A dasr gene deletion streptomyces antibioticus strain, and a preparation method and application thereof

Abstract

The application relates to a kind of dasR Genetically deficient streptomyces sp. Strain, its preparation method and application, and dasR The genetically deficient streptomyces sp. Strain is obtained by using double exchange homologous recombination gene knockout technology to knock out the transcriptional regulator of GntR / HutC family in streptomyces sp. dasR And the mutant strain. Experiments prove that, compared with the wild type strain, dasR The genetically deficient streptomyces sp. Strain produces more spiramycin, which shows that the gene is a negative regulator of spiramycin biosynthesis, and dasR Knockout influences carbon-nitrogen metabolism, transcriptional regulation and oxidative stress response.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to a... right Gene-deleted Streptomyces strains, their preparation methods, and applications. Background Technology

[0002] Spiramycin is produced by Streptomyces bisporus (Synthia spp.) Streptomyces ambofaciens Spiramycin is a sixteen-membered macrolide antibiotic produced by polyketide synthesized by type I polyketide synthase. It comprises a polyketide linked to two amino sugars (floxacin and carbamoglycosaminoglycans) and one neutral sugar (carbamoglycosaminoglycans). This structure endows spiramycin with unique pharmacological properties. Since its discovery, spiramycin has been widely used to treat toxoplasmosis infections and exhibits high sensitivity to some Gram-positive and Gram-negative bacteria, demonstrating bactericidal activity. Furthermore, spiramycin is stable and has a long-lasting post-antibiotic effect, with significantly fewer side effects than other drugs. Currently, spiramycin remains widely used in some clinical treatments and has good potential for widespread application and research.

[0003] However, spiramycin, as a secondary metabolite of Streptomyces, undergoes biosynthesis under strict multi-level regulation by transcriptional regulators, which exhibit complex cross-interactions. Transcriptional regulators are generally classified into pathway-specific regulators and global regulators. Pathway-specific regulators typically encode genes located within the same operon or its regulated biosynthetic gene cluster, such as in Streptomyces spiramycin. srm22 and srm40 In contrast, global regulatory factors directly or indirectly control several responses within bacterial cells. Extensive research has been conducted on transcriptional regulatory factors, accelerating the development of genetic tools and the design of high-yielding strains. However, functional studies and applications of transcriptional regulatory factors remain limited to model strains, and the regulatory mechanisms of some factors are still unresolved. Currently, the regulatory mechanisms of spiramycin biosynthesis in Streptomyces are poorly understood, hindering the rational design of high-yielding strains through genetic modification.

[0004] Patent CN114908015A discloses a high-yielding spiramycin strain and its screening method. The method for screening high-yielding spiramycin strains via plate culture includes: serially diluting a spore suspension or mycelial culture of *Streptomyces spiramycin* and spreading it onto a plate containing N-acetylglucosamine for isothermal incubation to obtain single colonies. Morphological screening is then performed on the obtained colonies, selecting those with well-developed aerial hyphae capable of sporulation for fermentation culture to obtain high-yielding spiramycin strains. While this method is simple and low-cost, it relies solely on phenotypic screening to obtain randomly mutant strains and does not involve targeted gene modification based on the spiramycin biosynthesis regulatory mechanism. This results in problems such as weak strain modification purpose, unclear genetic background, and unclear high-yield mechanism.

[0005] Patent CN111349595A discloses a spiramycin-producing bacterium, a cyclophosphamide-producing bacterium, their construction method, applications, and a method for increasing product yield. This method involves using the genome of either a spiramycin-producing or cyclophosphamide-producing bacterium as a template, designing primers at suitable sites based on the principle of complete or partial knockout of the Lrp gene, PCR amplifying the left and right arm gene fragments, cloning them into a knockout vector, constructing a recombinant vector, and introducing it into the spiramycin-producing bacterium and / or cyclophosphamide-producing bacterium. Recombinant bacteria with inactivated Lrp gene are obtained through resistance and passage selection. However, this method only increases the total spiramycin yield by approximately 5.2%, a very limited increase.

