Pseudomonas sp. and application thereof
Patent Information
- Application Number
- CN202611097807.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-07-23
- Publication Date
- 2026-08-21
AI Technical Summary
然而,目前针对同化型HN-AD菌株的研究相对薄弱,已报道的兼具高效同化脱氮与稳定植物促生功能于一体的菌株资源极为匮乏,严重制约了相关技术的产业化应用
(1)本发明提供了一株新型的水解外假单胞菌L7,其为同化型异养硝化-好氧反硝化菌,区别于传统产气脱氮的HN-AD菌,能够将环境中的无机氮高效同化为菌体有机氮,从源头实现氮素的资源化固定,彻底解决了传统生物脱氮过程中氮素气态逸散导致的资源浪费问题。
Smart Images

Figure CN122609463A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of microbial technology, specifically relating to an assimilatory heterotrophic nitrifying-aerobic denitrifying bacterium—*Pseudomonas hydrolytica* L7 (… Ectopseudomonas hydrolytica L7), and its applications in the nitrogen resource utilization treatment of nitrogen-containing wastewater, simultaneous promotion of plant growth, and preparation of microbial fertilizers or soil conditioners. Background Technology
[0002] With the intensive development of livestock and poultry farming, nitrogen in a large amount of nitrogen-containing wastewater is released through ammonia nitrogen (NH4). + -N), nitrate nitrogen (NO3) - Nitrogen is lost into the aquatic environment in the form of nitrogen (N-N), causing serious non-point source pollution and triggering a series of ecological and environmental problems such as eutrophication of water bodies and excessive nitrate in groundwater. It also results in a huge waste of nitrogen resources.
[0003] Traditional biological nitrogen removal processes rely on the division of labor between autotrophic nitrifying bacteria and heterotrophic anaerobic denitrifying bacteria, requiring strict spatial or temporal separation of nitrification and denitrification processes. Nitrifying bacteria have long doubling times and are extremely sensitive to environmental conditions (temperature, pH, dissolved oxygen), resulting in long system start-up cycles and poor operational stability. Denitrification requires strictly anoxic conditions and a sufficient organic carbon source as an electron donor; when treating wastewater with a low C / N ratio, commercial carbon sources such as methanol or sodium acetate must be added, leading to high operating costs. Furthermore, the multi-tank series process (nitrification tank, denitrification tank, sedimentation tank, etc.) results in a large land area, making it difficult to promote and apply in areas with limited land resources.
[0004] Heterotrophic nitrification-aerobic denitrification ( Heterotrophic Nitrification-Aerobic Denitrification The discovery of HN-AD bacteria has overturned the above-mentioned traditional understanding. HN-AD bacteria can simultaneously complete the nitrification and denitrification processes under a single aerobic condition, using organic carbon as energy and carbon source, without the need to separate aerobic and anoxic zones. This fundamentally solves the inherent contradiction of separating nitrification and denitrification processes in traditional processes, resulting in a significant simplification of the process flow and a significant reduction in the floor space required.
[0005] Based on differences in nitrogen metabolic flow, the denitrification mechanisms of HN-AD bacteria can be divided into two types: dissimilatory pathways and assimilatory pathways. The dissimilatory pathway refers to the process by which strains gradually reduce inorganic nitrogen to gaseous products such as nitrogen gas (N2) or nitrous oxide (N2O) through a cascade of enzymes including nitrate reductase, nitrite reductase, nitric oxide reductase, and nitrous oxide reductase, releasing these products into the atmosphere. Currently, the vast majority of HN-AD bacteria reported domestically and internationally primarily employ the dissimilatory pathway for denitrification. While this can reduce nitrogen concentration in water bodies, from a material cycle perspective, converting valuable nitrogen resources into useless gaseous products and releasing them is essentially a loss and waste of resources, inconsistent with the concepts of circular economy and green sustainable development.
[0006] The assimilation pathway refers to the process by which strains convert inorganic nitrogen (ammonia nitrogen, nitrate nitrogen, and nitrite nitrogen) in the environment into organic nitrogen such as amino acids, proteins, and nucleic acids through the glutamine synthase-glutamate synthase (GS-GOGAT) and glutamate dehydrogenase (GDH) pathways, thus achieving the biological fixation and resource retention of nitrogen. Assimilative HN-AD bacteria can block the escape of nitrogen in gaseous form at the source, possessing irreplaceable advantages in the resource utilization of nitrogen in nitrogen-containing wastewater and the development of multifunctional microbial fertilizers. However, current research on assimilative HN-AD strains is relatively weak, and reported strains possessing both highly efficient assimilation and denitrification functions and stable plant growth-promoting functions are extremely scarce, severely restricting the industrial application of related technologies.
[0007] Meanwhile, existing plant growth-promoting bacteria generally have limited functions, focusing on either phosphorus and potassium solubilization, growth hormone secretion, or siderophore production, which fails to meet the demands of modern agriculture for multifunctional compound microbial fertilizers. Developing a novel multifunctional strain capable of simultaneously achieving pollution control, nitrogen resource recovery, and crop yield enhancement is of significant practical importance and has broad application prospects for the resource utilization of nitrogen-containing wastewater and the sustainable development of green agriculture. Summary of the Invention
[0008] The technical problem to be solved by the present invention is to overcome the deficiencies and defects mentioned in the background art. The present invention provides a novel hydrolytic Pseudomonas aeruginosa L7 strain, which is an assimilating HN-AD bacterium that can efficiently assimilate inorganic nitrogen sources such as ammonia nitrogen and nitrate nitrogen in the environment into organic nitrogen in the bacterial cell itself. This prevents nitrogen from being lost in gaseous form at the source, realizes the resource fixation of nitrogen, and has excellent plant growth promotion ability and broad environmental adaptability. It has unique application advantages in the fields of resource treatment of nitrogen-containing wastewater and development of multifunctional microbial fertilizers.
[0009] To solve the above-mentioned technical problems, the technical solution proposed by this invention is as follows:
[0010] In a first aspect, the present invention provides a strain of *Exopseudomonas hydrolyticus*, named *Exopseudomonas hydrolyticus* L7 (… Ectopseudomonas hydrolytica L7), with accession number CGMCC No. 39516 from the China General Microbiological Culture Collection Center, was deposited on June 29, 2026.
[0011] The *Pseudomonas hydrolyticus* L7 strain, isolated from pig manure wastewater, is an assimilatory heterotrophic nitrifying-aerobic denitrifying bacterium. Unlike traditional HN-AD bacteria that utilize gas-producing denitrification pathways, this strain efficiently assimilates inorganic nitrogen (ammonia nitrogen, nitrate nitrogen, nitrite nitrogen, and mixed nitrogen) from the environment into organic nitrogen within the bacterial cell via the glutamine synthase-glutamate synthase (GS-GOGAT) and glutamate dehydrogenase (GDH) pathways, thus achieving resource-based nitrogen fixation.
[0012] The hydrolyzing Pseudomonas aeruginosa L7 grows most vigorously in heterotrophic nitrification-aerobic denitrification medium (HNDM, which contains both ammonia nitrogen and nitrate nitrogen), with a short lag phase, a large slope in the logarithmic growth phase, and an OD600 of over 0.85 at the plateau phase.
[0013] Secondly, the present invention provides an application of the aforementioned hydrolytic exopsips in the nitrogen resource recovery treatment of nitrogen-containing wastewater. The method for nitrogen resource recovery treatment of nitrogen-containing wastewater includes the following steps: inoculating the hydrolytic exopsips into nitrogen-containing wastewater, so that the inorganic nitrogen in the nitrogen-containing wastewater is converted into organic nitrogen in the bacterial cells through microbial assimilation, thereby achieving nitrogen fixation and recovery.
[0014] In the above-described applications, preferably, the assimilation pathway is the glutamine synthase-glutamate synthase pathway and / or the glutamate dehydrogenase pathway, and the inorganic nitrogen is one or more of ammonia nitrogen, nitrate nitrogen, and nitrite nitrogen.
[0015] Preferably, the ambient temperature for nitrogen resource recovery treatment of the nitrogen-containing wastewater is 20℃~37℃, more preferably 30℃~37℃. 30℃ is the optimal temperature, at which the strain can achieve a 94.4% removal rate of ammonia nitrogen within 6 hours and completely remove nitrate nitrogen within 9 hours. At 20℃, the strain can still completely remove ammonia nitrogen and nitrate nitrogen within 12 hours and 24 hours respectively, demonstrating good low-temperature adaptability. At 37℃, nitrate nitrogen removal is accelerated to complete removal in 7.5 hours, indicating that its nitrate reduction system has higher thermal stability.
[0016] Preferably, the method for nitrogen resource recovery treatment of nitrogen-containing wastewater further includes adding sodium citrate as a carbon source to improve nitrogen assimilation efficiency. When sodium citrate is used as the carbon source, the denitrification efficiency of this strain is significantly better than that using sodium succinate or sodium acetate as carbon sources. It achieves a removal rate of over 94% for an initial concentration of approximately 44.46 mg / L ammonia nitrogen within 6 hours, and a removal rate of 100% for an initial concentration of approximately 57.29 mg / L nitrate nitrogen within 9 hours.
[0017] The hydrolyzed Pseudomonas exogenes L7 has extremely low nitrite accumulation throughout its metabolism, avoiding the harm of toxic intermediates to the environment and organisms, and has high environmental safety.
