A recombinant escherichia coli containing a multi-enzyme mutant for fermentative production of chlorogenic acid, a method and an application thereof
Patent Information
- Application Number
- CN202611104704.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-07-24
- Publication Date
- 2026-08-21
AI Technical Summary
[0011]二是关键酶催化效率和底物选择性仍有限
1、与含有野生型酶的对照菌株相比,含有突变体的工程菌株绿原酸产量显著提高,说明本发明通过“底盘强化+关键酶工程化”的协同策略,有效提高了绿原酸合成效率。本发明方法可用于外源补加酪氨酸条件下绿原酸发酵生产,也可用于绿原酸合成路径关键节点和酶性能的筛选评价。
Smart Images

Figure CN122609481A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of bioengineering technology, and in particular to a recombinant Escherichia coli containing a multi-enzyme mutant for fermentation to produce chlorogenic acid, a method thereof, and its application. Background Technology
[0002] Chlorogenic acid (CGA) is a class of natural phenolic propane compounds formed by the esterification of caffeic acid and quinine. It is widely found in plants such as honeysuckle, eucommia, and green coffee beans, and possesses antioxidant, anti-inflammatory, antibacterial, and neuroprotective activities, making it highly valuable in the food, health product, pharmaceutical, and daily chemical industries. Currently, chlorogenic acid is mainly obtained through plant extraction. However, plant extraction methods are affected by factors such as raw material sources, planting cycles, geographical environment, and fluctuations in the content of effective components in tissues, resulting in long production cycles, unstable yields, high separation costs, and significant environmental burdens. In contrast, the production of chlorogenic acid through fermentation using microbial cell factories can utilize inexpensive carbon sources such as glucose and glycerol, offering advantages such as being green, sustainable, and suitable for large-scale production, thus attracting increasing attention.
[0003] From a metabolic perspective, the biosynthesis of chlorogenic acid requires the simultaneous supply of two types of precursors: one is the phenylpropane pathway, which involves the formation of p-coumaric acid and caffeic acid from L-tyrosine via reactions such as TAL and HpaBC; the other is the quinic acid pathway, which involves the formation of quinic acid / 3-dehydroquinic acid from the shikimic acid pathway. Subsequently, caffeic acid is activated by 4CL to generate caffeoyl-CoA, which then condenses with quinic acid under HQT catalysis to form chlorogenic acid. Ensuring the balance of precursors, cofactor supply, and key enzyme selectivity in both the caffeic acid and quinic acid pathways has always been a core challenge in this field. Therefore, the key to efficient biosynthesis of chlorogenic acid lies in: increasing the supply of aromatic and quinic acid precursors, coordinating the flux of the two precursor pathways, improving the catalytic efficiency of key enzymes, reducing byproduct accumulation, and enhancing the stability of the fermentation process.
[0004] Specifically, the existing technologies for bio-manufacturing chlorogenic acid can be broadly classified into the following categories.
[0005] First, in vitro enzymatic methods or heterologous HQT / HCT / 4CL combined catalytic routes. An earlier patent (international patent publication WO2012126789A1) disclosed the idea of using enzyme systems such as HCT / HQT and 4CL to synthesize chlorogenic acid species in vitro or in recombinant systems, indicating that the framework of "using HQT / 4CL combination to generate chlorogenic acid or its analogues" is not new in itself.
[0006] Second, artificial microbial communities or modular co-culture routes. A research report published in 2021 (De NovoBiosynthesis of Chlorogenic Acid Using an Artificial Microbial Community.PMID: 33629856 Journal of Agricultural and Food Chemistry, 25 Feb 2021, 69(9):2816-2825 https: / / doi.org / 10.1021 / acs.jafc.0c07588) separated the caffeic acid module, quinic acid module, and chlorogenic acid condensation module into three recombinant Escherichia coli strains, and achieved de novo synthesis of chlorogenic acid through artificial microbial communities. This route proved the feasibility of modular balanced throughput, but also reflected that it is not easy to simultaneously take care of two precursor branches within a single strain.
[0007] Third, the complete pathway for reconstructing single-strain Escherichia coli. Chinese patent publication CN116376796A discloses a recombinant Escherichia coli for producing chlorogenic acid, expressing FjTAL, endogenous HpaBC, aroG^fbr, tyrC, ydiB, NtHQT, and At4CL1 in Escherichia coli, and further overexpressing aroB, gldA, and knocking out menI; the reported yield in shake flasks can reach 638.2 mg / L, and in a 5L fermenter it can reach 2.8 g / L.
[0008] Fourth, a route focusing on BL21(DE3) and QA flux enhancement. Chinese patent publication CN117660274A discloses a method for improving chlorogenic acid production by using BL21(DE3)ΔtyrRΔmenI as the host, expressing HpaBC, reducing aroD expression intensity, and integrating ydiB into the aroE site; it reports that the chlorogenic acid accumulation in the shake flask after 72 hours is 1058 mg / L, and the chlorogenic acid content in the fermentation broth of a 5L fermenter after 52 hours reaches 4278 mg / L.
[0009] Fifth, further combining enzyme engineering, byproduct identification, and precursor throughput fine-tuning. Chinese patent publication CN117187283A discloses a chlorogenic acid engineered bacterium that simultaneously expresses 11 enzymes and knocks out related competing nodes; Chinese patent publication CN117645981A further discloses a tobacco-derived HQT mutant and its application in increasing chlorogenic acid production in BL21(DE3)ΔtyrRΔmenI. A report from 2025 (Efficient Biosynthesis of Chlorogenic Acid in Escherichia coli by Optimization of Precursors Metabolic Flow and Reduction of an Unknown Byproduct ACS Sustainable Chemistry & Engineering 202513 (9), 3479-3490 DOI: 10.1021 / acssuschemeng.4c08395) showed that by fine-tuning aroD and ydiB, identifying unknown byproducts, introducing HpaBC for splitting, and modifying the NtHQT catalytic pocket, the chlorogenic acid titer in a 5L fermenter could be further increased to approximately 4.99 g / L.
[0010] Although existing technologies have demonstrated that chlorogenic acid can be synthesized de novo or through biotransformation in microorganisms, the following shortcomings still exist: First, balancing the two precursor pathways is difficult. Chlorogenic acid synthesis depends on both caffeic acid and quinic acid precursors. Many existing technologies either emphasize enhancing the tyrosine / caffeic acid module or the quinic acid module, often leading to intermediate accumulation and limited efficiency in final product synthesis. The artificial microbial community route itself also illustrates that competition between the two pathways within a single strain is an objective challenge.