[0006] Therefore, developing a strain that produces high levels of spiramycin is of great significance. Summary of the Invention

[0007] The purpose of this invention is to overcome the problems in the prior art, such as the unclear regulatory mechanism of spiramycin biosynthesis and the difficulty in obtaining high-yielding spiramycin strains through genetic modification, and to provide a... right Gene-deleted Streptomyces strains, their preparation methods, and applications.

[0008] In a first aspect, the present invention provides right A gene-deleted Streptomyces strain, right Gene-deleted Streptomyces strains are created by knocking out transcriptional regulators of the GntR / HutC family in Streptomyces. right The obtained mutant strain, the right The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0009] Secondly, the present invention provides right A method for preparing a gene-deleted Streptomyces dignitaria strain includes the following steps: S1: Using the *Streptomyces bisporus* genome as a template, PCR amplification was performed using upstream and downstream homologous arm amplification primer pairs to obtain the target... right Upstream and downstream homologous arm segments of a gene; S2: Will target right By connecting the upstream and downstream homologous arms of a gene, a pre-knockout gene can be obtained. right Homologous arm sequences; S3: Insert the pre-knockout gene at the multiple cloning site of the temperature-sensitive plasmid. right The homologous arm sequences were obtained. right pD with gene deletion right plasmids; S4: Preparation of Streptomyces bifidum mycelium: The seed culture of Streptomyces bifidum was cultured, centrifuged, washed, and resuspended to obtain Streptomyces bifidum mycelium; S5: Will right pD with gene deletion right The plasmid was introduced into the mycelium of Streptomyces bifidus via conjugation transfer. S6: Successful single-exchange conjugates were selected, then continuously passaged, diluted, and plated onto antibiotic-free plates for further culture. Validation was performed using colony PCR. right Gene-deleted Streptomyces strain.

[0010] In one embodiment of the present invention, the upstream homologous arm amplification primer pair in step S1 is pKC- right -up-F / pKC- right -up-R; The downstream homologous arm amplification primer pair is pKC- right -down-F / pKC- right -down-R; pKC- right The nucleotide sequence of -up-F is shown in SEQ ID NO.2; pKC- right The nucleotide sequence of -up-R is shown in SEQ ID NO.3; The pKC- right The nucleotide sequence of -down-F is shown in SEQ ID NO.4; The pKC- right The nucleotide sequence of -down-R is shown in SEQ ID NO.5.

[0011] In one embodiment of the present invention, the temperature-sensitive plasmid in step S3 is pKC1139, and it is linked to the homologous arm through its HindIII and XbaI restriction sites.

[0012] In one embodiment of the invention, the conjugation transfer in step S5 is mediated by Escherichia coli donor strain ET12567 containing helper plasmid pUZ8002.

[0013] In one embodiment of the present invention, the screening in step S5 employs temperature and resistance pressure screening.

[0014] In one embodiment of the present invention, the temperature for continuous subculturing in step S6 is 26-30°C, and the number of subculturing cycles is 3-5. Preferably, the subculturing temperature is 28°C, and the number of subculturing cycles is 3.

[0015] Thirdly, the present invention provides right Application of genes in the preparation of streptavidin-producing Streptomyces.

[0016] Fourthly, the present invention provides right Application of gene-deleted Streptomyces strains in the fermentation production of spiramycin.

[0017] Fifthly, the present invention provides a method for producing spiramycin by fermentation, comprising: culturing... right Gene-deleted Streptomyces strains were obtained, and spiramycin was collected or extracted from the cultures.

[0018] In one embodiment of the present invention, the cultivation is: right The gene-deleted Streptomyces knockout strain was inoculated onto Streptomyces solid plate medium and cultured, then inoculated into seed culture medium and cultured; the cultured seed liquid was then inoculated into fermentation medium and fermented.

