geraniol). These precursors themselves are non-volatile and odorless. The preserved *Lactococcus fatatifossa* is likely a high-yielding... β - Lactic acid bacteria containing glucosidase. The main components of MRS medium are glucose, peptone, beef extract, etc., and it completely lacks the terpene glycoside precursors unique to bamboo shoots. Although the strains constitutively express or have basal levels... β The strain secretes glucosidase but cannot produce linalool. However, when it comes into contact with the glycoside precursor released by the rupture of bamboo shoot cells, it secretes... β - Glucosidase efficiently cleaves glycosides, hydrolyzing and releasing free volatile terpenoids such as linalool. Bamboo shoot cell walls or cell contents may contain specific glycosides, cellobioses, or certain phenolic acids, which can act as inducers, activating the enzymes encoded by these glycosides in the strain. β- The expression of genes for glucosidase or esterase leads to the production of large amounts of linalool; the specific mechanism requires further investigation.

[0014] Generally speaking, the hardness and crispness of bamboo shoots gradually decrease as the fermentation time increases. The change in the hardness of bamboo shoots during fermentation is related to a variety of factors, such as the total acid content, the content of ethanol-insoluble matter, and the effect of microorganisms on bamboo shoots.

[0015] Analyzing the mechanism, during fermentation, protopectin between bamboo shoot cells gradually dissolves into the fermentation broth, weakening intercellular connections and reducing firmness. Pectinase and cellulase produced by lactic acid bacteria partially decompose hemicellulose and lignin in the cell walls. Although lactic acid bacteria fermentation can inhibit pectinase secreted by other microorganisms, its own metabolism still slowly degrades the cell wall structure. Electron microscopy revealed that after fermentation, the thin-walled cells of bamboo shoots were disordered, significantly shrunken, with increased intercellular spaces, and some cells even showed signs of damage. This structural change directly weakens the mechanical strength of the tissue. Blanching pretreatment further exacerbates cell structure damage, but unblanched bamboo shoots combined with lactic acid bacteria fermentation best preserve cell integrity.

[0016] Bamboo shoot crispness is highly dependent on cell turgor pressure (the tension maintained by intracellular water). During fermentation, an osmotic pressure difference is created between the fermentation broth and the bamboo shoot cell sap, causing the cells to slowly lose water, reducing turgor pressure, and consequently weakening crispness. Bamboo shoot crispness is significantly positively correlated with the protopectin content in the cell wall. After fermentation causes protopectin to dissolve, the intercellular adhesion weakens, making the shoot more prone to non-brittle fracture (increased toughness) under pressure, resulting in decreased crispness.

[0017] Currently, no lactic acid bacteria metabolites have been found in lactic acid bacteria fermentation environments that can protect the hardness and crispness of bamboo shoot cell walls. When the *Lactococcus lactis* PM13 of this invention is applied to bamboo shoot fermentation, it can effectively inhibit pectinase activity, reduce pectin decomposition, and maintain cell structure stability, significantly improving the problem of decreased crispness in fermented bamboo shoots. Compared with traditional natural fermentation, fermented bamboo shoots produced under the same fermentation cycle can have a crispness that is more than 46% higher, which significantly improves the taste of fermented bamboo shoots.

[0018] Meanwhile, the Lactococcus lactis PM13 used in this invention is a food-grade safe microorganism. No additional chemical preservatives are required during the process, making the process simple and green, and suitable for industrial fermentation of bamboo shoots. Attached Figure Description

[0019] Figure 1 Colony diagram of Lactococcus fatii PM13 on MRS medium.

[0020] Figure 2 Morphological diagram of Lactococcus lactis PM13 strain on MRS medium.

[0021] Figure 3 Morphological diagram of Lactococcus lactis PM13 strain on MRS medium.

[0022] Figure 4 Growth curve of Lactococcus lactis PM13.

[0023] Figure 5 The effect of different strains on the pH of fermented bamboo shoots.

[0024] Figure 6 The effect of different strains on the total acid content of fermented bamboo shoots.