[0011] Second, the catalytic efficiency and substrate selectivity of key enzymes remain limited. In particular, key enzymes such as HQT, 4CL, and TAL often suffer from unsatisfactory expression levels, solubility, or substrate preference in heterologous hosts. In recent years, publicly available technologies have begun to improve efficiency through HQT mutation and TAL engineering, indicating that this issue remains a recognized bottleneck in the industry.
[0012] Third, the problem of byproducts is significant. The latest publicly available research has shown that NtHQT may catalyze the formation of non-target byproducts from L-DOPA and quinic acid. This requires HpaBC splitting and HQT catalytic pocket modification to reduce side reactions, which will affect carbon flow utilization, target product purity, and fermentation stability.
[0013] Fourth, there is still room for improvement in fermentation intensity and industrial applicability. Although existing single-strain routes can achieve g / L levels, induction methods, expression burden, precursor imbalance, and byproduct accumulation still limit further scale-up.
[0014] In summary, the existing technology has the following problems: 1. The existing chlorogenic acid engineered bacteria have an imbalance in the flux of the caffeic acid branch and the quinic acid branch, which leads to the accumulation of intermediates and insufficient yield of final products.
[0015] 2. Existing key enzymes such as TAL, HQT, 4CL, and HpaBC have limited catalytic efficiency and substrate selectivity, and produce a large number of byproducts.
[0016] 3. In existing publicly available schemes, the chlorogenic acid pathway in the BL21(DE3) system often adopts known modular combinations, lacking an integrated scheme that synergistically designs around a high QA throughput chassis and key enzyme modifications.
[0017] 4. There is still a need to improve the production intensity and process stability when using existing engineered bacteria to produce chlorogenic acid. Summary of the Invention
[0018] The purpose of this invention is to overcome the shortcomings of the prior art and provide a recombinant Escherichia coli containing a multi-enzyme mutant for fermentation to produce chlorogenic acid, a method, and applications.
[0019] The technical solution adopted by this invention to solve its technical problem is: A recombinant Escherichia coli strain containing a multi-enzyme mutant for fermentation to produce chlorogenic acid is disclosed. The recombinant Escherichia coli strain is based on Escherichia coli BL21(DE3) as the starting strain. A high-quinic acid throughput chassis strain is obtained through genome editing. The strain is further introduced with a key enzyme expression module for chlorogenic acid biosynthesis to obtain a recombinant strain. Then, the key rate-limiting enzyme is modified by protein engineering to finally obtain a recombinant Escherichia coli strain that can efficiently produce chlorogenic acid, thereby achieving efficient synthesis of chlorogenic acid.
[0020] Furthermore, the recombinant *E. coli* strain is *Escherichia coli* BL21(DE3), with the 3-dehydroquinic acid dehydratase encoding gene *aroD* knocked out; the quinic acid / shikimate-5-dehydrogenase encoding gene *ydiB* and the feedback-inhibited 3-deoxy-D-arabinohepenolate-7-phosphate synthase encoding gene *aroG* are integrated into and expressed in the genome. fbrThe enzyme expressed the following genes: phosphoenolpyruvate synthase (ppsA), 3-dehydroquinic acid synthase (aroB), and transketolase I (tktA); and expressed the tyrosine ammonia-lyase mutant RgTAL (Q115L / N247H), 4-hydroxyphenylacetic acid-3-hydroxylase HpaBC, 4-coumarate-coenzyme A ligase At4CL, and hydroxycinnamoyl-coenzyme A quinic acid transferase mutant HQT (R39K / D352E). Among them, the aroG fbr The nucleotide sequence of the RgTAL (Q115L / N247H) is shown in SEQ ID NO.1, the nucleotide sequence of the At4CL is shown in SEQ ID NO.3, and the nucleotide sequence of the HQT (R39K / D352E) is shown in SEQ ID NO.5.
[0021] Furthermore, the recombinant *E. coli* strain uses *Escherichia coli* BL21(DE3) as the starting strain. A high-quinic acid throughput chassis strain was first obtained through genome editing. The genome configuration of this chassis strain is as follows: E. coli△ aroD yeeL::PproD-ydiB yjgX::proD-aroG fbr mbhA::PproD-ppsA yghE::Ptrc-aroB yjiV::Ptrc-tktA ; Specifically, the aroD gene was knocked out to block the competitive conversion of 3-dehydroquinic acid to 3-dehydroshikimic acid. Aromatic amino acids or tyrosine were added to the culture medium to ensure the supply of substrates for the caffeic acid pathway. ydiB was expressed under the control of the PproD promoter to promote quinic acid production. aroG... fbr Expression under the control of the PproD promoter enhances DAHP synthesis and relieves feedback inhibition; expression of ppsA under the control of the PproD promoter enhances the supply of phosphoenolpyruvate; expression of aroB under the control of the Ptrc promoter enhances the synthesis of 3-dehydroquinic acid; expression of tktA under the control of the Ptrc promoter enhances the supply of erythrose-4-phosphate; thereby improving the upstream metabolic flux of the shikimic acid pathway and the supply capacity of quinic acid precursors. Two chlorogenic acid synthesis expression modules were further introduced into the high-quinic acid throughput chassis strain: The first expression module is pACYC-RgTAL-HpaBC, which contains the tyrosine ammonia-lyase gene RgTAL from Rhodotorula glutinis and the 4-hydroxyphenylacetic acid-3-hydroxylase gene HpaBC from Escherichia coli; RgTAL is used to catalyze the production of p-coumaric acid from L-tyrosine, and HpaBC is used to catalyze the hydroxylation of p-coumaric acid to caffeic acid; The second expression module is pETDuet-HQT-At4CL, which contains the 4-coumaric acid-coenzyme A ligase gene At4CL from Arabianopsis thaliana and the hydroxycinnamoyl-CoA quinic acid transferase gene HQT from Nicotiana; At4CL is used to catalyze the production of caffeic acid from caffeic acid to caffeoyl-CoA, and HQT is used to catalyze the condensation of caffeoyl-CoA with quinic acid to produce chlorogenic acid. Wherein, RgTAL and HQT are mutants modified by protein engineering, RgTAL is RgTAL(Q115L / N247H) with its nucleotide sequence as shown in SEQ ID NO.6, and HQT is HQT(R39K / D352E) with its nucleotide sequence as shown in SEQ ID NO.5; Finally got: E.coli BL21(DE3)ΔaroD yeeL::PproD-ydiB yjgX::PproD-aroG fbr mbhA::PproD-ppsA yghE::Ptrc-aroB yjiV::Ptrc-tktA carries pACYC-RgTAL(Q115L / N247H)-HpaBC / pETDuet-HQT(R39K / D352E)-At4CL; Among them, the genes integrated into the genome of engineered bacteria aroG fbr The nucleotide sequences are shown in SEQ ID NO.1, and the nucleotide sequences of the genes RgTAL, At4CL and HQT related to the catalysis of chlorogenic acid synthesis are shown in SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4, respectively.