[0019] Experiments of this invention demonstrate that the gene knockout technology constructed using double-crossover homologous recombination is effective. right Gene knockout strains were examined for their relationship with secondary metabolites. The results showed that, compared with wild-type strains... right The gene knockout strain produced more spiramycin, indicating that this gene is a negative regulator of spiramycin biosynthesis. right Knockout affects carbon and nitrogen metabolism, lipid metabolism, transcriptional regulation, and oxidative stress response.

[0020] Compared with the prior art, the present invention has the following beneficial effects: This invention utilizes double-crossover homologous recombination gene knockout technology to knock out transcriptional regulators of the GntR / HutC family in Streptomyces bisporus. right And what was obtained right Gene-deleted Streptomyces strains, compared to wild-type strains rightThe spiramycin production of the gene-deleted Streptomyces strain was 33.5% higher than that of the wild-type strain, indicating that this... right Genes are negative regulators of spiramycin biosynthesis.

[0021] Furthermore, transcriptomic analysis showed that, right Knockout affects carbon and nitrogen metabolism (e.g.) right Among the knockout strains pgi , pdhA down and no , nagB、glnII , gltB Upregulation of lipid metabolism (e.g., upregulation of acs), transcriptional regulation (e.g., upregulation of acs), and other related functions. right Among the knockout strains what? Downregulation) and oxidative stress responses (e.g. right Among the knockout strains sigR (The downward adjustment). Attached Figure Description

[0022] Figure 1 for right A schematic diagram of gene knockout bacteria construction technology.

[0023] Figure 2 PCR results for the knockout strain.

[0024] Figure 3 This is a sequencing verification diagram.

[0025] Figure 4 for right The results of spiramycin content detection on day 6 of fermentation of knockout strain and wild-type strain WT.

[0026] Figure 5 for right Comparison of the fermentation process of knockout strain and wild-type strain WT.

[0027] Figure 6A In order to be in right The expression patterns of 1172 genes over time in the RNA-Seq time-series datasets of knockout strains and wild-type strain WT.

[0028] Figure 6B In order to be in right Median eigenline profiles of each cluster in maSigPro analysis of RNA-Seq time-series datasets of knockout strains and wild-type strain WT.

[0029] Figure 7 for right A comprehensive map of differentially expressed genes related to spiramycin biosynthesis in knockout strains. Detailed Implementation

[0030] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments. These embodiments are based on the technical solution of the present invention and provide detailed implementation methods and specific operating procedures. However, the scope of protection of the present invention is not limited to the following embodiments.

[0031] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. The materials, reagents, culture media, and instruments used are all conventional materials, reagents, culture media, and instruments in the art, and can be obtained commercially by those skilled in the art. Unless otherwise specified, the molecular biology experimental operations involved in this invention, such as PCR amplification, enzyme digestion and ligation, and transformation, are all conventional experimental operations in the art or can be performed according to the product instructions of the corresponding reagents.

[0032] The dasR nucleotide sequence of this invention is shown in SEQ ID NO.1, with a length of 765 bp, and is derived from Streptomyces disacchariformis (Streptomyces dasacchariformis). Streptomyces ambofaciens ) SEQ ID NO.1: atgagcaccgacgtcagcagtgcggagaacgagggtggggcgaccgtccgtaccgcgcgcgtgcccaagtactaccgactgaagaagcacc tgctcgacatgacccggacgcaggcaccgggcactccggtcccccctgagcgcaccctggccgcggagttcgacacctcgcgcacgacggtgcgcc aggccttgcaggaactggtcgtcgaggggcgcctggagcgcatccagggcaagggcaccttcgtcgccaagcccaaggtctcgcaggccctgcaac tcacctcgtacaccgaggacatgcgggcgcagggcctcgaacccacctcgcagctgctggacatcggctacatcaccgccgacgaccggctcgccg ggctgctggacatcacggccggcgggcgggtactgcgcatcgagcggctgcgcatggccaacggcgagcccatggcgatcgagaccacccacctgt cggccaagcgcttcccggcgctgcgcaggtccctggtgaagtacacgtccctctacacggcgctcgccgaggtctacgacgtccatctcgccgagg ccgaggagaccatcgagacctcgctggccaccccgcgcgaggccggtctgctcggcaccgacgtcggcctgcccatgctgatgctctcccggcact cgcaggaccgcacgggccagcccgtggagtgggtgcgctcggtgtaccggggcgaccgctacaagttcgtggcccggctgaagcggccccaggacta The culture medium used in this invention and its composition are as follows: LB medium: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, pH 7.0.