[0018] Thirdly, the present invention provides the application of the aforementioned hydrolyzed Pseudomonas aeruginosa in the preparation of microbial fertilizers or soil conditioners.
[0019] In the above-described application, preferably, the microbial fertilizer or soil conditioner is a formulation containing the hydrolyzed *Pseudomonas exogenae* L7 suspension, and the concentration of the hydrolyzed *Pseudomonas exogenae* L7 suspension is not less than 1 × 10⁻⁶. 8 CFU / mL.
[0020] Fourthly, the present invention provides an application of the aforementioned hydrolyzed exopseudomonas in promoting plant growth.
[0021] In the above-described application, preferably, the method for promoting plant growth includes the following steps: applying a bacterial suspension containing the hydrolyzed *Pseudomonas exogenae* to plant seeds, seedlings, roots, or rhizosphere soil, wherein the concentration of the bacterial suspension is not less than 1 × 10⁻⁶. 8 CFU / mL. This process achieves the organic transformation of environmental inorganic nitrogen while simultaneously increasing plant biomass.
[0022] Preferably, the plant is Arabidopsis thaliana.
[0023] Compared with the prior art, the beneficial effects of the present invention are as follows: (1) This invention provides a novel hydrolytic Pseudomonas aeruginosa L7, which is an assimilatory heterotrophic nitrifying-aerobic denitrifying bacterium. Unlike the traditional gas-producing denitrifying HN-AD bacteria, it can efficiently assimilate inorganic nitrogen in the environment into organic nitrogen in the bacterial cell, thereby realizing the resource fixation of nitrogen from the source and completely solving the problem of resource waste caused by the gaseous emission of nitrogen in the traditional biological denitrification process.
[0024] (2) This strain has both efficient denitrification and plant growth promotion functions, and shows unique advantages in realizing the functional coupling of wastewater denitrification, nitrogen resource utilization and plant growth promotion. It has broad application prospects.
[0025] (3) This strain has strong environmental adaptability and good denitrification efficiency in a wide temperature range of 20℃ to 37℃. Its adaptability to low temperature and high temperature environments is better than most of the similar strains reported, and it can meet the application needs of different climate regions.
[0026] (4) The strain has extremely low nitrite accumulation during use and high biosafety. Whether used in wastewater treatment or applied directly to the rhizosphere of crops, it can effectively avoid the risk of toxicity to the environment and organisms.
[0027] The hydrolyzed exopsys L7 of the present invention ( Ectopseudomonas hydrolytica The L7 strain is deposited at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 39516. The deposit date is June 29, 2026. The address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. Attached Figure Description
[0028] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0029] Figure 1 This is a phylogenetic tree of hydrolyzed exopsymonas L7 constructed based on the 16S rDNA sequence in Example 1 of the present invention.
[0030] Figure 2 These are colony morphology and Gram staining photographs of *Pseudomonas hydrolyticus* L7 from Example 1 of the present invention; wherein, Figure a shows the colony morphology of *Pseudomonas hydrolyticus* L7, and Figure b shows the Gram staining oil immersion image of *Pseudomonas hydrolyticus* L7.
[0031] Figure 3 This describes the ammonia nitrogen removal characteristics of hydrolyzed Pseudomonas exogenae L7 in Example 1 of the present invention.
[0032] Figure 4 This describes the nitrate removal characteristics of *Exopseudomonas aeruginosa* L7 in Example 1 of the present invention.
[0033] Figure 5 This describes the nitrite removal characteristics of *Exopseudomonas aeruginosa* L7 in Example 1 of the present invention.
[0034] Figure 6 This describes the removal characteristics of mixed nitrogen sources by *Exopsysporium exomorphum* L7 in Example 1 of the present invention.
[0035] Figure 7 This is a statistical chart of the KEGG enrichment pathway and energy metabolism classification of *Exopsysporium exogene* L7 in Example 1 of this invention.
[0036] Figure 8 This is a nitrogen metabolism pathway diagram of *Exopsysporium exogene* L7 in Example 1 of the present invention.
[0037] Figure 9 This invention relates to Example 1 of the study, which describes the effect of *Exopseudomonas hydrolyticus* L7 on the growth of *Arabidopsis thaliana*. Figure a shows the effect of different strains on *Arabidopsis thaliana* seed germination; Figure b shows representative images of *Arabidopsis thaliana* seed germination after 8 days of treatment with different strains; Figure c shows the effect of different strains on the fresh weight of *Arabidopsis thaliana* plants; Figure d shows representative images of *Arabidopsis thaliana* plant growth after 12 days of treatment with different strains; and Figure e shows the effect of different strains on the chlorophyll content of *Arabidopsis thaliana* plants.
[0038] Figure 10 This is the growth curve of *Exopseudomonas hydrolyticus* L7 and strain L6 in HNDM medium in Example 1 of the present invention.
[0039] Figure 11 This invention, Example 1, illustrates the denitrification characteristics of *Exopseudomonas hydrolyticus* L7 in different culture media. Figure a shows the growth and nitrogen transformation in HNM medium (ammonia nitrogen as the sole nitrogen source); Figure b shows the growth and nitrogen transformation in HNDM medium (mixed nitrogen sources); and Figure c shows the growth and nitrogen transformation in DM-1 medium (nitrate as the sole nitrogen source). The strains were cultured in the corresponding media at 30°C and 900 rpm with shaking. OD600 values and nitrogen concentrations were measured at specified time points. Data are expressed as mean ± standard deviation (n = 3).
[0040] Figure 12 This invention relates to Example 1, which describes the effect of temperature on the denitrification efficiency of *Pseudomonas hydrolyticus* L7. Figure a shows the growth of *Pseudomonas hydrolyticus* L7 in HNM medium at different temperatures; Figure b shows the growth of *Pseudomonas hydrolyticus* L7 in DM-1 medium at different temperatures; Figure c shows the ammonia nitrogen removal dynamics of *Pseudomonas hydrolyticus* L7 in HNM medium at different temperatures; and Figure d shows the nitrate nitrogen removal dynamics of *Pseudomonas hydrolyticus* L7 in DM-1 medium at different temperatures. The strains were cultured in the corresponding media at 20℃, 30℃, and 37℃ with shaking. Ammonia nitrogen or nitrate concentrations and OD600 were measured at specified time points. Data are expressed as mean ± standard deviation (n=3).
[0041] Figure 13This invention relates to Example 1, which describes the effect of carbon source on the denitrification efficiency of *Pseudomonas hydrolyticus* L7. Figure a shows the growth curves of *Pseudomonas hydrolyticus* L7 in HNM medium under different carbon sources (ammonia nitrogen was the sole nitrogen source); Figure b shows the growth curves of *Pseudomonas hydrolyticus* L7 in DM-1 medium under different carbon sources (nitrate nitrogen was the sole nitrogen source); Figure c shows the ammonia nitrogen removal dynamics of *Pseudomonas hydrolyticus* L7 in HNM medium under different carbon sources; and Figure d shows the nitrate nitrogen removal dynamics of *Pseudomonas hydrolyticus* L7 in DM-1 medium under different carbon sources. The strains were cultured with sodium citrate, sodium acetate, and sodium succinate as the sole carbon source at 30°C and 900 rpm with shaking. OD600 values and nitrogen concentrations were measured at specified time points. Data are expressed as mean ± standard deviation (n=3).
[0042] Figure 14 This invention relates to Example 1, which analyzes the activity of key enzymes in nitrogen metabolism of *Pseudomonas hydrolyticus* L7. Figure a shows a schematic diagram of the nitrogen assimilation pathway and key enzymes in *Pseudomonas hydrolyticus* L7; NR: nitrate reductase; NIR: nitrite reductase; GS: glutamine synthase; GOGAT: glutamate synthase; GDH: glutamate dehydrogenase; Figure b shows the activity of nitrate reductase (NR) under different nitrogen sources; Figure c shows the activity of nitrite reductase (NIR) under different nitrogen sources; Figure d shows the activity of glutamine synthase (GS) under different nitrogen sources; Figure e shows the activity of glutamate dehydrogenase (GDH) under different nitrogen sources; Figure f shows the activity of glutamate synthase (GOGAT) under different nitrogen sources. Enzyme activities were measured after the strain was cultured for 6 h in HNM (ammonia nitrogen as the sole nitrogen source), DM-1 (nitrate nitrogen as the sole nitrogen source), and HNDM (ammonia nitrogen + nitrate nitrogen mixed nitrogen source). Data are expressed as mean ± standard deviation (n=3). P<0.05; P<0.01; P < 0.001, determined by t-test.
[0043] Figure 15 This is Example 1 of the present invention, showing the changes in nitrogen speciation and dynamics of nitrite accumulation in different culture media; wherein, Figure a shows the NH4+ content at 0 h and 6 h in different culture media. + NO3 - NO2 - Concentration comparison; HNM: NH4 + -N is the sole nitrogen source; DM-1: NO3 - -N is the sole nitrogen source; DM-2: NO2 - -N is the sole nitrogen source; HNDM: NH4 + -N and NO3 --N represents a mixed nitrogen source; Figure b compares nitrite content after 6 h of culture in different media. Data are expressed as mean ± standard deviation (n=3); Figure c shows the dynamics of nitrite accumulation from 0 to 6 h in DM-1 and HNDM media. The strains were cultured with shaking at 30℃ and 900 rpm, and nitrite concentration was measured at specified time points. Data are expressed as mean ± standard deviation (n=3).