[0025] Figure 7 The effect of different strains on the nitrite content of fermented bamboo shoots.

[0026] Figure 8 The effect of different strains on the content of volatile compounds in fermented bamboo shoots.

[0027] Figure 9 The effects of different bacterial strains on the types and quantities of volatile compounds in fermented bamboo shoots.

[0028] Figure 10 The effect of different strains on the hardness of fermented bamboo shoots.

[0029] Figure 11 The effect of different strains on the crispness of fermented bamboo shoots.

[0030] Figure 12 Table 1: Relative contents of volatile compounds in bamboo shoots fermented with different lactic acid bacteria for 72 hours.

[0031] Figure 13 Table 1 (continued): Relative contents of volatile compounds in bamboo shoots fermented with different lactic acid bacteria for 72 hours.

[0032] Figure 14 The main aroma active compounds identified in bamboo shoots fermented with different lactic acid bacteria for 72 h (Table 2, OAV>1). Detailed Implementation

[0033] The present invention will be further described in detail below with reference to specific embodiments.

[0034] Evaluating the impact of fermentation on the edible quality of bamboo shoots and studying the changes in texture, microstructure, and color of bamboo shoots during fermentation are also important indicators for evaluating the preservation effect of bamboo shoots.

[0035] Color: Before testing, the sample was cut into cubes of 1 cm × 2 cm × 1 cm, and the color was measured using a colorimeter at room temperature in the dark.

[0036] Hardness (g) and brittleness (g): These are mainly simulated by mechanically compressing the sample twice to simulate the chewing motion in the human mouth, using mechanical testing methods to simulate the sensory evaluation of food texture.

[0037] The samples were placed under the P36R probe of the texture analyzer for testing. The test parameters were as follows: pre-test rate 2.0 mm / s, test rate 1.0 mm / s, post-test rate 1.0 mm / s, compression 40%, intermediate pause time 5.0 s, data acquisition rate 400 pps, trigger value 10.0 g, and each sample was measured 6 times. The average value was taken. Example

[0038] This strain was deposited at the China Center for Type Culture Collection on September 20, 2024, with accession number CCTCC M 20242014. Its Latin name is... Lactococcus cremoris Address: Wuhan University, Wuhan, Hubei Province, 430072, China. Tel: 027-68754052.

[0039] The colony characteristics of *Lactococcus lactis* PM13 preserved in this invention are as follows: on MRS agar plates, the colonies are milky white, round, opaque, with a small diameter (1 mm ± 0.5 mm), raised in a hemispherical shape, smooth surface, moist texture, and neat edges. The cell shape is spherical or oval. The optimal growth temperature is 25℃~37℃, and it is a facultative anaerobic bacterium. *Lactococcus lactis* PM13 belongs to the kingdom Bacteria, phylum Bacillota, class Bacilli, order Lactobacillales, family Streptococcaceae, and genus *Lactococcus*. Lactococcus Its colony morphology and cell morphology are shown in [the table / reference]. Figure 1 , Figure 2 and Figure 3 .

[0040] The strain preserved in this invention was screened from naturally fermented bamboo shoots, and the steps for obtaining it are as follows: First, multiple strains of lactic acid bacteria were screened from naturally fermented bamboo shoots.

[0041] Second, 2% of the selected lactic acid bacteria strains were inoculated into MRS broth containing 200 μg / mL NaNO2, mixed evenly, and anaerobic cultured at 30℃ for 24 h. The nitrite content in the supernatant was measured using uninoculated nitrite-containing medium as a blank control, and lactic acid bacteria with strong nitrite degradation ability were screened out.

[0042] Third, lactic acid bacteria with strong nitrite tolerance were screened by inoculating 2% by volume of lactic acid bacteria into MRS broth containing different NaNO2 contents (0, 50, 100, 150, 200, 250, 300 μg / mL) and incubating at 30 °C.

[0043] Fourth, from the above methods, the strain *Lactococcus lactis* PM13, which has strong activity, strong ability to degrade nitrite and nitrite tolerance, was screened out and its accession number is CCTCC M 20242014.