[0033] TSB medium: 17 g / L tryptone, 3 g / L soybean peptone, 5 g / L sodium chloride, 1.95 g / L potassium dihydrogen phosphate, 2.5 g / L glucose, pH 7.0.

[0034] IWL-4 medium: soluble starch 10 g / L, dipotassium hydrogen phosphate 1 g / L, magnesium sulfate heptahydrate 1 g / L, sodium chloride 1 g / L, ammonium sulfate 2 g / L, calcium carbonate 2 g / L, ferrous sulfate heptahydrate 0.001 g / L, manganese dichloride hexahydrate 0.001 g / L, zinc sulfate 0.001 g / L, yeast extract 0.5 g / L, peptone 1 g / L, agar powder 20 g / L, pH 7.2.

[0035] Streptomyces bifidum solid plate culture medium: 45 g / L soybean meal powder, 30 g / L glucose, 1 g / L magnesium sulfate heptahydrate, 20 g / L agar powder, pH 6.7.

[0036] Seed culture medium: dextrin 50 g / L, soybean meal 10 g / L, corn steep liquor 15 g / L, calcium carbonate 5 g / L, pH 6.7.

[0037] Fermentation medium: dextrin 55 g / L, yeast powder 2 g / L, corn steep liquor 18 g / L, soybean oil 20 g / L, potassium dihydrogen phosphate 4 g / L, sodium chloride 3 g / L, potassium chloride 3 g / L, glucose 12 g / L, ammonium sulfate 2 g / L, zinc sulfate 1 g / L, magnesium sulfate 1 g / L, cobalt chloride 0.3 g / L, calcium carbonate 15 g / L, pH 6.7.

[0038] The strain information involved in the following examples is shown in Table 1; the plasmid information involved is shown in Table 2; and the primer information involved is shown in Table 3.

[0039] Table 1. Information on the strains involved in the examples. Table 2. Plasmid information involved in the examples Table 3 Primer sequence information involved in the examples Example 1: right Gene-deleted Streptomyces strain D right Construction Gene knockout technology using double crossover homologous recombination was constructed right The construction of a gene-deleted Streptomyces strain is as follows: Figure 1 As shown: 1.1 right Gene knockout plasmid pD right Construction Using the Streptomyces bisporus genome as a template, PCR was performed to amplify... right Upstream and downstream homologous arms. Using primer pKC- right -up-F / pKC- right -up-R and pKC- right -down-F / pKC- right -down-R amplifies the 1146bp upstream homologous arm and the 1211bp downstream homologous arm, respectively. Both fragments are amplified using primers pKC- right -up-F and pKC- right -down-R PCR ligation via overlap extension. Upstream and downstream homologous arms were ligated to HindIII / XbaI-digested pKC1139 and transformed into DH5α. Positive recombinants were screened using primers YZ-pKC-F / YZ-pKC-R to obtain plasmid pD. right .

[0040] 1.2 Joining and Transfer Steps 1) Inoculate the preserved glycerol tube (containing Streptomyces bisaccharidus with preservation number CCTCC No.AA 2017001) into seed culture medium and culture at 220 rpm and 26°C for 48 h. Take 1 mL of the cultured Streptomyces bisaccharidus seed culture and inoculate it into 30 mL of TSB liquid culture medium and culture at 220 rpm and 26°C for 6-8 h.

[0041] 2) Put pD right The plasmid was transformed into ET12567 / pUZ8002, and 1 mL of the bacterial culture that had been incubated overnight at 220 rpm and 30°C was inoculated into 50 mL of LB medium. Apr, Km, and Cm antibiotics were added (final concentrations of Apr, Km, and Cm antibiotics were 100 μg / mL, 50 μg / mL, and 25 μg / mL, respectively), and the medium was incubated at 220 rpm and 30°C until OD500. 600 It is 0.4-0.6.