[0022] Furthermore, the high-quinic acid flux chassis is based on Escherichia coli BL21(DE3), with overexpression of the E. coli endogenous transketolase I encoding gene tktA; and overexpression of the E. coli endogenous phosphoenolpyruvate synthase encoding gene. ppsA tktA and ppsA are key genes in the biosynthetic center of the shikimate pathway metabolite. Co-expression of these two genes promotes the production of DAHP, the first intermediate in the shikimate pathway. Overexpression of the key gene for endogenous quinic acid / shikimate-5-dehydrogenase in *E. coli* is also crucial. ydiB Overexpression of key genes for endogenous 3-deoxy-D-arabinohepetulose-7-phosphate synthase in Escherichia coli aroG Mutants that relieve feedback inhibition aroG fbr Overexpression of the gene encoding the 3-dehydroquinic acid synthase in the endogenous shikimic acid pathway of Escherichia coli aroB The gene encoding 3-dehydroquinic acid dehydratase is missing. aroD ; Obtain a high-quinic acid flux chassis.
[0023] Furthermore, when introducing the key enzyme expression module for chlorogenic acid biosynthesis, the nucleic acid sequence encoding the key enzyme for chlorogenic acid synthesis is introduced into the expression vector and then transferred into the chassis strain; wherein, the key enzyme includes at least RgTAL, which catalyzes the conversion of L-tyrosine to p-coumaric acid, HQT and At4CL, which catalyze the condensation of caffeoyl-CoA with quinic acid to generate chlorogenic acid, and HpaBC, which catalyzes the hydroxylation reaction and promotes the formation of caffeic acid; Alternatively, when combining protein engineering to modify key rate-limiting enzymes, the key rate-limiting enzymes are HQT and RgTAL, which are key rate-limiting enzymes in the chlorogenic acid synthesis process. HQT is mutated at a specific site to obtain the combined mutant HQT (R39K / D352E); RgTAL is mutated at a specific site to obtain the combined mutant RgTAL (Q115L / N247H). The above mutants are used to improve the caffeic acid synthesis capacity and / or chlorogenic acid fermentation titer of the engineered bacteria. Then, a plasmid containing the above two combined mutants is constructed, and the two plasmids are introduced into the recombinant strain to obtain recombinant Escherichia coli containing multi-enzyme mutants for fermentation to produce chlorogenic acid.
[0024] Furthermore, RgTAL, HQT, At4CL, and HpaBC were placed in one or more plasmid expression vectors and combined and optimized using different promoter strengths, RBS strengths, copy numbers, or induction strategies to regulate the metabolic balance between the caffeic acid tributary and the quinic acid tributary. Alternatively, two functional module expression vectors were constructed: plasmid pACYC-RgTAL-HpaBC, to enhance the supply of caffeic acid precursors; and plasmid pETDuet-HQT-At4CL, to catalyze the generation of caffeoyl-CoA and the chlorogenic acid condensation reaction.
[0025] The method for constructing recombinant Escherichia coli as described above includes the following steps, the order of which can be adjusted except for step S1: S1. Obtain the starting strain Using Escherichia coli BL21(DE3) as the starting strain, electrotransformation competent cells were prepared for subsequent genome editing and plasmid transformation; S2, Knockout of the aroD gene The aroD gene in the genome of the starting strain was knocked out using CRISPR / Cas9, λ-Red homologous recombination or a combination thereof to block the conversion of 3-dehydroquinic acid to 3-dehydroshikimic acid, thus obtaining the E. coli BL21(DE3)ΔaroD strain. S3, Integrated ydiB Expression Box The PproD-ydiB expression cassette was integrated into the yeeL pseudogene site of the E. coli BL21(DE3)ΔaroD strain, so that the endogenous quinic acid / shikimic acid-5-dehydrogenase encoding gene ydiB in E. coli was expressed under the control of the PproD promoter, and an engineered strain capable of enhancing quinic acid production was obtained. S4, integrating aroG fbr Expression Box The strain obtained in step S3 integrates the PproD-aroGfbr expression cassette at the pseudogene locus yjgX in its genome, thereby releasing the feedback-inhibited gene encoding the 3-deoxy-D-arabinohepenolate-7-phosphate synthase aroG. fbr Expression under the control of the PproD promoter to enhance the ingress metabolic flux of the shikimic acid pathway; S5, Integrated PPSA Expression Box The PproD-ppsA expression cassette is integrated into the mbhA site of the genomic pseudogene locus of the strain obtained in step S4, so that the phosphoenolpyruvate synthase encoding gene ppsA is expressed under the control of the PproD promoter, thereby increasing the supply level of phosphoenolpyruvate. S6, Integrated aroB Expression Box The Ptrc-aroB expression cassette is integrated into the yghE pseudogene site of the strain obtained in step S5, so that the 3-dehydroquinic acid synthase encoding gene aroB is expressed under the control of the Ptrc promoter, thereby promoting the conversion of DAHP to 3-dehydroquinic acid. S7, Integrated tktA Expression Box The Ptrc-tktA expression cassette was integrated into the yjiV pseudogene locus of the strain obtained in step S6, enabling the expression of the transketolase I encoding gene tktA under the control of the Ptrc promoter, thereby enhancing the supply of erythrose-4-phosphate; thus, a high-quinic acid flux chassis strain was obtained: E. coli BL21(DE3)ΔaroDyeeL::PproD-ydiB yjgX::PproD-aroG fbr mbhA::PproD-ppsA yghE::Ptrc-aroB yjiV::Ptrc-tktA; S8. Constructing a caffeic acid synthesis and expression module The RgTAL gene from Rhodotorula glutinis and the HpaBC gene from Escherichia coli were cloned into the pACYC-Duet1 vector to construct the plasmid pACYC-RgTAL-HpaBC. RgTAL is used to catalyze the production of p-coumaric acid from L-tyrosine, and