[0044] The DNA sequence of *Lactococcus lactis* PM13 preserved in this invention is as follows: 16S rDNA partial sequence: NNNCNNGGCNGCGTGCTATACATGCAGTTGAGCGATGAAGATTGGTGCTTGCACCAATTTGAAGAGCAGCGAACGGGTGA GTAACGCGTGGGGAATCTGCCTTTGAGCGGGGGACAACATTTGGAAACGAATGCTAATACCGCATAACAACTTTAAACAT AAGTTTTAAGTTTGAAAGATGCAATTGCATCACTCAAAGATGATCCCGCGTTGTATTAGCTAGTTGGTGAGGTAAAGGCT CACCAAGGCGATGATACATAGCCGACCTGAGAGGGTGATCGGCCACATTGGGACTGAGACACGGCCCAAACTCCTACGGG AGGCAGCAGTAGGGAATCTTCGGCAATGGACGAAAGTCTGACCGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCG TAAAACTCTGTTGGTAGAGAAGAACGTTGGTGAGAGTGGAAAGCTCATCAAGTGACGGTAACTACCCAGAAAGGGACGGC TAACTACGTGCCAGCAGCCGCGGTAATACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGTG GTTTATTAAGTCTGGTGTAAAAGGCAGTGGCTCAACCATTGTATGCATTGGAAACTGGTAGACTTGAGTGCAGGAGAGGA GAGTGGAATTCCATGTGTAGCGGTGAAATGCGTAGATATATGGAGGAACACCGGTGGCGAAAGCGGCTCTCTGGCCTGTA ACTGACACTGAGGCTCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGAGTGCTA GATGTAGGGAGCTATAAGTTCTCTGTATCGCAGCTAACGCAATAAGCACTCCGCCTGGGGAGTACGACCGCAAGGTTGAA ACTCAAAGGAATTGACNGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGAAGCAACGCGAAGAACCCTTACCNN TCTTGACATACTCGTGCTATTCCTAGAGATAGGAAGTTCCTTCGGGACANG Example

[0045] This embodiment provides a method for fermenting bamboo shoots with Lactococcus lactis PM13 obtained in Example 1. The specific steps are as follows.

[0046] (1) Cut fresh bamboo shoots into 3 mm thin slices, blanch them in boiling water at 100°C for 1 min and then quickly cool them to room temperature (about 25°C).

[0047] (2) Prepare a deionized water solution containing 2% (w / w) sucrose and 3.65% (w / w) salt, and inoculate the seed culture of Lactococcus lactis PM13 at a volume ratio of 4% to obtain the fermentation broth.

[0048] (3) Bamboo shoot slices and fermentation liquid are placed into a fermentation container at a mass ratio of 1:1 and fermented at a constant temperature of 30 °C for 72 h to obtain mixed fermented bamboo shoots with Lactococcus faecium PM13.

[0049] The resulting product had a pH of 3.02, a total acid content of 11.41 g / kg, a lactic acid content of 8.72 g / kg, and a nitrite content of less than 2 mg / kg. The product exhibited a distinct floral, fresh, fatty, and citrus flavor profile, with no off-odors.

[0050] The results were compared with other LM groups (Leuconostoc mesenteroides PM10) and LF groups (Lactobacillus fermentum PM11), and various data of bamboo shoots were measured as follows.