[0042] 3) Pour the bacterial cultures prepared in steps (1) and (2) into 50 mL centrifuge tubes respectively. Centrifuge Streptomyces at 8000 rpm for 2 minutes at 4℃ to collect mycelia. Centrifuge Escherichia coli at 4000 rpm for 10 minutes at 4℃ to collect cells. Wash the collected cells 2-3 times with the same volume of LB liquid medium. After washing, resuspend the collected cells in 1 mL of LB liquid medium.

[0043] 4) Mix the donor bacteria (Escherichia coli) and recipient bacteria (Streptomyces bifidum) evenly at a volume ratio of 1:1, 1:2 and 1:3, spread them on IWL-4 plates, and incubate them overnight in an incubator at 28°C.

[0044] 5) After culturing for 12-16 hours, remove the plate and spread 1 mL of covering solution evenly on the conjugation transfer plate (IWL-4 plate). The covering solution contains 20 µg / mL Apr and 40 µg / mL NA.

[0045] 6) After incubating at 28°C for 7-10 days, once colonies have grown on the plates, the subsequent screening process can begin.

[0046] 1.3 Screening and Validation of Mutants 1) Transfer the colonies on the conjugation transfer plate to IWL-4 plates containing NA and Apr resistance (final antibiotic concentration of 40 μg / mL), incubate at 28°C for 7 days, and then perform colony PCR to screen for conjugates.

[0047] 2) Re-stripe the positive conjugate onto an IWL-4 plate containing 40 μg / mLApr resistance, incubate at 28°C for 1 day until visible colonies appear, then incubate at 37°C for another 4-6 days. Strains that grow normally are considered successful single-crossover strains.

[0048] 3) Select the successfully exchanged strains and inoculate them into antibiotic-free TSB liquid medium for three passages, followed by relaxation culture at 28°C for 3-5 days.

[0049] 4) After cultivation, dilute and spread onto Streptomyces bifidum solid plate medium.

[0050] 5) After culturing at 28°C for 7-10 days, use primer YZ-D right -F / YZ-D right -R is used for colony PCR verification ( Figure 2 ) and sequencing ( Figure 3 ),get right Gene-deleted Streptomyces strain D right That is, knockout strain D right .

[0051] Example 2: right Gene-deleted Streptomyces knockout strain D right Application in the fermentation production of spiramycin 1) The above right Gene-deleted Streptomyces knockout strain D right Inoculate onto Streptomyces bifidum solid agar plates and incubate at 28°C for 7-10 days. Then, use a sterile cell scraper to collect 1-2 cm of the culture medium. 2Fresh mycelial growth was inoculated into 250 mL Erlenmeyer flasks containing 30 mL of seed culture medium and cultured at 26°C and 220 rpm for 48 h. The resulting seed culture was then inoculated into fermentation medium at a 6% inoculation rate. The fermentation medium was placed in 250 mL Erlenmeyer flasks, with each flask containing 25 mL of the medium, and fermented at 26°C and 220 rpm for 6 days.

[0052] 2) After fermentation, the bacterial culture was centrifuged, and the supernatant was analyzed by high-performance liquid chromatography (HPLC). Detection conditions: Column: C8 (ZORBAX SB-C8, 4.6×250mm, 5μm, Agilent Technologies), mobile phase: 9.3g / L sodium perchlorate phosphate buffer at pH 2.2: acetonitrile = 7:3, column temperature: 30℃, detection UV wavelength: 232 nm, flow rate: 1 mL / min, injection volume: 20 µL.