[0044] Figure 16 This is the relative expression level of gltB and gltD genes under different nitrogen sources in Example 1 of the present invention; wherein, Figure a shows the relative expression level of gltB, the gene encoding the large subunit of GOGAT, under different nitrogen sources; Figure b shows the relative expression level of gltD, the gene encoding the small subunit of GOGAT, under different nitrogen sources; the strain was in HNM (NH4) + -N is the sole nitrogen source), DM-1 (NO3) - -N is the sole nitrogen source) and HNDM (NH4+) + -N and NO3 - Total RNA was extracted after culturing in a medium containing a mixed nitrogen source (-N) for 6 h. The 16S rRNA gene of *Pseudomonas exogenae* L7 was used as an internal control. A 2... -ΔΔCt Relative expression levels were calculated using the method. Data are expressed as mean ± standard deviation (n=3). P<0.05; P<0.01; P < 0.001, determined by t-test.
[0045] Figure 17 This is a preliminary investigation of the GOGAT activity regulation mechanism in Example 1 of the present invention; Figure a shows the effect of different nitrogen sources added in vitro on GOGAT activity; crude GOGAT enzyme solution was extracted from bacteria cultured in HNM medium, and ammonium salt, nitrate salt, and a mixture of the two were added to the in vitro reaction system, and GOGAT enzyme activity was measured; Figure b shows the effect of AKP on GOGAT activity; alkaline phosphatase (AKP) was added to HNM medium, and GOGAT enzyme activity was measured after 6 h of culture; Figure c shows the effect of phosphatase inhibitors on GOGAT activity. Phosphatase inhibitors were added to HNM medium, and GOGAT enzyme activity was measured after 6 h of culture. Data are expressed as mean ± standard deviation (n=3), and ns indicates no significant difference (n=3). P>0.05). P<0.05; P<0.01; P < 0.001, determined by t-test. Detailed Implementation
[0046] To facilitate understanding of the present invention, the present invention will be described more fully and in detail below with reference to the accompanying drawings and preferred embodiments, but the scope of protection of the present invention is not limited to the following specific embodiments.
[0047] Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by those skilled in the art. The technical terms used herein are for the purpose of describing particular embodiments only and are not intended to limit the scope of the invention.
[0048] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be purchased from the market or prepared by existing methods.
[0049] The methods for determining cell biomass and inorganic nitrogen concentration in the following experiments are as follows: Cell biomass (OD600): optical density method; Ammonia nitrogen: Nessler's reagent spectrophotometry; Nitrate nitrogen: Ultraviolet spectrophotometry; Nitrite nitrogen: N-(1-naphthyl)ethylenediamine spectrophotometric method; Total nitrogen: potassium persulfate-ultraviolet spectrophotometry.
[0050] The following are the removal efficiency formulas for each substrate: Substrate removal rate (%): R1 = (C0) C t ) / C0× 100%; Substrate removal rate (mg / L / h): R2 = (C0) C t ) / t; In the formula, C0 is the initial substrate concentration (mg / L); C t The substrate concentration (mg / L) at time t is the incubation time (h).
[0051] Culture medium formulation: LB liquid medium: 10 g / L tryptone, 5 g / L yeast extract, 5 g / L NaCl, no solidifying agent, homogeneous liquid overall.
[0052] LB solid medium: 10 g / L tryptone, 5 g / L yeast extract, 5 g / L NaCl, with an additional 1.5%~2% agar powder as a solidifying agent.
[0053] Heterotrophic nitrification medium (HNM): 0.2358 g / L (NH4)2SO4, 10.55 g / L Na2HPO4·12H2O, 1.5 g / L KH2PO4, 0.1 g / L MgSO4·7H2O, 3.26 g / L sodium citrate, 2 mL / L trace element solution.
[0054] Aerobic denitrification medium (DM-1): 0.36 g / L KNO3, 10.55 g / L Na2HPO4·12H2O, 1.5 g / L KH2PO4, 0.1 g / L MgSO4·7H2O, 3.26 g / L sodium citrate, 2 mL / L trace element solution.
[0055] Aerobic denitrification medium (DM-2): 0.1232 g / L NaNO2, 10.55 g / L Na2HPO4·12H2O, 1.5 g / L KH2PO4, 0.1 g / L MgSO4·7H2O, 3.26 g / L sodium citrate, 2 mL / L trace element solution.
[0056] Heterotrophic nitrification-aerobic denitrification medium (HNDM): 0.1179 g / L (NH4)2SO4, 0.18 g / L KNO3, 10.55 g / L Na2HPO4·12H2O, 1.5 g / L KH2PO4, 0.1 g / L MgSO4·7H2O, 3.26 g / L sodium citrate, 2 mL / L trace element solution.
[0057] Trace element solution: 50.0 g / L EDTA-2Na, 2.2 g / L ZnSO4, 5.5 g / L CaCl2, 5.06 g / LMnCl2·4H2O, 5.0 g / L FeSO4·7H2O, 1.57 g / L CuSO4·5H2O, 1.61 g / L CoCl2·6H2O.
[0058] 1 / 2MS solid medium: 2.49 g / L 1 / 2MS powder, 1% sucrose, 0.8% agar, pH adjusted to 5.8 with KOH.
[0059] Solid agar plates: Add agar powder to the corresponding culture medium at a volume ratio of 1.5%.
[0060] All culture media were initially pHed to 7.0 and autoclaved at 121°C for 30 min.
[0061] The following examples use hydrolyzed exopseudomonas L7 ( Ectopseudomonas hydrolyticaThe L7 strain is deposited at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 39516, and the deposit date is June 29, 2026.
[0062] Example 1 This invention provides a strain of hydrolyzed exopsips (Pseudomonas hydrolyticus). Ectopseudomonas hydrolytica The strain was named *Exopseudomonas hydrolyticus* L7. Ectopseudomonas hydrolytica L7).
[0063] Experiment 1. Screening and Identification of Strains 1.1 Materials The pig manure used for bacterial screening in this invention was collected from the Institute of Subtropical Agriculture Ecology, Chinese Academy of Sciences. Sampling took place in May 2023. The collected pig manure samples were placed in sterile sample bags for subsequent enrichment, acclimatization, and isolation of bacterial strains.
[0064] Artificially synthesized wastewater: Trace element solution 0.50 mL / L, sodium citrate 1.02 g / L, ammonium sulfate 0.1179 g / L, dipotassium hydrogen phosphate (trihydrate) 0.0552 g / L, potassium dihydrogen phosphate 0.033 g / L, magnesium sulfate (heptahydrate) 0.257 g / L, calcium chloride 0.0551 g / L. Trace element solution: potassium iodide 0.14 g / L, boric acid 0.10 g / L, copper sulfate (pentahydrate) 0.02 g / L, manganese chloride (tetrahydrate) 0.09 g / L, ferric chloride (hexahydrate) 1.00 g / L, sodium molybdate (dihydrate) 0.045 g / L, cobalt chloride (hexahydrate) 0.10 g / L, EDTA-2Na 7.50 g / L, zinc sulfate 0.09 g / L.
[0065] 1.2 Strain screening process (1) Weigh 400 g of pig manure sample and add it to a 2 L graduated cylinder. Pour in 1600 mL of sterile double-distilled water (ddH2O), mix well, and let stand for 30 min. Then pour out 500 mL of the upper layer of manure water into an Erlenmeyer flask as the initial manure water sample for enrichment and acclimatization of HN-AD functional bacteria. Inoculate 20 mL of the initial manure water sample into 180 mL of HNDM medium. Then place it in a constant temperature (30℃) shaker and culture aerobically at 150 rpm for 60 days. During the process, periodically take out 20 mL of bacterial suspension (hereinafter referred to as bacterial suspension) and add an equal amount of HNDM medium. Centrifuge the collected bacterial suspension (8000 rpm, 10 min) and collect the supernatant to determine the concentration of each inorganic nitrogen and total nitrogen. The experiment was set up with 3 biological replicates.
[0066] (2) The bacterial precipitate collected after centrifugation was washed three times with sterile ddH2O, and the sample precipitate was stored at -80℃ for subsequent molecular biological detection. Based on the characteristic changes in the enrichment and acclimatization process, the acclimatization process of HN-AD functional bacteria was divided into three stages: stage 1 (0~16 d), stage 2 (17~38 d), and stage 3 (39~60 d). The bacterial precipitates at five key time points were selected as the analysis objects. In stage 1, samples were selected from day 0, day 2, and day 16; in stage 2, samples were selected from day 35; and in stage 3, samples were selected from day 52. For easy differentiation, the above sampling time points were numbered sequentially as T1 (0 d), T2 (2 d), T3 (16 d), T4 (35 d), and T5 (52 d), and three biological replicates were set up for each time point.
[0067] (3) Five purified strains (tentatively named L1, L4, L5, L6, and L7) were successfully obtained by isolating and purifying the HN-AD functional bacterial groups obtained through enrichment and domestication. The HN-AD function of these five purified strains was preliminarily investigated using HNDM medium. After 4 h of treatment, the ammonia nitrogen concentration in the experimental groups was significantly lower than that in the control group (P<0.05), but the degradation effects varied. Among them, strain L7 had the best ammonia nitrogen removal effect, with a removal rate as high as 100%.