HpaBC is used to catalyze the hydroxylation of p-coumaric acid to caffeic acid. S9. Constructing a chlorogenic acid condensation expression module The At4CL gene from Arabianopsis thaliana and the HQT gene from Nicotiana were cloned into the pETDuet-1 vector to construct the plasmid pETDuet-HQT-At4CL. At4CL is used to catalyze the production of caffeic acid from caffeoyl-CoA, and HQT is used to catalyze the condensation of caffeoyl-CoA with quinic acid to produce chlorogenic acid. S10. Obtain the key enzyme mutant. Site-directed mutagenesis was performed on the HQT to obtain the combined mutant HQT(R39K / D352E); site-directed mutagenesis was performed on the RgTAL to obtain the combined mutant RgTAL(Q115L / N247H); and the wild-type HQT and RgTAL in the corresponding plasmids were replaced respectively to obtain expression plasmids containing mutant enzymes: pACYC-RgTAL(Q115L / N247H)-HpaBC and pETDuet-HQT(R39K / D352E)-At4CL; S11, high-quinic acid flux chassis strain The two expression plasmids obtained in step S10 were co-transformed into the high-quinic acid throughput chassis strain obtained in step S7. After resistance screening, colony PCR, plasmid verification and sequencing confirmation, recombinant Escherichia coli containing multi-enzyme mutants for chlorogenic acid production was obtained. S12. Induced expression and verification of chlorogenic acid synthesis ability. The recombinant E. coli obtained in step S11 was inoculated into fermentation medium and cultured. After 6 hours of cell growth, 0.1–0.5 mM IPTG was added to induce the expression of RgTAL (Q115L / N247H), HpaBC, At4CL, and HQT (R39K / D352E). After fermentation, the chlorogenic acid content was detected, and recombinant E. coli capable of producing chlorogenic acid efficiently was screened. Among them, the chlorogenic acid yield of the screened recombinant E. coli was not less than 524 mg / L under the condition of 48 h of shake flask fermentation, which was 48.0% higher than that of the strain without HQT mutation.
[0026] The application of recombinant Escherichia coli in chlorogenic acid fermentation production as described above.
[0027] The method for producing chlorogenic acid using recombinant Escherichia coli fermentation as described above includes the following steps: Single colonies of recombinant *E. coli* were picked from glycerol tubes or plates and inoculated into 3–5 mL of LB liquid medium. The colonies were cultured at 37°C and 220 rpm for 12–16 h as primary seed culture. Then, 1–2% of the inoculum was transferred to 500 mL shake flasks containing 25–50 mL of LB liquid medium and cultured at 37°C and 220 rpm for 6–8 h as secondary seed culture. Finally, 1–2% of the inoculum was transferred to fermentation medium and cultured at 37°C for 6 h. After induction with 0.1 mM IPTG inducer, the culture was fermented at 28°C for 48 h.
[0028] Furthermore, the specific steps include the following: Single colonies of recombinant *E. coli* were picked from glycerol tubes or plates and inoculated into 3–5 mL of LB liquid medium. The culture was incubated at 37°C and 220 rpm for 12–16 h as primary seed culture. Then, 1–2% of the inoculum was transferred to 500 mL shake flasks containing 25–50 mL of LB liquid medium and incubated at 37°C and 220 rpm for 6–8 h as secondary seed culture. The secondary seed culture was then inoculated at 2% (v / v) into 500 mL shake flasks containing 50 mL of fermentation medium and incubated at 37°C and 220 rpm for 6 h. After incubation, 0.1 mM IPTG was added to induce expression. The culture temperature was then adjusted to 28°C. At 12 h post-inoculation, tyrosine was added to the fermentation medium to achieve a final concentration of 4 g / L. After feeding, the culture was maintained at 28°C and 220 rpm for 48 h post-inoculation until fermentation was complete.
[0029] Further, the fermentation medium is formulated as follows: D-glucose: 20 g / L, yeast extract: 5-7 g / L, ammonium sulfate: 7.5 g / L, potassium dihydrogen phosphate: 2 g / L, dipotassium hydrogen phosphate trihydrate: 3 g / L, magnesium sulfate heptahydrate: 1 g / L, sodium chloride: 0.5 g / L, citric acid monohydrate: 1.1 g / L, thiamine hydrochloride: 0.1 g / L, L-ascorbic acid: 0.45 g / L, betaine: 5 g / L, trace element solution: 1 mL / L, L-tyrosine 2 g / L, L-phenylalanine: 1 g / L, L-tryptophan: 1 g / L, with water as the solvent; The formula for the trace element solution is as follows: FeSO4·7H2O: 10 g / L, ZnSO4·7H2O: 2.2 g / L, MnSO4·H2O: 1.54 g / L, CuSO4·5H2O: 1.0 g / L, (NH4)6Mo7O 24 ·4H2O: 0.5 g / L, H3BO3: 0.5 g / L, CoCl2·6H2O: 0.1 g / L, solvent is water.
[0030] The advantages and positive effects of this invention are as follows: 1. Compared with the control strain containing wild-type enzymes, the engineered strain containing the mutant showed a significant increase in chlorogenic acid production, indicating that the present invention effectively improves chlorogenic acid synthesis efficiency through a synergistic strategy of "chassis enhancement + key enzyme engineering". The method of this invention can be used for chlorogenic acid fermentation production under exogenous tyrosine supplementation conditions, and can also be used for screening and evaluating the performance of key nodes and enzymes in the chlorogenic acid synthesis pathway.
[0031] 2. This invention constructs a high-quinic acid throughput chassis strain based on BL21(DE3), and then introduces plasmid expression vectors containing key enzyme genes such as RgTAL, HQT, At4CL, and HpaBC, along with their engineered protein variants, into this chassis to achieve efficient synthesis of chlorogenic acid and its intermediates. This invention emphasizes a synergistic design of "chassis quinic acid throughput enhancement + key enzyme engineering + pathway combination optimization," rather than simply stacking conventional pathway elements.