[0051] Bamboo shoots contain a large amount of carbohydrates. During fermentation, lactic acid bacteria decompose and utilize these carbohydrates to produce organic acids. The pH and total acidity change with the accumulation of organic acids, as shown in the following figures. Figure 5 and Figure 6 In fermented foods, pH is related to the relative growth rate of microorganisms and the accumulation of metabolites. This not only significantly affects sensory quality, but pH also indicates the maturity or even spoilage of kimchi. Figure 5 and Figure 6 It can be seen that the pH of the inoculated fermentation group was significantly lower than that of the CN group during fermentation, and the total acid content gradually increased with the extension of fermentation time. Compared with natural fermentation, the change in total acid content in the inoculated fermentation group was more significant, and the acid production efficiency was higher. This is mainly due to the introduction of a dominant lactic acid bacteria strain during the inoculation fermentation process, which allowed the lactic acid bacteria to quickly gain a dominant position in the early stage of fermentation and produce acid rapidly. The high initial bacterial concentration not only accelerated the metabolic activity of lactic acid bacteria, but also inhibited the growth of other microorganisms by rapidly lowering the environmental pH, further enhancing the competitive advantage of lactic acid bacteria. Therefore, inoculation fermentation can more effectively promote the accumulation of organic acids and improve the quality and stability of fermented products. Comparing the changes in pH and total acid content in the control group and the inoculated fermentation group, it was found that the CN group had fewer lactic acid bacteria in the early stage of fermentation and its growth and metabolism were inhibited by the environment, resulting in a slower rate of organic acid production and a slower rate of pH decrease. At 72 h of fermentation, the pH was 3.51 and the total acid was 6.01 g / kg. In contrast, the pH of the inoculated fermentation group dropped rapidly to below 4.0 at 12 h. Among them, *Lactococcus lactis* PM13 (LC group) showed the fastest pH decrease in the first 12 hours of fermentation. After 72 hours of fermentation, the pH of all inoculated fermentation groups dropped below 3.2, and acid production increased significantly. The results indicate that inoculation fermentation can rapidly produce acid, lowering the pH and increasing lactic acid content, which is beneficial for inhibiting the growth of unwanted bacteria, shortening the fermentation cycle, and, since fermented bamboo shoots are acidic, can effectively inhibit the proliferation and metabolic activity of spoilage bacteria, thus extending shelf life.

[0052] like Figure 7As shown, during bamboo shoot fermentation, the changes in nitrite content in each group exhibited a clear "nitrite peak" phenomenon, meaning that the nitrite content gradually increased in the early stages of fermentation, reached a peak, and then began to decline. The nitrite peak appeared later in group CN, and the content was the highest, at 7.31 mg / kg. This may be closely related to the growth of putrefactive microorganisms. In the early stages of fermentation, the activity of putrefactive microorganisms was high, leading to the accumulation of nitrite. As fermentation progressed, beneficial microorganisms, such as lactic acid bacteria, gradually became dominant, inhibiting the growth of putrefactive microorganisms, further degrading nitrite, thus leading to a decrease in nitrite content. The nitrite content gradually decreased as it further degraded. Figure 7 It can be seen that the nitrite content in the inoculated fermentation group was significantly lower than that in the CN group. This is likely because lactic acid bacteria can decompose nitrite in fermented vegetables, thus the peak nitrite content in fermented vegetables is significantly lower than that in naturally fermented vegetables. The nitrite content in the inoculated fermentation group reached its peak at 36 h, while the "nitrite peak" in the CN group appeared at 48 h, after which the content gradually decreased. This indicates that when using mixed lactic acid bacteria to ferment pickled bamboo shoots, the combined effects of factors such as the metabolic characteristics of lactic acid bacteria, pH changes, bacterial interactions, substrate competition, and fermentation conditions led to an earlier nitrite peak. The nitrite content during the fermentation process of all three lactic acid bacteria was significantly lower than that in the CN group, and the nitrite peak appeared earlier in the CN group as well. Nitrate-reducing bacteria reduce nitrate in the early stages of fermentation, leading to an increase in nitrite content. As fermentation progresses, the growth of these bacteria is gradually inhibited, and the amount of nitrite decreases. After 72 hours of fermentation, the nitrite content in all inoculated groups was lower than that in the CN group and met the national standard for green food pickled vegetables (4 mg / kg). The lowest nitrite content was observed in the *Lactococcus lactis* PM13 (LC group) and *Lactobacillus mucilaginosus* PM11 (LF group) fermentation groups. These results indicate that inoculation fermentation can effectively control nitrite content and improve the safety and quality of fermented bamboo shoots.