[0068] (4) 16S rDNA sequencing and identification of strain L7 were performed. Based on the 16S rDNA sequence, a phylogenetic tree of each HN-AD strain was constructed, and the blast sequence alignment results, query cover, and percent identity were recorded. Figure 1 As shown. Strain L7 and Ectopseudomonas hydrolytica strain KHPS2 (99.65%) is highly homologous and has been identified as [the source of the KHPS2 group]. Ectopseudomonas hydrolytica It was named *Exopseudomonas hydrolyticus* L7 ( Ectopseudomonas hydrolytica L7 (abbreviated as L7). This strain was deposited on June 29, 2026 at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 39516, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.
[0069] (5) Next, colony morphology and oil immersion observation were performed on Pseudomonas hydrolyticus L7. Figure 2 The colony morphology and Gram staining images of Pseudomonas hydrolyticus L7 are shown. The colonies of Pseudomonas hydrolyticus L7 are milky white, round in shape, with blurred edges and a moist and smooth surface. Under an oil immersion microscope, they appear as short rods.
[0070] (6) The ability of hydrolyzing *Pseudomonas exogenae* L7 to remove ammonia nitrogen was verified using HNM medium. For example... Figure 3 As shown, the nitrogen degradation process of *Exopseudomonas hydrolyticus* L7 is similar to that of strain L1. Ammonia nitrogen concentration rapidly decreases within 0–12 h, bacteria grow rapidly, and a small amount of nitrite nitrogen accumulates, which is completely removed by 36 h. The ammonia nitrogen removal rate is 94.46% at 12 h, and reaches its lowest point at 48 h with a removal rate of 96.47%. Bacterial growth peaks at 0.37 at 48 h, and no nitrite nitrogen accumulates during the culture period. The total nitrogen concentration drops to a minimum of 7.51 mg / L at 12 h, with a removal rate of 84.10%, and then fluctuates between 8.00 and 9.00 mg / L. These results indicate that *Exopseudomonas hydrolyticus* L7 has a good and efficient denitrification capacity when using ammonia nitrogen as the nitrogen source.
[0071] (7) The ability of *Exopsysporium exolyticus* L7 to remove nitrate nitrogen was verified using DM-1 medium. For example... Figure 4 As shown, *Exopseudomonas hydrolyticus* L7 grew rapidly from 0 to 12 h, with the OD600 value increasing from 0.00 to 0.34, peaking at 0.45 at 36 h. During this period, the nitrate nitrogen concentration decreased rapidly from 51.74 mg / L to 7.60 mg / L, with a nitrate nitrogen removal rate of 3.68 mg / L / h. The nitrate nitrogen removal rate subsequently reached 100.00% at 36 h. No significant accumulation of nitrite nitrogen was observed throughout the culture period. The total nitrogen concentration rapidly decreased to 5.17 mg / L from 0 to 12 h, at which point the removal rate reached 90.00%, with a slight increase during subsequent culture periods. These results indicate that *Exopseudomonas hydrolyticus* L7 exhibits a maximum removal rate of 100.00% and a maximum removal rate of 3.68 mg / L / h when using nitrate nitrogen as the nitrogen source, demonstrating good and efficient nitrogen removal capabilities.
[0072] (8) The ability of *Exopseudomonas hydrolyticus* L7 to remove nitrite nitrogen was verified using DM-2 medium. For example... Figure 5 As shown, L7 grew rapidly from 0 to 12 h, with the OD600 value increasing from 0.00 to 0.24, and reaching a peak of 0.35 at 36 h. During the 0-12 h period, the nitrite nitrogen concentration rapidly decreased to 0.00 mg / L, achieving a removal rate of 100.00%. The ammonia nitrogen concentration fluctuated within a small range, decreasing to 0.00 mg / L at 48 h. The total nitrogen concentration decreased to 7.54 mg / L at 12 h and then stopped decreasing, achieving a removal rate of 77.10%. These results indicate that *Pseudomonas hydrolyticus* L7, using nitrite nitrogen as the nitrogen source, achieved a maximum nitrite nitrogen removal rate of 100.00%, demonstrating excellent and efficient denitrification capabilities.
[0073] (9) The ability of hydrolyzed *Pseudomonas exogenae* L7 to remove mixed nitrogen sources was verified using HNDM medium. For example... Figure 6As shown, *Exopseudomonas hydrolyticus* L7 grew well in the mixed nitrogen source medium. The OD600 value increased from 0.00 to 0.40 from 0 to 12 h, reaching a peak of 0.44 at 48 h. The ammonia nitrogen concentration decreased to a minimum of 1.59 mg / L at 12 h, with a removal rate of 93.30%. The nitrate nitrogen concentration rapidly decreased to 1.88 mg / L from 0 to 12 h, and was completely removed by 24 h, achieving a removal rate of 100.00%. The total nitrogen concentration decreased to a minimum of 7.84 mg / L at 24 h, with a removal rate of 86.06%. In conclusion, *Exopseudomonas hydrolyticus* L7 grew well in HNDM medium and exhibited good denitrification ability.
[0074] (10) The whole genome sequencing results of Pseudomonas hydrolyticus L7 showed that among the KEGG enriched pathways, there were 185 genes related to energy metabolism, of which 27 were related to nitrogen metabolism. Figure 7 ).
[0075] (11) Nitrogen metabolism-related genes and possible nitrogen metabolism pathways obtained from the whole genome sequencing of *Exopsysporium hydrolysate* L7, such as... Figure 8 As shown, the strain transports nitrate and nitrite nitrogen into the cell via a nitrate / nitrite transporter protein encoded by the narK gene. Nitrate nitrogen is reduced to nitrite nitrogen under the catalysis of nitrate reductases encoded by the napA / B genes. The narK and napA / B genes are mainly involved in the dissimilar nitrate reduction (DNRA) process. Simultaneously, nitrate nitrogen can also enter the cell via the ABC transport system composed of proteins encoded by the nrtA / B / C genes, which belongs to the assimilar nitrate reduction (ANRA) pathway. Furthermore, *Pseudomonas hydrolyticus* L7 can also catalyze the degradation of nitrosalkanes using nitropropane dioxygenase (npd) to obtain nitrite nitrogen for its own use, indicating that *Pseudomonas hydrolyticus* L7 possesses potential nitroalkane degradation capabilities. In the further conversion of nitrite nitrogen, *Pseudomonas hydrolyticus* L7 catalyzes the reduction of nitrite nitrogen to ammonia nitrogen via nitrite reductases encoded by the nirB / D genes. During nitrogen assimilation, *Exopseudomonas hydrolyticus* L7 can utilize ammonia nitrogen to synthesize amino acids and other nitrogen-containing compounds for growth and reproduction. These results indicate that *Exopseudomonas hydrolyticus* L7 employs multiple pathways in nitrogen metabolism and can efficiently utilize exogenous inorganic nitrogen (ammonia nitrogen, nitrate nitrogen, and nitrite nitrogen) by synthesizing various enzymes.
[0076] Experiment 2. Effects of the strain on Arabidopsis seed germination, plant fresh weight, and chlorophyll content. Seed germination test: Plump Arabidopsis wild-type seeds were collected, disinfected with 75% ethanol for 8 min, and then washed 3-4 times with sterile deionized water. The disinfected seeds were then irradiated with a bacterial suspension of 5 strains (1×10⁻⁶). 8Seeds were soaked in sterile deionized water (CFU / mL) and sterile deionized water (control group) for 5 min, and then sown on 1 / 2 MS solid medium plates. The culture conditions were: temperature 25℃, light intensity 5500 lx, photoperiod 18 h light / 6 h dark. Seed germination rate was calculated after 8 days of culture. Figure 9 The ab diagram showed that, compared with the control group, there was no significant difference in seed germination rate after treatment with the five strains (P>0.05), and none of them showed obvious inhibitory effects. The radicles and cotyledons of Arabidopsis thaliana in each treatment group developed normally, and no malformation, yellowing, or growth retardation or other toxic phenomena were observed.
[0077] Seedling growth experiment: Arabidopsis thaliana seedlings at the two-leaf-one-heart stage were transplanted into nutrient soil (vermiculite: nutrient soil = 1:1). After 7 days of acclimatization culture, freshly prepared overnight culture solution was evenly poured into the rhizosphere soil at a dosage of 1.2 mL per pot. After 12 days of continued culture, the fresh weight of the plants and chlorophyll content were measured. Figure 9 The CD plots showed that the L7 treatment group had the highest fresh weight, reaching 0.074 ± 0.015 g / strain, which was significantly higher than the control group (0.061 ± 0.012 g / strain) by 20.9% (P<0.05); the L6 treatment group had a fresh weight of 0.071 ± 0.020 g / strain, which was significantly higher than the control group by 15.7% (P<0.05). Figure 9 Figure e shows that there was no significant difference in chlorophyll content between the treatment groups and the control group (P>0.05), and no stress characteristics such as decreased chlorophyll or inhibited photosynthesis were observed.
[0078] It is evident that *Exopseudomonas hydrolyticus* L7 has no toxic effects on Arabidopsis thaliana, exhibits good biosafety, can significantly promote the increase of plant fresh weight, and is safe and harmless to the plant photosynthetic system. It is an excellent strain with both nitrogen assimilation and plant growth-promoting potential.