[0032] 3. This invention reduces the metabolic stress caused by high burden expression of a single plasmid, which is beneficial to pathway balance. This invention divides the chlorogenic acid synthesis pathway into two functional modules: one is the pACYC-RgTAL(Q115L / N247H)-HpaBC caffeic acid precursor supply module; the other is the pETDuet-HQT(R39K / D352E)-At4CL chlorogenic acid condensation module.
[0033] By combining the low-copy pACYC-Duet1 vector with the pETDuet-1 dual-expression vector, the caffeic acid condensation pathway and the chlorogenic acid condensation pathway can be regulated relatively independently. Compared with the wild-type enzyme combination, the chlorogenic acid yield per cell in the dual-module mutant engineered strain increased from 298 mg / L to 524 mg / L.
[0034] 4. Compared with existing technologies, the key improvement of this invention lies not in simply replacing HQT or simply superimposing existing synthesis modules, but in combining a high-quinic acid throughput chassis, an RgTAL precursor supply mutant, and an HQT terminal condensation mutant. Comparative experiments under the same chassis, culture medium, and induction conditions show that RgTAL (Q115L / N247H) significantly increases caffeic acid precursor supply, and HQT (R39K / D352E) significantly improves chlorogenic acid synthesis efficiency. The combination of these two enzymes resulted in a 48.0% increase in chlorogenic acid production in engineered strain CGA-02 compared to strain CGA-01, which combines RgTAL (Q115L / N247H) with the wild-type HQT key enzyme. This technical effect directly demonstrates that the dual-key enzyme combination in this invention substantially contributes to the chlorogenic acid synthesis pathway. Attached Figure Description
[0035] Figure 1This is a metabolic pathway diagram of chlorogenic acid biosynthesis in Escherichia coli in this invention; Figure 2 In this invention aroD Gene knockout verification diagram; where M: Marker, 1: aroD Upstream homologous arm fragment, 2: aroD Downstream homologous arm fragment, 3: aroD Positive transformant, 4: original bacteria negative control; Figure 3 This is a full plasmid map of pACYC-RgTAL-HpaBC in this invention; Figure 4 This is a full plasmid map of pETDuet-HQT-At4CL in this invention; Figure 5 The diagram shows the simulation and mutation site analysis of the key enzyme HQT before and after docking with RgTAL in this invention; where A is a schematic diagram of the protein structure of the key enzyme HQT, B is a schematic diagram of the mutation site after molecular docking of the key enzyme HQT with the ligand quinic acid, C is a schematic diagram of the protein structure of the key enzyme RgTAL, and D is a schematic diagram of the mutation site after molecular docking of the key enzyme RgTAL with the ligand tyrosine. Figure 6 The diagram shows the effects of different RgTAL mutants on caffeic acid production (A) and different HQT mutants on chlorogenic acid production (B). The caffeic acid production corresponding to WT RgTAL, RgTAL(Q115L), RgTAL(N247H), and RgTAL(Q115L / N247H) are 590 mg / L, 623 mg / L, 615 mg / L, and 689 mg / L, respectively. The chlorogenic acid production corresponding to WT HQT, HQT(R39K), HQT(D352E), and HQT(R39K / D352E) are 354 mg / L, 362 mg / L, 427 mg / L, and 524 mg / L, respectively. Figure 7 This is a comparison of chlorogenic acid titers among the wild-type key enzyme combination engineered strain CGA-00, the RgTAL mutant engineered strain CGA-01, and the double-mutant key enzyme combination engineered strain CGA-02 in this invention. CGA-01 showed an 18.8% increase compared to CGA-00, CGA-02 showed a 48.0% increase compared to CGA-01, and CGA-02 showed a 75.8% increase compared to CGA-00. Detailed Implementation
[0036] The present invention will be further described below with reference to the embodiments. The following embodiments are descriptive and not limiting, and should not be used to limit the scope of protection of the present invention.
[0037] The various experimental operations involved in the specific embodiments are all conventional techniques in the field. For parts not specifically annotated in this document, those skilled in the art can refer to various commonly used reference books, scientific and technological documents or related instructions and manuals prior to the filing date of this invention to carry out the operations.
[0038] A recombinant Escherichia coli strain containing a multi-enzyme mutant for fermentation to produce chlorogenic acid is disclosed. The recombinant Escherichia coli strain is based on Escherichia coli BL21(DE3) as the starting strain. A high-quinic acid throughput chassis strain is obtained through genome editing. The strain is further introduced with a key enzyme expression module for chlorogenic acid biosynthesis to obtain a recombinant strain. Then, the key rate-limiting enzyme is modified by protein engineering to finally obtain a recombinant Escherichia coli strain that can efficiently produce chlorogenic acid, thereby achieving efficient synthesis of chlorogenic acid.