[0053] To further investigate the volatile flavor compounds in fermented bamboo shoots from different strains, HS-SPME-GC-MS was used to analyze the types and contents of volatile compounds. A total of 64 volatile compounds were detected in the four groups of fermented bamboo shoots, including 23 aldehydes, 15 alcohols, 5 acids, 7 esters, 7 ketones, and 7 other compounds. These compounds collectively constitute the main flavor of fermented bamboo shoots, forming their complex flavor profile. Figure 8 and Figure 9It can be seen that the types and contents of volatile compounds in fermented bamboo shoots varied considerably among different strains. The total contents in the four fermentation groups, from highest to lowest, were LF group > LM group > LC group > CN group. The LF group had the highest total compound content at 463.15 μg / kg, while the CN group had the lowest at 240.52 μg / kg. The number of volatile compounds in the inoculated fermentation groups was also higher than that in the control group. The results indicate that inoculation fermentation can significantly increase the types and contents of volatile components. Among the volatile compounds, the LM group (Leuconostoc mesenteroides PM10) and the LF group (Lactobacillus fermentum PM11) showed similar types and contents, producing a relatively high amount of aldehydes. However, the LC group (Lactococcus lactis PM13) had a significantly higher linalool content than the other groups, providing a greater floral aroma.

[0054] like Figure 10 and Figure 11 As shown, the hardness and crispness of fermented bamboo shoots in all groups gradually decreased with prolonged fermentation time. This is related to the acid production by lactic acid bacteria, cell wall degradation, and pectin dissolution during fermentation. However, the degree of textural degradation varied significantly among different bacterial strains. The natural fermentation (control group) showed the most dramatic decrease in hardness and crispness, significantly lower than all inoculated groups at the fermentation endpoint. P The pH value was <0.05, which may be due to the complex and uncontrollable microbial community in the natural fermentation system, containing various contaminating microorganisms (such as Enterobacteriaceae, yeasts, and molds). These microorganisms can secrete cell wall degrading enzymes such as pectinase and cellulase, accelerating the softening and loss of crispness of bamboo shoot tissue. In contrast, lactic acid bacteria inoculation and fermentation delayed the textural deterioration to some extent, indicating that the fermentation system dominated by *Lactococcus fattyae* PM13 can protect the integrity of cell wall structure by rapidly lowering the pH through acid production, inhibiting the growth of contaminating microorganisms and enzyme activity. Notably, the LC group (*Lactococcus fattyae* PM13) maintained the highest hardness and crispness values ​​throughout the fermentation process, indicating that this strain has the best textural preservation ability. This may be related to the fact that *Lactococcus fattyae* strains produce a component that protects the bamboo shoot cell wall, or that they produce little or no cell wall degrading enzymes during metabolism, or that they have a strong ability to synthesize extracellular polysaccharides. Extracellular polysaccharides can form a protective film on the tissue surface, reducing water loss and structural damage. Therefore, selecting the appropriate Lactococcus lactis PM13 for inoculation and fermentation can effectively slow down the decrease in hardness and crispness of bamboo shoots during the fermentation process, thereby improving the quality of the product.

[0055] After 72 hours of fermentation, the hardness and crispness of the bamboo shoots were about 30% and 46% higher than those of the control group, respectively, and also showed significant differences compared with the other two inoculated groups. This fully verified the crispness-preserving advantage of Lactococcus lactis PM13 in bamboo shoot fermentation and processing, clarified the application value of this strain in bamboo shoot fermentation and processing, and provided an excellent strain basis for developing crisp, tender, and safe fermented bamboo shoot products.

[0056] Due to differences in olfactory thresholds, the concentration of volatile organic compounds (VOCs) does not directly reflect their contribution to the overall aroma. To assess the relative impact of individual VOCs on the overall aroma of fermented bamboo shoots, odor activity values ​​(OAV) were calculated. Higher values ​​indicate greater aroma intensity, and VOCs with OAV > 1 are generally considered key aroma active compounds, significantly contributing to the overall aroma characteristics. Based on OAV analysis, 16 VOCs with OAV values ​​greater than 1 were identified as key aroma active compounds, including 11 aldehydes, 3 alcohols, 1 ketone, and 1 furan (Table 2), indicating their potential importance in sensory evaluation.