[0079] Experiment 3. Determination of the growth characteristics of the strain To further screen target strains for subsequent studies, the growth characteristics of *Pseudomonas hydrolyticus* L7 and strain L6 in heterotrophic nitrification-aerobic denitrification medium (HNDM) were determined.
[0080] Experimental Methods: Freshly cultured single colonies from LB agar plates were inoculated into LB liquid medium and incubated overnight at 30°C with shaking at 900 rpm. The OD600 value of the overnight bacterial culture was measured. The initial OD600 was uniformly adjusted to 0.085 and inoculated into fresh HNDM medium, and incubated at 30°C with shaking at 900 rpm. Samples were taken at 0, 3, 6, 9, 21, 36, and 48 h to measure the OD600 value. Each group was divided into three replicates.
[0081] The results are as follows Figure 10As shown, both strains exhibited typical bacterial growth curves within 48 hours of culture, but their growth rates and biomass accumulation differed significantly. *Exopseudomonas hydrolyticus* L7 showed superior growth performance: a shorter lag phase, entering the logarithmic growth phase after 6 hours of culture; a longer logarithmic growth phase with a steeper slope; and a plateau phase reached after 36 hours of culture, with a peak OD600 value of approximately 0.85. In contrast, strain L6 grew more slowly: its lag phase extended to approximately 9 hours; its logarithmic growth phase had a smaller slope; and its peak OD600 value at the plateau phase was approximately 0.60, significantly lower than that of *Exopseudomonas hydrolyticus* L7.
[0082] Growth curve results showed that *Exopseudomonas hydrolyticus* L7 exhibited stronger growth adaptability and higher biomass accumulation in HNDM medium.
[0083] Experiment 4. Denitrification characteristics of the strain in different nitrogen source media The growth and denitrification characteristics of the strain were determined in heterotrophic nitrification medium (HNM, ammonia nitrogen as the sole nitrogen source), aerobic denitrification medium (DM-1, nitrate as the sole nitrogen source), and heterotrophic nitrification-aerobic denitrification medium (HNDM, a mixture of ammonia nitrogen and nitrate as nitrogen sources).
[0084] Experimental Methods: The bacterial culture cultured overnight in LB liquid medium was used as the seed culture, and the OD600 was adjusted to 1.0. At an inoculum size of 1% (v / v), the culture was transferred to HNM, DM-1, and HNDM liquid media, respectively. The cultures were incubated with shaking at 30℃ and 900 rpm, and samples were taken at specified time points. The bacterial culture samples were centrifuged at 4℃ and 10,000 rpm for 2 min, and the supernatant was used to determine the nitrogen concentration. Ammonia nitrogen was determined using Nessler's reagent spectrophotometry, nitrate nitrogen was determined using ultraviolet spectrophotometry, and nitrite nitrogen was determined using the N-(1-naphthyl)-ethylenediamine spectrophotometric method.
[0085] The results are as follows Figure 11 As shown: (a) In HNM medium ( Figure 11 (Figure a) The strain exhibited highly efficient ammonia nitrogen assimilation capacity. The ammonia nitrogen concentration continuously decreased from an initial 44.46 mg / L, reaching 2.47 mg / L after 6 h, with a removal rate of 94.4%. The rapid removal period of ammonia nitrogen (3–6 h) was highly synchronized with the logarithmic growth phase of the strain, with an average removal rate of 7.25 mg·L⁻¹ within 4.5 h. -1 ·h -1 No significant accumulation of nitrates or nitrites was observed throughout the process, indicating that ammonia nitrogen was mainly converted into cellular material directly through assimilation, rather than through nitrification.
[0086] (b) In DM-1 medium ( Figure 11(Figure c): Nitrate concentration decreased continuously from an initial 57.29 mg / L and was completely removed after 9 h. Nitrite showed a brief accumulation during the process, peaking at 2.0 mg / L at 4.5 h, then rapidly decreased and was completely consumed after 9 h. Ammonia nitrogen remained at a low level (2.3–4.6 mg / L), indicating that the ammonia nitrogen produced by nitrate reduction was rapidly assimilated.
[0087] (c) In HNDM medium ( Figure 11 (Figure b): The strain exhibited the most vigorous growth, with an OD600 value of 0.517 at 10.5 h, significantly higher than HNM (0.336) and DM-1 (0.402). Ammonia nitrogen decreased to 0.33 mg / L at 7.5 h, achieving a removal rate of 98.5%. Nitrate removal rate accelerated significantly, with rapid removal concentrated within 1.5 h from 6 to 7.5 h, reaching a removal amount of 19.79 mg / L, and an average removal rate as high as 13.19 mg·L⁻¹. -1 ·h -1 The utilization of ammonia nitrogen and nitrate exhibits a temporal pattern—the strain preferentially utilizes ammonia nitrogen, and only begins to utilize nitrate in large quantities after the ammonia nitrogen is depleted. The nitrite accumulation value is extremely low, far lower than that of DM-1, indicating that the nitrite reduction step is highly efficient under mixed nitrogen source conditions and is not the rate-limiting step in nitrogen conversion.
[0088] The above results indicate that the strain can grow well under all three nitrogen source conditions, and exhibits strong adaptability and transformation ability to both single and mixed nitrogen sources. It converts inorganic nitrogen into organic nitrogen in the bacterial cells through assimilation, thereby realizing the resource-based fixation of nitrogen.
[0089] Experiment 5. Effect of temperature on the denitrification efficiency of the strain Three temperature gradients of 20℃, 30℃ and 37℃ were set up to determine the nitrogen removal dynamics and growth of the strain in HNM and DM-1 media.
[0090] Experimental methods: Seed culture was prepared according to the method in Experiment 4 of this embodiment, and inoculated into HNM and DM-1 culture media respectively. The culture was carried out at 20℃, 30℃ and 37℃ with shaking at 900 rpm. Samples were taken at the specified time points to determine the nitrogen concentration and OD600 value.
[0091] The results are as follows Figure 12 As shown: (a) The effect of temperature on the growth of the strain ( Figure 12(Figures a and b): 30℃ is the optimal growth temperature. In HNM, the OD600 reaches 0.336 after 10.5 h, and in DM-1, it reaches 0.402. 20℃ significantly inhibits growth. In HNM, the strain experiences a prolonged lag phase, only entering the logarithmic growth phase after 12 h, but the final biomass can still approach the level of 30℃. 37℃ exhibits a "rapid early growth, stagnant later growth" characteristic: in HNM, the OD600 reaches 0.304 after 4.5 h, significantly higher than the same period at 30℃, but growth stagnates thereafter, and at 10.5 h, it is actually lower than 30℃.
[0092] (b) The effect of temperature on ammonia nitrogen removal Figure 12 (Figure c): Efficiency is highest at 30℃, with an ammonia nitrogen removal rate of 94.4% within 6 hours. Removal slows down at 20℃, requiring 12 hours for complete removal, twice as long as at 30℃, but complete removal is eventually achieved. At 37℃, the removal rate exhibits a pattern of "rapid initial removal followed by stagnation," reaching 89.8% at 4.5 hours, but then stagnates, ultimately achieving only 86.8% removal, failing to completely remove ammonia nitrogen.
[0093] (c) Effect of temperature on nitrate removal Figure 12 (Figure d): 30℃ is the optimal temperature for complete nitrate removal, with an average removal rate of 11.40 mg·L⁻¹ during the 4.5–7.5 h period. -1 ·h -1 It is highly effective in a short time at 37℃, achieving complete removal in 7.5 hours, 1.5 hours earlier than at 30℃, with an average removal rate as high as 25.81 mg·L⁻¹ during the 6-7.5 hour period. -1 ·h -1 This indicates that the nitrate reductase system has extremely high activity under high temperature conditions. Removal at 20℃ is extremely slow, requiring 24 hours for complete removal, which is about 1.7 times longer than at 30℃.
[0094] The above results indicate that 30℃ is the optimal temperature; at 20℃, the rate slows down but can eventually be completely removed, showing that the strain exhibits low-temperature adaptability; at 37℃, nitrate removal is accelerated but ammonia nitrogen removal is incomplete, revealing that the nitrate reduction system has higher thermal stability.
[0095] Experiment 6. Effect of carbon source on nitrogen removal efficiency of bacterial strains The growth and nitrogen removal dynamics of the strains in HNM and DM-1 media were determined using sodium citrate, sodium acetate, and sodium succinate as the sole carbon source, respectively.
[0096] Experimental methods: Seed culture was prepared according to the method in Experiment 4 of this embodiment, and inoculated into HNM and DM-1 media with sodium citrate, sodium succinate and sodium acetate as the only carbon sources, respectively. The culture was shaken at 30℃ and 900 rpm. Samples were taken at specified time points to determine nitrogen concentration and OD600 value.
[0097] The results are as follows Figure 13 As shown: (a) The effect of carbon source on strain growth ( Figure 13 (Figures a and b): The carbon source utilization efficiency is ranked as follows: sodium citrate > sodium succinate > sodium acetate. Sodium citrate is the optimal carbon source, with an OD600 of 0.336 in HNM and 0.402 in DM-1 after 10.5 h. Sodium succinate is the next best, with an OD600 of 0.320 in HNM and 0.367 in DM-1 after 10.5 h. Sodium acetate severely inhibits growth, with an OD600 of only 0.064 in HNM and only 0.024 in DM-1 after 10.5 h; the strain showed almost no growth.