[0053] HPLC detection results are as follows Figure 4 As shown in the figure, the knockout strain D... right The spiramycin production of this strain was significantly higher than that of the wild-type strain WT, indicating that... right The gene negatively regulates spiramycin synthesis. Knockout strain D right The production of spiramycin from wild-type strain WT was monitored process-wise by HPLC, and the results are as follows: Figure 5 As shown, compared to the wild type, the initial yields of both are similar, but D right The final yield (9.77 mg / mL) was 33.5% higher than the WT yield (7.32 mg / mL), and D right It maintained highly efficient and stable synthesis of spiramycin throughout the later stages of fermentation. (Gene) right Knockout can be used to increase the yield of spiramycin produced by Streptomyces bifidum fermentation, which has positive significance for reducing product prices and industrial costs.

[0054] Example 3: right Gene-deleted Streptomyces knockout strain D right Transcriptomic analysis of wild-type strain WT right Gene-deleted Streptomyces knockout strain D right There are significant differences between strain D and wild-type WT in spiramycin production; therefore, transcriptomic analysis (RNA-seq) was used to study strain D by comparing transcriptomic data. right The reasons for high spiramycin production, and an explanation. right The mechanism by which genes regulate bacterial secondary metabolism.

[0055] 3.1 Sequencing data quality control For knockout strain D right RNA-seq analysis was performed on the wild-type strain WT at 24h, 48h, 96h, and 144h, and the data were statistically analyzed. The cleanliness rate of the raw data after filtering was over 98%. The proportion of Q20 was over 98%, and the proportion of Q30 was over 93%, indicating that the sequencing data was of high quality and the sequencing results were qualified for further analysis.

[0056] 3.2 Statistical analysis of differentially expressed genes DEseq2 was used to knock out strain D right Differential expression levels of the wild-type strain WT were analyzed at 24h, 48h, 96h, and 144h. The screening criteria were set as follows: qValue < 0.05 and fold change |FoldChange| ≥ 2. Genes that met the screening criteria were considered to be significantly differentially expressed genes. The results of differentially expressed genes are shown in Table 4 below.

[0057] Table 4. Statistical analysis of differentially expressed genes 3.3 Knockout strain D right Time-sequential transcriptomic analysis of wild-type strain WT Temporal transcriptomics can reconstruct the dynamic process of gene expression, reveal the temporal regulatory logic, and identify key genes and key nodes. MaSigPro software was used, with a significance level of α=0.05 and a coefficient of determination rsq=0.7 to screen variables.

[0058] Temporal process analysis identified 1172 genes with significantly different transcriptional profiles at different time points and between the two strains; these genes were divided into 9 clusters based on their gene expression profiles, exhibiting different temporal gene expression patterns. The results are shown in [Figure number missing]. Figure 6A B. Compared to WT, D in cluster 4 right Gene expression showed higher levels at all four time points, and in cluster 9, D right The expression peak at 48 h was significantly reduced, while the expression level was higher at 144 h. Conversely, in clusters 1, 2, 3, 5, 6, 7, and 8, D... right The gene expression levels of most of them are lower than those of WT.

[0059] Cluster 4 in right Gene expression levels in mutant strains were higher than in wild-type strains, and intracluster genes were involved in the transport and metabolism of GlcNAc. no , no , nagK , ngcE , ptsH ), nitrogen metabolism ( glnII , gltB lipid metabolism () acs) and pathway-specific regulatory genes srm22 and srm40 .Gene no and no These genes encode N-acetylglucosamine-6-phosphate deacetylase and glucosamine-6-phosphate deaminase, respectively, which convert N-acetylglucosamine-6-phosphate to fructose-6-phosphate for glycolysis. These two genes are directly regulated by dasR in *Streptomyces azureense*. no , no , glnII and gltB The upward adjustment ensures the supply of carbon and nitrogen sources, which in turn enables the synthesis of acetyl-CoA synthase ( acs It catalyzes the production of acetyl-CoA from acetic acid, while srm22 and srm40 Upregulation directly promotes spiramycin production. Cluster 9 contains most of the structural genes involved in spiramycin biosynthesis, and these genes were upregulated after 96 hours. Spiramycin biosynthesis consists of three core stages: polyketide chain synthesis and macrocyclic lactone ring formation, deoxyhexose biosynthesis, and post-modification with glycosylation and acylation. Therefore, based on 144-hour transcriptome sequencing results, a comprehensive map of differentially expressed genes (DEGs) related to spiramycin biosynthesis was constructed, such as... Figure 7 As shown in the diagram. The green area represents the formation of macrocyclic lactone rings, the blue area represents the biosynthesis of deoxyhexoses, and the orange area represents post-modification and glycosylation. (Gene) right After knockout, almost all genes related to the three core pathways were upregulated, indicating that... right It has a certain regulatory relationship with secondary metabolism and is beneficial to increasing the production of spiramycin.