[0039] Furthermore, the recombinant *E. coli* strain uses *Escherichia coli* BL21(DE3) as the starting strain. A high-quinic acid throughput chassis strain was first obtained through genome editing. The genome configuration of this chassis strain is as follows: E. coli△ aroD yeeL::PproD-ydiB yjgX::proD-aroG fbr mbhA::PproD-ppsA yghE::Ptrc-aroB yjiV::Ptrc-tktA ; Specifically, the aroD gene was knocked out to block the competitive conversion of 3-dehydroquinic acid to 3-dehydroshikimic acid. Aromatic amino acids or tyrosine were added to the culture medium to ensure the supply of substrates for the caffeic acid pathway. ydiB was expressed under the control of the PproD promoter to promote quinic acid production. aroG... fbr Expression under the control of the PproD promoter enhances DAHP synthesis and relieves feedback inhibition; expression of ppsA under the control of the PproD promoter enhances the supply of phosphoenolpyruvate; expression of aroB under the control of the Ptrc promoter enhances the synthesis of 3-dehydroquinic acid; and expression of tktA under the control of the Ptrc promoter enhances the supply of erythrose-4-phosphate. This improves the upstream metabolic flux of the shikimic acid pathway and the supply capacity of quinic acid precursors. Two chlorogenic acid synthesis expression modules were further introduced into the high-quinic acid throughput chassis strain: The first expression module is pACYC-RgTAL-HpaBC, which contains the tyrosine ammonia-lyase gene RgTAL from Rhodotorula glutinis and the 4-hydroxyphenylacetic acid-3-hydroxylase gene HpaBC from Escherichia coli; RgTAL is used to catalyze the production of p-coumaric acid from L-tyrosine, and HpaBC is used to catalyze the hydroxylation of p-coumaric acid to caffeic acid; The second expression module is pETDuet-HQT-At4CL, which contains the 4-coumaric acid-coenzyme A ligase gene At4CL from Arabianopsis thaliana and the hydroxycinnamoyl-CoA quinic acid transferase gene HQT from Nicotiana; At4CL is used to catalyze the production of caffeic acid from caffeic acid to caffeoyl-CoA, and HQT is used to catalyze the condensation of caffeoyl-CoA with quinic acid to produce chlorogenic acid. Wherein, RgTAL and HQT are mutants modified by protein engineering, RgTAL is RgTAL(Q115L / N247H) with its nucleotide sequence as shown in SEQ ID NO.6, and HQT is HQT(R39K / D352E) with its nucleotide sequence as shown in SEQ ID NO.5; Finally got: E.coli BL21(DE3)ΔaroD yeeL::PproD-ydiB yjgX::PproD-aroG fbr mbhA::PproD-ppsA yghE::Ptrc-aroB yjiV::Ptrc-tktA carries pACYC-RgTAL(Q115L / N247H)-HpaBC / pETDuet-HQT(R39K / D352E)-At4CL; Among them, the genes integrated into the genome of engineered bacteria aroG fbr The nucleotide sequences are shown in SEQ ID NO.1, and the nucleotide sequences of the genes RgTAL, At4CL and HQT related to the catalysis of chlorogenic acid synthesis are shown in SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4, respectively.
[0040] Furthermore, the high-quinic acid flux chassis is based on Escherichia coli BL21(DE3), with overexpression of the E. coli endogenous transketolase I encoding gene tktA; and overexpression of the E. coli endogenous phosphoenolpyruvate synthase encoding gene. ppsA tktA and ppsA are key genes in the biosynthetic center of the shikimate pathway metabolite. Co-expression of these two genes promotes the production of DAHP, the first intermediate in the shikimate pathway. Overexpression of the key gene for endogenous quinic acid / shikimate-5-dehydrogenase in *E. coli* is also crucial. ydiB Overexpression of key genes for endogenous 3-deoxy-D-arabinohepetulose-7-phosphate synthase in Escherichia coli aroG Mutants that relieve feedback inhibition aroG fbr Overexpression of the gene encoding the 3-dehydroquinic acid synthase in the endogenous shikimic acid pathway of Escherichia coli aroB The gene encoding 3-dehydroquinic acid dehydratase is missing. aroD ; Obtain a high-quinic acid flux chassis.
[0041] Furthermore, when introducing the key enzyme expression module for chlorogenic acid biosynthesis, the nucleic acid sequence encoding the key enzyme for chlorogenic acid synthesis is introduced into the expression vector and then transferred into the chassis strain; wherein, the key enzyme includes at least one or more of the following: RgTAL, which catalyzes the conversion of L-tyrosine to p-coumaric acid; HQT and At4CL, which catalyze the condensation of caffeoyl-CoA with quinic acid to generate chlorogenic acid; and HpaBC, which catalyzes hydroxylation reactions and promotes the formation of caffeic acid; Alternatively, when combining protein engineering to modify key rate-limiting enzymes, the key rate-limiting enzymes are HQT and RgTAL, which are key rate-limiting enzymes in the chlorogenic acid synthesis process. HQT is mutated at a specific site to obtain the combined mutant HQT (R39K / D352E); RgTAL is mutated at a specific site to obtain the combined mutant RgTAL (Q115L / N247H). The above mutants are used to improve the caffeic acid synthesis capacity and / or chlorogenic acid fermentation titer of the engineered bacteria. Then, a plasmid containing the above two combined mutants is constructed, and the two plasmids are introduced into the recombinant strain to obtain recombinant Escherichia coli containing multi-enzyme mutants for fermentation to produce chlorogenic acid.
[0042] Furthermore, RgTAL, HQT, At4CL, and HpaBC were placed in one or more plasmid expression vectors and combined and optimized using different promoter strengths, RBS strengths, copy numbers, or induction strategies to regulate the metabolic balance between the caffeic acid tributary and the quinic acid tributary. Alternatively, two functional module expression vectors were constructed: plasmid pACYC-RgTAL-HpaBC, to enhance the supply of caffeic acid precursors; and plasmid pETDuet-HQT-At4CL, to catalyze the generation of caffeoyl-CoA and the chlorogenic acid condensation reaction.