[0057] Aldehydes are the main contributors to the aroma characteristics of fermented bamboo shoots, primarily due to their low odor threshold and high aroma intensity. Most aldehydes impart fresh, fruity, and nutty aromas to pickled vegetables. In this study, the control group contained five aldehydes with an OAV > 1: (E)-2-nonenal (26.37), nonanal (21.28), octanal (10.80), (E)-2-octenal (2.22), and decanal (1.92). The LM and LF groups had the highest number of aldehydes with an OAV > 1 (11 per group), significantly more than the control and LC groups. In particular, these two groups showed relatively similar characteristics in terms of the type and concentration of aldehydes. This finding may be attributed to... L. mesenteroides and L. fermentum All samples underwent heterogenous fermentation metabolism and shared the same metabolic pathway. In contrast, the OAV values ​​of nonanal and octanal were higher in the LC group than in other groups, resulting in fermented bamboo shoots exhibiting pronounced fatty and citrus aromas. This study indicates that nonanal significantly affects the flavor of fermented bamboo shoots. Fatty aldehydes primarily originate from the release of free unsaturated fatty acids mediated by lipases. These fatty acids are subsequently converted to fatty acid peroxides by lipoxygenases (LOX), and then cleaved into aldehydes by peroxide lyases (HPL). Some aldehydes can undergo reversible interconversion with their corresponding alcohols under the catalysis of alcohol dehydrogenases (ADH). Although *Lactococcus lactis* strains lack these plant endogenous enzymes (LOX and HPL), the rapid acidification and plant cell wall degradation induced by *Lactococcus lactis* fermentation may promote the release of plant endogenous enzymes and enhance their activity, while simultaneously increasing the release of free fatty acids, thus providing more substrate for LOX / HPL-catalyzed oxidative cleavage.

[0058] The alcohols detected in fermented bamboo shoots mainly included ethanol, 1-octen-3-ol, and 1-nonanol. Although the ethanol content was relatively high after fermentation, its high odor threshold limited its direct contribution to the overall aroma. In contrast, 1-octen-3-ol and 1-nonanol exhibited OAV values ​​>1 in all groups. Specifically, the OAV values ​​of 1-octen-3-ol were significantly higher in the LM and LF groups than in other treatment groups. As an unsaturated alcohol with a unique mushroom-like aroma, this compound has been widely reported in various fermentation products. Notably, linalool was detected only in LC. Due to its extremely low odor threshold, it exhibited a high OAV value, contributing floral and fruity aromas to fermented bamboo shoots. Since *Lactococcus lactis* typically lacks the complete mevalonate (MVA) or methyl erythritol phosphate (MEP) pathway for the de novo synthesis of terpenoids, the accumulation of linalool is mainly attributed to strain-specific glycosidase activity. These enzymes (such as...) β α-Glucosidase hydrolyzes endogenous glycosylated terpene precursors present in the plant matrix, releasing linalool. Furthermore, the OAV values ​​of 2,3-butanedione and 2-pentylfuran were both greater than 1. 2,3-Butanedione exhibited the highest OAV value in the control group, while its content was significantly reduced or undetectable in the inoculated fermentation groups, indicating that inoculation with the starting strain effectively inhibited its own formation or that of its precursors. 2-Pentylfuran had an OAV value less than 1 in the control group but greater than 1 in all other inoculated groups, contributing to the aromas of green peas and butter.

[0059] p-Cresol is a commonly reported characteristic volatile compound in traditional pickled bamboo shoots, possessing a certain odor that affects the flavor of fragrant pickled bamboo shoots. It is also a characteristic substance of traditional fermented bamboo shoots. In this study, p-cresol was not detected in the fermented bamboo shoots. P-cresol is mainly produced by specific microorganisms through tyrosine metabolism. Amino acid analysis showed that the tyrosine content in the control group was significantly lower than that in the fermentation group inoculated with *Lactococcus lactis*. This result indicates that the inoculated *Lactococcus lactis* starting strain may effectively inhibit the metabolic pathway that converts tyrosine to p-cresol. Example

[0060] This embodiment provides a method for fermenting bamboo shoots with Lactococcus lactis PM13 obtained in Example 1. The specific steps are as follows.