[0060] Compared to the wild-type strain, genes expressed at lower levels in the DdasR strain are involved in central carbon metabolism, energy metabolism, and transformation processes. Central carbon metabolism includes the pathway encoding pentose phosphate (PtS) zwf , pgl , yes , tall , tkt Cluster 7), glycolysis ( pgi , pgm Cluster 6 or 7) and the tricarboxylic acid cycle ( pdhA , lpd , acnA , sdhA , sdhC , sdhD , sucB Genes of clusters 1, 6, or 7. Respiratory chain-related protein—cytochrome c biosynthetic protein ResB (… resB Cluster 6), nicotinamide nucleotide adenylate transferase ( no Cluster 6) and coenzyme fatty acid synthase ( lip Cluster 5) in right Expression levels were also significantly reduced in the knockout strains. Furthermore, it is involved in DNA replication (… DNA , gyrA , top , polA Cluster 1, cluster 5 or cluster 8), cell division ( ftsQ , ftsX Cluster 1 or cluster 6) and cell wall synthesis ( if not , if , if , Mr. , glmS , glmU Genes of clusters 1, 5, 6, or 7 are in right Expression was downregulated in the knockout strains. It is involved in amino acid interactions (including...). aroA , aroB , aroC , aroQ , trpA , trpB , hisB , hisH , hisF , dapA , dapB , leuc , read , test , proC , thrC , cysD ) and nucleotides ( pyrrh , yourX , no , pyre , purD , purM , up Biosynthesis in right The knockout strains showed lower gene expression (these genes were enriched in clusters 1, 2, 5, 6 or 7).

[0061] From the fermentation sequence, clusters 1, 2, 3, 5, 6, 7, and 8 showed comparable gene expression levels during the 24-hour growth phase of Streptomyces, indicating that... right The initial growth of the knockout strains may not have been affected. These data suggest that DasR weakens cell growth and division during the glycogen production phase, thereby reducing... right Oxidative metabolism in knockout strains. Oxidative metabolism leads to oxidative stress, and it was noted that many genes involved in oxidative stress include... sigJ , sigR , sigE , sigma And many genes involved in DNA recombination and repair, such as recF , record , recD2 , recN , radA , uvrB , UVR , nothing Downregulation. As a core σ factor regulating oxidative stress and protein repair, the transcriptional downregulation of SigR may reduce stress-related energy consumption in bacteria, decrease the diversion of carbon flux and reducing power, thereby promoting the synthesis of secondary metabolites. In cluster 1... what? As a transcriptional regulator, it directly activates sporulation-related cell division genes, and its downregulation in the dasR mutant is consistent with the downregulation of expression levels of the genes involved in cell division mentioned above.

[0062] The above data shows that, right The knockout may have affected i) the biosynthesis of spiramycin (e.g. right Among the knockout strains srm22 and srm40 ii) upregulation of carbon and nitrogen metabolism (e.g.) right Among the knockout strains pgi , pdhA down and no , nagB、glnII , gltB iii) upregulation of lipid metabolism (e.g., upregulation of acs); iv) transcriptional regulation (e.g., upregulation of acs). right Among the knockout strains what? (v) downregulation); v) oxidative stress response (e.g. right Among the knockout strains sigR (The downward adjustment).