[0043] The method for constructing recombinant Escherichia coli as described above includes the following steps, the order of which can be adjusted except for step S1: S1. Obtain the starting strain Using Escherichia coli BL21(DE3) as the starting strain, electrotransformation competent cells were prepared for subsequent genome editing and plasmid transformation; S2, Knockout of the aroD gene The aroD gene in the genome of the starting strain was knocked out using CRISPR / Cas9, λ-Red homologous recombination or a combination thereof to block the conversion of 3-dehydroquinic acid to 3-dehydroshikimic acid, thus obtaining the E. coli BL21(DE3)ΔaroD strain. S3, Integrated ydiB Expression Box The PproD-ydiB expression cassette was integrated into the yeeL pseudogene site of the E. coli BL21(DE3)ΔaroD strain, so that the endogenous quinic acid / shikimic acid-5-dehydrogenase encoding gene ydiB in E. coli was expressed under the control of the PproD promoter, and an engineered strain capable of enhancing quinic acid production was obtained. S4, integrating aroG fbr Expression Box The strain obtained in step S3 integrates the PproD-aroGfbr expression cassette at the pseudogene locus yjgX in its genome, thereby releasing the feedback-inhibited gene encoding the 3-deoxy-D-arabinohepenolate-7-phosphate synthase aroG. fbr Expression under the control of the PproD promoter to enhance the ingress metabolic flux of the shikimic acid pathway; S5, Integrated PPSA Expression Box The PproD-ppsA expression cassette is integrated into the mbhA site of the genomic pseudogene locus of the strain obtained in step S4, so that the phosphoenolpyruvate synthase encoding gene ppsA is expressed under the control of the PproD promoter, thereby increasing the supply level of phosphoenolpyruvate. S6, Integrated aroB Expression Box The Ptrc-aroB expression cassette is integrated into the yghE pseudogene site of the strain obtained in step S5, so that the 3-dehydroquinic acid synthase encoding gene aroB is expressed under the control of the Ptrc promoter, thereby promoting the conversion of DAHP to 3-dehydroquinic acid. S7, Integrated tktA Expression Box The Ptrc-tktA expression cassette was integrated into the yjiV pseudogene locus of the strain obtained in step S6, enabling the expression of the transketolase I encoding gene tktA under the control of the Ptrc promoter, thereby enhancing the supply of erythrose-4-phosphate; thus, a high-quinic acid flux chassis strain was obtained: E. coli BL21(DE3)ΔaroDyeeL::PproD-ydiB yjgX::PproD-aroG fbr mbhA::PproD-ppsA yghE::Ptrc-aroB yjiV::Ptrc-tktA; S8. Constructing a caffeic acid synthesis and expression module The RgTAL gene from Rhodotorula glutinis and the HpaBC gene from Escherichia coli were cloned into the pACYC-Duet1 vector to construct the plasmid pACYC-RgTAL-HpaBC. RgTAL is used to catalyze the production of p-coumaric acid from L-tyrosine, and HpaBC is used to catalyze the hydroxylation of p-coumaric acid to caffeic acid. S9. Constructing a chlorogenic acid condensation expression module The At4CL gene from Arabianopsis thaliana and the HQT gene from Nicotiana were cloned into the pETDuet-1 vector to construct the plasmid pETDuet-HQT-At4CL. At4CL is used to catalyze the production of caffeic acid from caffeoyl-CoA, and HQT is used to catalyze the condensation of caffeoyl-CoA with quinic acid to produce chlorogenic acid. S10. Obtain the key enzyme mutant. Site-directed mutagenesis was performed on HQT to obtain the combined mutant HQT(R39K / D352E); site-directed mutagenesis was performed on RgTAL to obtain the combined mutant RgTAL(Q115L / N247H); and wild-type HQT and RgTAL in the corresponding plasmids were replaced respectively to obtain expression plasmids containing mutant enzymes: pACYC-RgTAL(Q115L / N247H)-HpaBC and pETDuet-HQT(R39K / D352E)-At4CL; S11, high-quinic acid flux chassis strain The two expression plasmids obtained in step S10 were co-transformed into the high-quinic acid throughput chassis strain obtained in step S7. After resistance screening, colony PCR, plasmid verification and sequencing confirmation, recombinant Escherichia coli containing multi-enzyme mutants for chlorogenic acid production was obtained. S12. Induced expression and verification of chlorogenic acid synthesis ability. The recombinant E. coli obtained in step S11 was inoculated into fermentation medium and cultured. After 4-6 hours of cell growth, 0.1-0.5 mM IPTG was added to induce the expression of RgTAL (Q115L / N247H), HpaBC, At4CL, and HQT (R39K / D352E). During fermentation, the contents of p-coumaric acid, caffeic acid, quinic acid, and chlorogenic acid were detected. Recombinant E. coli that can produce chlorogenic acid efficiently were screened. Among them, the chlorogenic acid yield of the screened recombinant E. coli was not less than 524 mg / L under the condition of 48 h of shake flask fermentation, which was at least 48% higher than that of the non-mutated strain.
[0044] The application of the recombinant *E. coli* as described above in the fermentation production of chlorogenic acid. The method for producing chlorogenic acid using the recombinant *E. coli* as described above includes the following steps: Recombinant *E. coli* was cultured in a fermentation medium containing carbon, nitrogen, and inorganic salts to allow cell growth and expression of the key enzymes. Fermentation was carried out under suitable temperature, pH, dissolved oxygen, and induction conditions. The content of chlorogenic acid and intermediate products such as caffeic acid, p-coumaric acid, and quinic acid was measured during fermentation to evaluate the pathway flux distribution and final product accumulation. The final products and intermediates were qualitatively and quantitatively analyzed by HPLC. This method can be used for the fermentation production of chlorogenic acid under exogenous tyrosine supplementation, and can also be used for screening and evaluating the performance of key nodes and enzymes in the chlorogenic acid synthesis pathway. Figure 1 As shown.
[0045] The relevant culture media in this invention are as follows: Shake-flask seed culture medium: LB liquid medium.
[0046] Shake-flask fermentation medium formulation: D-glucose: 20 g / L, yeast extract: 5-7 g / L, ammonium sulfate ((NH4)2SO4): 7.5 g / L, potassium dihydrogen phosphate (KH2PO4): 2 g / L, dipotassium hydrogen phosphate trihydrate (K2HPO4·3H2O): 3 g / L, magnesium sulfate heptahydrate (MgSO4·7H2O): 1 g / L, sodium chloride (NaCl): 0.5 g / L, citric acid monohydrate: 1.1 g / L, thiamine hydrochloride (Thiamine·HCl): 0.1 g / L, L-ascorbic acid: 0.45 g / L, betaine: 5 g / L (to enhance osmotic tolerance), trace element solution: 1 mL / L, L-tyrosine: 2 g / L, L-phenylalanine: 1 g / L, L-tryptophan: 1 g / L g / L, solvent is water; The formula for the trace element solution is as follows: FeSO4·7H2O: 10 g / L, ZnSO4·7H2O: 2.2 g / L, MnSO4·H2O: 1.54 g / L, CuSO4·5H2O: 1.0 g / L, (NH4)6Mo7O 24 ·4H2O: 0.5 g / L, H3BO3: 0.5 g / L, CoCl2·6H2O: 0.1 g / L, solvent is water.
[0047] A two-stage control method was used: cell growth was promoted at 37°C before induction, and IPTG (0.1–0.5 mM) was added 4–6 hours later to induce enzyme expression, followed by continuous culture at 28°C for 48 hours.
[0048] The key genes, mutants, and plasmid sequences involved in this invention are shown in Table 5, among which aroG fbrThe sequences of RgTAL, At4CL, HQT, HQT(R39K / D352E), RgTAL(Q115L / N247H), pACYC-RgTAL-HpaBC, and pETDuet-HQT-At4CL are shown in SEQ ID NO.1 to SEQ ID NO.8, respectively.
[0049] Specifically, the relevant preparation and testing methods are as follows: Example 1: Construction of high-throughput QA chassis strains.