[0098] (b) The effect of carbon source on ammonia nitrogen removal Figure 13 (Figure c) When sodium citrate was used as the carbon source, the ammonia nitrogen removal efficiency was the highest, decreasing to 2.47 mg / L (removal rate 94.4%) after 6 h. Sodium succinate was the next most efficient, decreasing to 1.01 mg / L (removal rate 97.6%) after 7.5 h, with a slightly longer time to complete removal. When sodium acetate was used as the carbon source, the ammonia nitrogen removal efficiency was extremely low, still as high as 27.92 mg / L after 10.5 h, with a removal rate of only 29.9%.
[0099] (c) The effect of carbon source on nitrate removal Figure 13 (Figure d) When sodium citrate was used as the carbon source, the nitrate removal efficiency was the highest, and it was completely removed after 9 h. The average removal rate was as high as 11.40 mg·L⁻¹ during the period of 4.5–7.5 h. -1 ·h -1 When sodium succinate is used as the carbon source, the removal efficiency is the second lowest, decreasing to 3.46 mg / L after 10.5 h (removal rate of 93.7%), but complete removal requires more than 10.5 h. When sodium acetate is used as the carbon source, the nitrate removal efficiency is extremely low, still as high as 51.46 mg / L after 10.5 h, with a removal rate of only 7.4%.
[0100] The above results indicate that sodium citrate is the most suitable carbon source for this strain, providing ATP and reducing power for nitrogen assimilation rapidly; while sodium acetate may not be effectively utilized or may produce inhibitory intermediates during metabolism.
[0101] Experiment 7. Analysis of the activities of key enzymes in nitrogen metabolism of the strain To investigate the nitrogen metabolism regulation mechanism of *Exopseudomonas hydrolyticus* L7 under different nitrogen source environments, its nitrogen metabolism in HNM (NH4+ only) was measured. + -N), DM-1 (NO3 only) - -N) and HNDM (NH4) + -N + NO3 -The activity of key nitrogen-metabolizing enzymes after 6 h of culture in three culture media (-N).
[0102] Experimental method: The seed culture was prepared according to the method in Experiment 4 of this embodiment and the OD600 was adjusted to 1.0. It was then inoculated at a 2% (volume fraction) inoculation rate into HNM, DM-1, and DM-2 (NO2 only). - The cells were cultured in HNDM and HNDM liquid media at 30°C and 900 rpm for 6 h with shaking. After culture, the cells were collected by centrifugation, washed three times with sterile deionized water, resuspended, and then subjected to the corresponding enzyme activity extraction solution. The cells were then sonicated under ice bath conditions (200 W power, 3 s sonication, 7 s interval, 30 cycles). The cells were centrifuged at 8000 g for 10 min at 4°C, and the supernatant was collected to obtain the crude enzyme solution. The activities of nitrate reductase (NR), nitrite reductase (NIR), glutamine synthase (GS), glutamate dehydrogenase (GDH), and glutamate synthase (GOGAT) were determined using the corresponding activity assay kits.
[0103] The formula for calculating enzyme activity is as follows (based on sample protein concentration): NR (U / mg prot)=5.359×△A÷Cpr; NIR (µmol / h / mg prot) = 1.47 × (A blank tube - A test tube + A control tube - 0.0072) ÷ Cpr; GOGAT (U / mg prot)=321×△A÷Cpr; GDH (U / mg prot)=675×△A÷Cpr; GS(U / mg prot)=19×△A÷Cpr; In the formula: Cpr is the protein content of the sample (mg / mL), and △A is the absorbance difference.
[0104] The results are as follows Figure 14 As shown, all five enzymes were expressed under different nitrogen source conditions, confirming the existence of a complete nitrate reduction pathway (NR / NIR) and ammonia nitrogen assimilation pathway (GS-GOGAT / GDH) in *Pseudomonas hydrolyticus* L7, which relies solely on the assimilation pathway for nitrogen conversion. Among these, the activity of GOGAT showed significant differences among different nitrogen sources: the activity was lowest in HNM, increased in DM-1, and reached its highest level in DM-2, with statistically significant differences among the three sources.
[0105] Experiment 8. Analysis of the dynamic changes in nitrogen speciation and nitrite accumulation characteristics in the culture system. To investigate whether the differences in GOGAT enzyme activity in different culture media were caused by different nitrogen factors in the environment, the differences in nitrogen speciation in different culture media at 0 h and 6 h of culture were analyzed.
[0106] Experimental Methods: The culture was performed according to the method described in Experiment 7 of this embodiment, and samples were taken at 0 h and 6 h. The samples were centrifuged at 4℃ and 10000 rpm for 2 min, and the supernatant was used to determine the NH4 content. + NO3 - and NO2 - Concentration was measured using the same method as in Experiment 4 of Example 1.
[0107] The results are as follows Figure 15 As shown: (a) Comparison of nitrogen concentrations at 0 h and 6 h in different culture media ( Figure 15 (Figures a and b): After culturing *Exopsysporium exolyticus* L7 in different nitrogen sources for 6 h, the nitrogen concentrations showed significant differences. Of particular note is the high NO2 concentration in each group. - The accumulation of NO2 in the HNM group showed a certain positive correlation with GOGAT enzyme activity: - Extremely low content (close to the detection limit), lowest GOGAT enzyme activity; NO2 in DM-1 group - The accumulation was moderate (mean approximately 2.9 μg / mL), and the GOGAT enzyme activity was high; NO2 in the DM-2 group - The initial concentration was high, and it remained at a high level after 6 hours (average value of about 16.7 μg / mL), with high GOGAT enzyme activity.
[0108] (b) Dynamics of nitrite accumulation in DM-1 and HNDM media from 0 to 6 h Figure 15 (Figure c): Two groups of NO2 - The accumulation patterns differed significantly. In the DM-1 group, NO2... - The concentration increased continuously from 0 to 4 hours, reaching a peak at 4 hours (approximately 4.6 μg / mL), and then decreased to approximately 2.9 μg / mL from 4 to 6 hours, exhibiting a typical "increase followed by decrease" characteristic, reflecting the NO3--- - →NO2 - The reduction process and subsequent NO2 - Transformation. HNDM group NO2 - The concentration remained at extremely low levels (<0.2 μg / mL) throughout the first 0-4 hours, then began to accumulate slowly after 4 hours, reaching approximately 1.3 μg / mL at 6 hours. Despite the higher GOGAT enzyme activity and higher NO2 levels in the DM-1 and DM-2 groups... - The corresponding levels suggested a possible positive correlation between the two, but the observations in the HNDM group broke this simple linear relationship—NO2 in this group... -The NO2 accumulation (approximately 1.3 μg / mL) was significantly lower than that of the DM-1 group (approximately 2.9 μg / mL), but its GOGAT enzyme activity was higher. This contradictory phenomenon indicates that the difference in GOGAT enzyme activity is not simply due to NO2. - The content determines the amount and may involve more complex regulatory mechanisms.
[0109] Experiment 9. Expression characteristics analysis of transcriptional level and enzyme activity of the GOGAT-encoding gene To investigate the upstream regulatory mechanism of GOGAT enzyme activity differences, the relative mRNA expression levels of gltB and gltD, encoding genes of the large and small subunits of GOGAT protein, were detected using qRT-PCR under different nitrogen source conditions.
[0110] Experimental Methods: After culturing for 6 h according to the method in Experiment 7 of this embodiment, total bacterial RNA was extracted using the silica gel membrane centrifugation column method (Buffer RL lysis, gDNA filtration column to remove genomic DNA, and HiPure RNA Mini Column purification). Using the extracted RNA as a template, reverse transcription was performed using the PrimeScript™ RT reagent Kit with gDNA Eraser: first, genomic DNA was removed by incubation at 42℃ for 2 min, followed by incubation at 37℃ for 15 min and 85℃ for 5 s to synthesize cDNA. Using the cDNA as a template, qRT-PCR was performed in an Applied Biosystems Real Time PCR system using TB Green Premix Ex Taq II (pre-denaturation: 95℃ for 30 s; 95℃ for 5 s, 60℃ for 30 s, for a total of 40 cycles; melting curve: 95℃ for 15 s, 60℃ for 30 s, 95℃ for 15 s). 16S rRNA was used as an internal control. -ΔΔCt The relative expression levels of gltB and gltD genes were calculated using a method. Primer sequences are as follows: gltB1-F: TCTCTACCGTCGCGTCCTAC, gltB1-R: GCTTCTGCTCGCTTTCGATG; gltB2-F: ATGCCGACCACTACATCTGC, gltB2-R: CCACTTCGGCAGGGTATTGG; gltD1-F: AGTGCCCGGTACACAACTTC, gltD1-R: ACTTCTCCACCGAACCGATG; gltD2-F: TCCGTCTCAACACCGAGATC, gltD2-R: GGCGATCAGGAAGTCCAGTG.
[0111] The results are as follows Figure 16As shown: Compared with the expression level in HNM medium (set as 1.0), the relative expression level of gltB in DM-1 medium was 0.28 ± 0.01, and in HNDM medium it was 0.27 ± 0.01, both significantly lower than in HNM (P<0.001). The expression pattern of gltD gene was basically the same as that of gltB: the relative expression level in DM-1 was 0.26 ± 0.01, and in HNDM it was 0.25 ± 0.01, also significantly lower than in HNM (P<0.001). Comparison of qRT-PCR results with GOGAT enzyme activity data showed that the mRNA expression level of GOGAT was negatively correlated with enzyme activity—the enzyme activity was highest in HNDM, which had the lowest transcription level, while the enzyme activity was lowest in HNM, which had the highest transcription level.