[0061] (1) Cut fresh bamboo shoots into 1 mm thin slices, blanch them in 90°C water for 3 min and then quickly cool them to 4°C.

[0062] (2) Prepare a deionized water solution containing 2.2% (w / w) sucrose and 3.52% (w / w) salt, and inoculate the seed culture of Lactococcus lactis PM13 at a volume ratio of 1% to obtain the fermentation broth.

[0063] (3) Bamboo shoot slices and fermentation liquid are placed into a fermentation container at a mass ratio of 3:1 and fermented at a constant temperature of 28 °C for 48 h to obtain mixed fermented crispy bamboo shoots with Lactococcus faecium PM13. Example

[0064] This embodiment provides a method for fermenting bamboo shoots with Lactococcus lactis PM13 obtained in Example 1. The specific steps are as follows.

[0065] (1) Cut fresh bamboo shoots into 10 mm thin slices, blanch them in 95°C water for 0.2 min and then quickly cool them to 30°C.

[0066] (2) Prepare a deionized water solution containing 1.8% (w / w) sucrose and 3.87% (w / w) salt, and inoculate the seed culture of Lactococcus lactis PM13 at a volume ratio of 8% to obtain the fermentation broth.

[0067] (3) Bamboo shoot slices and fermentation liquid are placed into a fermentation container at a mass ratio of 1:2 and fermented at a constant temperature of 37°C for 96 h to obtain mixed fermented crispy bamboo shoots with Lactococcus faecium PM13.

Claims

1. A strain of *Lactococcus lactis* PM13, characterized in that, Latin name: Lactococcus cremoris It is deposited at the China Center for Type Culture Collection, accession number: CCTCC No: M20242014.

2. An application of the *Lactococcus lactis* as described in claim 1, characterized in that: The Lactococcus faecium PM13 is used to ferment bamboo shoots to prepare fragrant and sour bamboo shoots.

3. The application of *Lactococcus lactis* according to claim 1, characterized in that: The Lactococcus lactis PM13 is used to produce rich floral and fresh aromas during the fermentation of bamboo shoot fermentation broth.

4. The application of *Lactococcus lactis* according to claim 1, characterized in that: The Lactococcus faecium PM13 is used to maintain the crispness and firmness of bamboo shoots during fermentation in bamboo shoot fermentation broth.

5. A method for preparing fragrant pickled bamboo shoots, characterized in that, Includes the following steps: (1) Slice the fresh bamboo shoots, blanch them, and then cool them; (2) Dissolve sucrose and salt in water, inoculate with seed culture of Lactococcus lactis PM13, and obtain fermentation broth; (3) Mix the cooled bamboo shoot slices with the fermentation liquid and ferment them under constant temperature conditions to obtain fermented fragrant sour bamboo shoots.

6. The method for preparing fragrant pickled bamboo shoots according to claim 5, characterized in that, The slice thickness in step (1) is 1-10 mm, the hot scalding treatment is to blanch in hot water at 90-95℃ for 0.2-3 minutes, and the final cooling temperature is 4-30℃.

7. The method for preparing fragrant pickled bamboo shoots according to claim 5, characterized in that, The final concentration of sucrose in step (2) is 1.8% to 2.2% (w / w), and the final concentration of salt is 3.52% to 3.87% (w / w).

8. The method for preparing fragrant pickled bamboo shoots according to claim 5, characterized in that, The inoculation amount of the Lactococcus faecium PM13 seed liquid in step (2) is 1% to 8% of the fermentation liquid volume.

9. The method for preparing fragrant pickled bamboo shoots according to claim 5, characterized in that, The mass ratio of bamboo shoot slices to fermentation liquid in step (3) is 1:2 to 3:

1.

10. The method according to claim 1, characterized in that, The temperature for constant temperature fermentation in step (3) is 28~37℃, and the fermentation time is 48~96 hours.

Images