[0063] The above description of the embodiments is provided to enable those skilled in the art to understand and use the invention. It will be apparent to those skilled in the art that various modifications can be made to these embodiments, and the general principles described herein can be applied to other embodiments without inventive effort. Therefore, the present invention is not limited to the above embodiments, and any improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the invention should be within the protection scope of the present invention. The above description of the embodiments is provided to enable those skilled in the art to understand and use the invention. It will be apparent to those skilled in the art that various modifications can be made to these embodiments, and the general principles described herein can be applied to other embodiments without inventive effort. Therefore, the present invention is not limited to the above embodiments, and any improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the invention should be within the protection scope of the present invention.

Claims

1. A kind dasR Gene-deleted Streptomyces strains, characterized in that, Should dasR Gene-deleted Streptomyces strains are transcription regulators of the GntR / HutC family in Streptomyces that have been knocked out. dasR The obtained mutant strain; dasR The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. The one described in claim 1 dasR A method for preparing a gene-deleted Streptomyces strain, characterized in that, Includes the following steps: S1: Using the *Streptomyces bisporus* genome as a template, PCR amplification was performed using upstream and downstream homologous arm amplification primer pairs, respectively, to obtain the target... dasR Upstream and downstream homologous arm segments of a gene; S2: Will target dasR By connecting the upstream and downstream homologous arms of a gene, a pre-knockout gene can be obtained. dasR Homologous arm sequences; S3: Insert the pre-knockout gene at the multiple cloning site of the temperature-sensitive plasmid. dasR The homologous arm sequences were obtained. dasR pD with gene deletion dasR plasmids; S4: Preparation of Streptomyces bifidum mycelium: The seed culture of Streptomyces bifidum was cultured, centrifuged, washed, and resuspended to obtain Streptomyces bifidum mycelium; S5: Will dasR pD with gene deletion dasR The plasmid was introduced into the mycelium of Streptomyces bifidus via conjugation transfer. S6: Successful single-exchange conjugates were screened, then continuously passaged, diluted, and plated onto antibiotic-free plates for further culture. Validation was performed using colony PCR. dasR Gene-deleted Streptomyces strain.

3. The one according to claim 2 dasR A method for preparing a gene-deleted Streptomyces strain, characterized in that, In step S1, the upstream homologous arm amplification primer pair is pKC- dasR -up-F / pKC- dasR -up-R; The downstream homologous arm amplification primer pair is pKC- dasR -down-F / pKC- dasR -down-R; pKC- dasR The nucleotide sequence of -up-F is shown in SEQ ID NO.2; pKC- dasR The nucleotide sequence of -up-R is shown in SEQ ID NO.3; pKC- dasR The nucleotide sequence of -down-F is shown in SEQ ID NO.4; pKC- dasR The nucleotide sequence of -down-R is shown in SEQ ID NO.

5.

4. The one according to claim 2 dasR A method for preparing a gene-deleted Streptomyces strain, characterized in that, In step S3, the temperature-sensitive plasmid is pKC1139, and it is linked to the homologous arm through its HindIII and XbaI restriction sites.

5. The method according to claim 2 dasR A method for preparing a gene-deleted Streptomyces strain, characterized in that, In step S5, the conjugation transfer is mediated by Escherichia coli donor strain ET12567 containing helper plasmid pUZ8002.

6. The method according to claim 2 dasR A method for preparing a gene-deleted Streptomyces strain, characterized in that, In step S6, the temperature for continuous subculture is 26-30℃, and the number of subcultures is 3-5 times.

7. The one described in claim 1 dasR Application of genes in the preparation of streptavidin-producing Streptomyces.

8. The one described in claim 1 dasR Application of gene-deleted Streptomyces strains in the fermentation production of spiramycin.

9. A method for producing spiramycin by fermentation, characterized in that, include: Cultivate the as described in claim 1 dasR Gene-deleted Streptomyces strains were obtained, and spiramycin was collected or extracted from the cultures.

10. A method for producing spiramycin by fermentation according to claim 9, characterized in that, The cultivation process is as follows: dasR The gene-deleted Streptomyces knockout strain was inoculated onto Streptomyces solid plate medium and cultured, then inoculated into seed culture medium and cultured; the cultured seed liquid was then inoculated into fermentation medium and fermented.

Images