[0112] 10. Preliminary Investigation into the Regulatory Mechanism of GOGAT Activity To investigate the regulatory mechanism of differences in GOGAT enzyme activity in different culture media, in vitro validation experiments and phosphorylation modification intervention experiments were conducted.
[0113] (a) In vitro nitrogen source addition experiment: Bacterial cells cultured in HNM medium were extracted and lysed to obtain crude GOGAT enzyme solution. Ammonium salt, nitrate salt, and a mixture of both were added to the in vitro reaction system, and the changes in GOGAT enzyme activity were measured. Results are as follows: Figure 17 As shown in Figure a, there were no significant differences in GOGAT enzyme activity after adding three nitrogen sources to the crude enzyme solution (P>0.05), and the GOGAT enzyme activity in each treatment group remained at a similar level compared with the control group. This result indicates that the differences in GOGAT enzyme activity observed in different culture media are not caused by the direct activation of the enzyme protein by nitrogen sources, but require the maintenance of an intact cellular environment, suggesting the possible existence of an intracellular signal transduction mechanism.
[0114] (b) Alkaline phosphatase (AKP) treatment experiment: Obtaining alkaline phosphatase (AKP) cultured in HNM medium. Ectopseudomonas hydrolytica The crude GOGAT enzyme solution of L7 bacteria was treated with alkaline phosphatase (AKP), and the changes in GOGAT enzyme activity were measured. The results are as follows: Figure 17 As shown in Figure b, the GOGAT enzyme activity in the control group was approximately 18.30 U / mg prot, while the enzyme activity in the AKP-treated group increased to approximately 22.96 U / mg prot (P<0.05). AKP catalyzes protein dephosphorylation, which promotes the increase in GOGAT enzyme activity, suggesting that dephosphorylation can activate GOGAT.
[0115] (c) Phosphatase inhibitor treatment experiment: Phosphatase inhibitors were added to HNM medium, and GOGAT enzyme activity was measured after 6 h of incubation. Results are as follows: Figure 17As shown in Figure c, the GOGAT enzyme activity in the control group was approximately 23.21 U / mg prot, while the enzyme activity in the inhibitor-treated group increased to approximately 28.30 U / mg prot (P<0.05). Phosphatase inhibitors block the dephosphorylation process, thus also promoting an increase in GOGAT enzyme activity.
[0116] The above results indicate that the regulation of GOGAT activity may involve a complex multi-site phosphorylation network, and protein phosphorylation modification is an important post-translational regulatory mechanism for regulating GOGAT activity. This regulatory mechanism endows the strain with flexible metabolic adaptability: under high ammonium conditions, cells may reduce GOGAT activity through inhibitory phosphorylation modification to conserve energy and carbon backbone, while maintaining a high level of gltB / gltD for mRNA transcription as a strategic reserve; when the environment changes (such as ammonia nitrogen depletion), GOGAT can be rapidly activated through dephosphorylation, achieving rapid switching of metabolic pathways.
[0117] Example 2 This invention provides hydrolyzed exopsys L7 ( Ectopseudomonas hydrolytica Application of L7 in nitrogen resource recovery treatment of nitrogen-containing wastewater.
[0118] The application method includes the following steps: (1) Activation of strains and preparation of seed culture: Hydrolyzed Pseudomonas exogenae L7 was taken from the preserved strain and streaked on LB solid medium plates and cultured at 30℃ for 12-16 h. Single colonies were picked and inoculated into LB liquid medium and cultured at 30℃ and 900 rpm for 12 h to obtain seed culture.
[0119] (2) Standardization of seed liquid: Measure the OD600 value of seed liquid and adjust the concentration of seed liquid to OD600=1.0 using sterile deionized water.
[0120] (3) Inoculation and treatment: The seed liquid with the adjusted concentration is inoculated into the nitrogen-containing wastewater treatment system (which contains ammonia nitrogen and / or nitrate nitrogen) at an inoculation rate of 1% (volume fraction). Aerobic culture treatment is carried out at 30°C. Sodium citrate is used as an external carbon source or auxiliary carbon source in the treatment system to improve the nitrogen assimilation efficiency, so that the ammonia nitrogen and / or nitrate nitrogen in the nitrogen-containing wastewater can be converted into bacterial organic nitrogen through microbial assimilation, so as to achieve nitrogen fixation and recovery.
[0121] The denitrification was verified using a laboratory-simulated nitrogen-containing wastewater system (see Experiments 4-6 in Example 1). It was observed that under the conditions of 30℃ and sodium citrate as the carbon source: A single ammonia nitrogen system (initial concentration approximately 44.46 mg / L): ammonia nitrogen removal rate reached 94.4% within 6 hours. Figure 11 (Figure a) Single nitrate system (initial concentration approximately 57.29 mg / L): nitrate completely removed within 9 hours. Figure 11 (Figure c) Mixed nitrogen source system (containing both ammonia nitrogen and nitrate): Ammonia nitrogen removal rate reached 98.5% after 7.5 hours, and nitrate removal rate reached 99.6%. Figure 11 (Figure b) shows that the strain exhibited the most vigorous growth, with an OD600 of 0.517 at 10.5 h.
[0122] Temperature adaptability data can be found Figure 12 : At 20℃: ammonia nitrogen was completely removed in 12 h, and nitrate was completely removed in 24 h; At 30℃: ammonia nitrogen removal rate was 94.4% after 6 hours, and nitrate was completely removed after 9 hours; At 37℃: nitrates were completely removed in 7.5 h (1.5 h earlier than at 30℃), and the final removal rate of ammonia nitrogen was 86.8%.
[0123] Nitrite accumulation was extremely low throughout the denitrification process: no nitrite accumulation was detected in HNM; the peak nitrite level in DM-1 was only 2.0 mg / L; and the nitrite accumulation in HNDM was far lower than that in DM-1 (see [link to relevant documentation]). Figure 11 ).
[0124] Carbon source adaptability data ( Figure 13 The carbon source utilization efficiency is ranked as follows: sodium citrate > sodium succinate > sodium acetate. Sodium citrate is the optimal carbon source with the highest denitrification efficiency; sodium acetate can hardly support strain growth and denitrification.
[0125] In summary, *Exopseudomonas hydrolyticus* L7 efficiently converts ammonia and nitrate nitrogen from the environment into organic nitrogen within the bacteria through assimilation, achieving biological fixation and resource retention of nitrogen. This differs from traditional HN-AD bacteria, which denitrify by producing gaseous products such as nitrogen gas (N2) or nitrous oxide (N2O) through dissimilation, thus preventing nitrogen loss in gaseous form at the source. Under optimized conditions of 30℃ and sodium citrate as the carbon source, it exhibits extremely high removal efficiency for both single and mixed nitrogen sources. Furthermore, this strain can effectively denitrify within a wide temperature range of 20℃ to 37℃, demonstrating broad environmental adaptability. The accumulation of toxic intermediate products such as nitrite during the entire metabolic process is extremely low, indicating high environmental safety. Isolated from pig manure wastewater, this strain is naturally adapted to high-nitrogen, complex substrate conditions, possessing unique advantages and application potential in the resource utilization of nitrogen from nitrogen-containing wastewater.
[0126] Example 3 This invention provides the application of hydrolyzed Pseudomonas exogenes L7 in the preparation of microbial fertilizers or soil conditioners.
[0127] The application method includes the following steps: (1) Activation of strains and preparation of seed liquid: Same as step (1) in Example 2.
[0128] (2) Large-scale fermentation culture: The seed culture is inoculated into a fermenter and fermented on a large scale using LB liquid medium or nutrient broth medium. The culture conditions are 30℃, aerated and stirred for 12-24 h, until the OD600 value of the bacterial culture reaches the plateau phase and the viable count is ≥1×10⁻⁶. 8 CFU / mL.
[0129] (3) Preparation of microbial agent: After fermentation, the fermentation broth is mixed with the sterilized carrier in an appropriate ratio for adsorption, so that the number of viable bacteria is ≥1×10⁻⁶. 8 CFU / g, after low-temperature drying and packaging, yields a powdered microbial fertilizer or soil conditioner. The sterilization carrier is peat moss, vermiculite, biochar, or a mixture thereof. Alternatively, an appropriate amount of preservative (such as glycerol or trehalose) can be added to the fermentation broth before direct bottling to obtain a liquid microbial agent product.
[0130] (4) Application: The product can be applied to the plant rhizosphere soil environment during the sowing or growth period of the crop by means of root dipping, seed mixing, root irrigation or water flushing.
[0131] Basic performance data of the strain (see Example 1 for details): (a) Denitrification performance: At 30℃ and with sodium citrate as the carbon source, ammonia nitrogen removal rate was 94.4% after 6 hours, and nitrate was completely removed after 9 hours. Figure 11 Nitrogen conversion can still be completed at 20℃. Figure 12 The carbon source utilization efficiency is ranked as follows: sodium citrate > sodium succinate > sodium acetate. Figure 13 ).
[0132] (b) Growth-promoting properties: at 1×10 8 Treatment of Arabidopsis thaliana with CFU / mL bacterial suspension resulted in a seed germination rate of 85.2%, which was not significantly different from the control group. Figure 9 (Figures a and b); the fresh weight of the seedlings was significantly increased by 20.9% compared with the control group (P<0.05). Figure 9 (Figures c and d); chlorophyll content showed no significant difference from the control group (P>0.05) Figure 9 (e-graph).
[0133] (c) Activities of key nitrogen metabolism enzymes: After culturing for 6 h in three media (HNM, DM-1, and HNDM), five enzymes—nitrate reductase (NR), nitrite reductase (NIR), glutamine synthase (GS), glutamate dehydrogenase (GDH), and glutamate synthase (GOGAT)—were all expressed with activity. Figure 14This confirms that the strain possesses complete nitrate reduction and ammonia nitrogen assimilation pathways. The strain relies solely on the assimilation pathway to complete nitrogen transformation, converting inorganic nitrogen into organic nitrogen within the bacterial cell.
[0134] In summary, microbial fertilizers or soil conditioners prepared from *Pseudomonas hydrolyticus* L7, when applied to the rhizosphere, can convert inorganic nitrogen (ammonia nitrogen, nitrate nitrogen) in the rhizosphere environment into organic nitrogen (amino acids, proteins, etc.) through the strain's highly efficient nitrogen assimilation capacity. These nitrogen-containing organic compounds can be directly absorbed and utilized by plants after the bacteria die and lyse, improving plant nitrogen nutrition and thus promoting plant growth. Simultaneously, the nitrogen metabolism process of this strain is stable, with extremely low accumulation of toxic intermediate products such as nitrite, effectively avoiding potential toxic risks to plant roots. The strain can still complete nitrogen conversion at 20℃, exhibiting good low-temperature adaptability, making it suitable for application in early spring, late autumn, and other low-temperature seasons, as well as in northern regions. The microbial fertilizers or soil conditioners prepared in this embodiment possess multiple functions, including nitrogen resource fixation, plant growth promotion, and broad environmental adaptability, showing promising application prospects.
[0135] Example 4 This invention provides the application of hydrolyzed exopseudomonas L7 in promoting plant growth.
[0136] The application method includes the following steps: (1) Preparation of bacterial suspension: *Pseudomonas hydrolyticus* L7 was taken from the preserved strain and streaked onto LB agar plates, incubated at 30°C for 12–16 h. Single colonies were picked and inoculated into LB liquid medium, incubated at 30°C and 900 rpm for 12 h to obtain the seed culture. The seed culture was washed three times with sterile deionized water and resuspended, and the bacterial concentration was adjusted to not less than 1 × 10⁻⁶. 8 The bacterial suspension is obtained by measuring CFU / mL.
[0137] (2) Application: Apply the bacterial suspension to plant seeds, seedlings, roots or rhizosphere soil. Application methods may include seed soaking, seedling root irrigation or direct watering of the rhizosphere soil.
[0138] Verification of the effect of promoting fruit production using Arabidopsis thaliana as a model plant: (a) Seed germination test: Wild-type Arabidopsis thaliana seeds were disinfected with 75% ethanol for 8 min, washed 3-4 times with sterile deionized water, and then germinated with 1×10⁻⁶ seeds. 8 Seeds were soaked in CFU / mL bacterial suspension for 5 min (the control group was treated simultaneously with sterile deionized water) and then sown on 1 / 2 MS solid medium plates. The culture conditions were 25℃, 5500 lx light intensity, and a photoperiod of 18 h light / 6 h dark. Seed germination rate was calculated after 8 days of culture. Results are as follows: Figure 9As shown in Figure ab, the seed germination rate of the *Pseudomonas hydrolyticus* L7 treatment group was not significantly different from that of the control group (P>0.05). The radicle and cotyledons developed normally, and no malformation, yellowing, or growth retardation were observed. The seed germination rate of the treatment group reached 85.2%.
[0139] (b) Seedling growth experiment: Arabidopsis thaliana seedlings with two leaves and one bud and similar growth were selected and transplanted into sterile nutrient soil (vermiculite: nutrient soil = 1:1), with 5 seedlings per pot. After 7 days of acclimatization culture, freshly prepared overnight culture solution was evenly poured into the rhizosphere soil at a rate of 1.2 mL per pot (the control group was watered with an equal volume of sterile deionized water). After 12 more days of culture, the fresh weight of the plants and the chlorophyll content of the leaves were measured.
[0140] The results are as follows Figure 9 As shown in the CD plot: the average fresh weight of the control group was 0.061±0.012 g / plant; the fresh weight of the *Pseudomonas hydrolyticus* L7 treatment group was the highest, reaching 0.074±0.015 g / plant, which was significantly higher than that of the control group by 20.9% (P<0.05). Plant morphology showed that the plants in the *Pseudomonas hydrolyticus* L7 treatment group had more abundant rosette leaves and larger leaf area, consistent with the fresh weight measurement results.
[0141] The results of chlorophyll content determination are as follows: Figure 9 As shown in Figure e: the total chlorophyll content of the leaves in the control group was 1.78±0.25 mg / g; the total chlorophyll content of the L7 hydrolyzed Pseudomonas aeruginosa treatment group was 1.82±0.18 mg / g, which was not significantly different from the control group (P>0.05). No stress characteristics such as decreased chlorophyll or inhibited photosynthesis were observed.
[0142] In summary, the application of *Pseudomonas exogenae* L7 suspension to plants did not inhibit seed germination, achieving a germination rate of 85.2%; it significantly increased plant fresh weight by 20.9% compared to the control group; and it did not interfere with chlorophyll synthesis or photosynthetic metabolism, making it safe and harmless to the plant's photosynthetic system. The growth-promoting effect of this strain is mainly reflected in promoting nutrient accumulation and vegetative growth, achieving a significant increase in biomass without causing physiological stress to the plant. Combined with the strain's highly efficient nitrogen assimilation capacity (see Example 1), its growth-promoting effect may be related to the following mechanism: the strain converts inorganic nitrogen in the rhizosphere into organic nitrogen (amino acids, proteins, etc.) through its efficient nitrogen assimilation capacity. These nitrogen-containing organic compounds can be directly absorbed and utilized by the plant after bacterial death and lysis, improving plant nitrogen nutrition and thus promoting growth. Furthermore, the accumulation of toxic intermediate products such as nitrite during the entire metabolic process is extremely low, effectively avoiding potential toxic risks to plant roots and demonstrating high biosafety.
Claims
1. A strain of hydrolyzed exopsips, characterized in that, It was named *Exopseudomonas hydrolyticus* L7 ( Ectopseudomonas hydrolytica L7), with accession number CGMCC No. 39516 from the China General Microbiological Culture Collection Center, was deposited on June 29, 2026.
2. The application of *Exopseudomonas hydrolyticus* according to claim 1 in the nitrogen resource recovery treatment of nitrogen-containing wastewater, characterized in that, The method for nitrogen resource recovery treatment of nitrogen-containing wastewater includes the following steps: inoculating the hydrolyzing Pseudomonas aeruginosa into the nitrogen-containing wastewater, so that the inorganic nitrogen in the nitrogen-containing wastewater is converted into organic nitrogen in the bacterial cells through microbial assimilation, thereby achieving nitrogen fixation and recovery.
3. The application of *Exopseudomonas hydrolyticus* according to claim 2 in the nitrogen resource recovery treatment of nitrogen-containing wastewater, characterized in that, The assimilation pathway is the glutamine synthase-glutamate synthase pathway and / or the glutamate dehydrogenase pathway, and the inorganic nitrogen is one or more of ammonia nitrogen, nitrate nitrogen and nitrite nitrogen.
4. The application of *Exopseudomonas hydrolyticus* according to claim 2 in the nitrogen resource recovery treatment of nitrogen-containing wastewater, characterized in that, The ambient temperature for nitrogen resource recovery treatment of the nitrogen-containing wastewater is 20℃~37℃.
5. The application of *Exopseudomonas hydrolyticus* according to claim 2 in the nitrogen resource recovery treatment of nitrogen-containing wastewater, characterized in that, The method for nitrogen resource recovery treatment of nitrogen-containing wastewater also includes adding sodium citrate as a carbon source.
6. The application of the hydrolyzable Pseudomonas exogenae according to claim 1 in the preparation of microbial fertilizers or soil conditioners.
7. The application of the hydrolyzable *Exopseudomonas aeruginosa* according to claim 6 in the preparation of microbial fertilizers or soil conditioners, characterized in that, The microbial fertilizer or soil conditioner is a preparation containing the hydrolyzed *Pseudomonas exogenae* L7 suspension, wherein the concentration of the hydrolyzed *Pseudomonas exogenae* L7 suspension is not less than 1 × 10⁻⁶. 8 CFU / mL.
8. The application of the hydrolyzable exopseudomonas aeruginosa according to claim 1 in promoting plant growth.
9. The application of the hydrolyzed exopseudomonas aeruginosa in promoting plant growth according to claim 8, characterized in that, The method for promoting plant growth includes the following steps: applying a bacterial suspension containing the hydrolyzed *Pseudomonas exogenae* to plant seeds, seedlings, roots, or rhizosphere soil, wherein the concentration of the bacterial suspension is not less than 1 × 10⁻⁶. 8 CFU / mL.
10. The application of the hydrolyzed *Exopseudomonas* according to claim 9 in promoting plant growth, characterized in that, The plant in question is Arabidopsis thaliana.