[0050] 1. Using Escherichia coli BL21(DE3) as the starting strain, gene editing technology was used to knock out the 3-dehydroquinate dehydratase (AroD) gene aroD to block the conversion of 3-dehydroquinic acid to 3-dehydroshikimic acid, resulting in strain QA-01. 2. Using strain QA-01 as the starting strain, gene editing technology was employed to integrate the 3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (DAHP synthase) gene aroG, which had been relieved of negative feedback inhibition, into the pseudogene site yjgX. fbr The strain QA-02 was obtained by starting with the proD promoter. 3. Using strain QA-02 as the starting strain, the phosphoenolpyruvate synthase (PpsA) gene ppsA was integrated into the pseudogene site mbhA using gene editing technology, and the strain was started with the proD promoter to obtain strain QA-03. 4. Using strain QA-03 as the starting strain, the quinate / shikimate dehydrogenase (YdiB) gene was integrated into the pseudogene site yeeL using gene editing technology. The strain was then started with the proD promoter to obtain strain QA-04. 5. Using strain QA-04 as the starting strain, the transketolase A (TktA) gene tktA was integrated into the pseudogene site yjiV using gene editing technology and started with the trc promoter to obtain strain QA-05; 6. Starting with strain QA-05, the 3-dehydroquinate synthase (AroB) gene aroB was integrated into the pseudogene site yghE using gene editing technology and started with the trc promoter to obtain strain QA-06. The integration sites yeeL, yjgX, mbhA, yghE, and yjiV mentioned above are pseudogene sites in the *E. coli* genome that can be used for site-specific integration of exogenous expression cassettes; the integrated aroG fbr Key genes such as ydiB, ppsA, aroB, and tktA are used to enhance the upstream metabolic flux of the shikimic acid pathway and the supply capacity of quinic acid precursors. The key genes and plasmid sequences involved in this invention are shown in Table 5 and SEQ ID NO.1 to SEQ ID NO.8.
[0051] The specific construction method of the engineered bacteria, which uses CRISPR / Cas9 editing technology for gene knockout and integration, includes the following steps: For strain engineering, chromosome deletion or integration is performed on engineered bacteria using the CRISPR-Cas9 system. Here, we take the knockout gene aroD as an example. Using the CRISPR RGEN tool (http: / / www.rgenome.net / cas-designer / ), a pair of primers with 20 bp complementary sequences (gRNA-aroD-S and gRNA-aroD-A listed in Primer Table 5) were designed. Annealing was used to form a gRNA fragment containing the aroD target sequence. Reverse PCR was used to amplify the sgRNA plasmid to obtain a linearized vector fragment. Homologous recombination of the two fragments was then performed to construct a plasmid expressing sgRNA (pEcgRNA-aroD). To prepare the donor DNA fragment for the target gene deletion, two pairs of primers (UP-...) were used... △aroD -S / UP- △aroD -A, DN- △aroD -S / DN- △aroD -A) Amplify the upstream and downstream homologous arms (~300bp each) of the partially deleted ΔaroD gene in the target gene by PCR. Ligate the two homologous arms using overlapping PCR to generate the donor DNA fragment (DNA- △aroD ). pEcgRNA- △aroD and DNA- △aroDThe cells were co-transformed into *E. coli* electroporation competent cells carrying the plasmid pEcCas9 (L-arabinose induces the expression of λ-Red recombinase). After electroporation, the cells were recovered at 37°C and 220 rpm for 2 h (method referenced in *Acta Biochim Biophys Sin*, 2021, 53(5), 620–627 doi:10.1093 / abbs / gmab036). The cells were then plated on LB agar plates containing 50 μg / mL kanamycin sulfate and streptomycin resistance, and incubated at 37°C for 12–16 h. Positive colonies were verified by colony PCR, and DNA sequencing was used to confirm whether the target gene was knocked out. Further analysis was conducted by detecting the loss of pEcgRNA. △aroD Achieving stable aroD The knockout strain, also known as the recombinant strain QA-01 (E. coli), △aroD ).
[0052] The construction process of the aroD knockout fragment and the PCR verification electrophoresis image of the positive clone are shown below. Figure 2 The upstream homologous arm is 480 bp long, the downstream homologous arm is 608 bp long, and the total length of the spliced knockout fragment is 1049 bp. During PCR verification, the amplified band of the positive recombinant strain should be 1049 bp, while the amplified band of the unedited original strain is 1528 bp long; the two are significantly different and can be used for effective differentiation. Figure 2 As shown. The recombinant fragment used for integration consists of upstream and downstream homologous arms of the integration site and the gene fragment to be integrated (upstream homologous arm - target gene - downstream homologous arm). The donor DNA fragment is constructed using overlapping PCR of the two homologous arms and the target gene, and the target gene is integrated into the target site. Using primer design software Primer5, upstream and downstream homologous arm primers (amplification length approximately 300-600 bp) are designed using the upstream and downstream sequences of the gene to be knocked out or the integration site as templates; amplification primers for the integration gene are designed using the gene to be integrated as a template. After amplifying the upstream and downstream homologous arms and the target gene fragment separately by PCR, the recombinant fragment is prepared by overlapping PCR; the recombinant fragment used for knockout consists of upstream and downstream homologous arms of the gene to be knocked out (upstream homologous arm - downstream homologous arm). Other steps are the same as those for aroD gene knockout. The operation methods for the same type of gene in the examples are consistent with this method and will not be described further.
[0053] The PCR amplification system is shown in Table 1: Table 1
[0054] The overlapping PCR amplification system is shown in Table 2: Table 2
[0055] Pre-denaturation (95℃) for 5 min; then perform 30 cycles: denaturation at 98℃ for 10 s, annealing at 55℃ for 15 s, extension at 72℃ (this enzyme activity extends by approximately 1 kb per min), and then begin PCR.
[0056] 7. Perform shake-flask scale culture of strain QA-06. Specifically, pick a single colony of engineered strain QA-06 from a glycerol tube or plate and inoculate it into 3-5 mL of LB liquid medium. Incubate at 37℃ and 220 rpm for 12-16 h as primary seed. Then, transfer the inoculum at a rate of 1-2% to a 500 mL shake flask containing 25-50 mL of LB liquid medium and incubate at 37℃ and 220 rpm for 6-8 h as secondary seed. The secondary seed culture was inoculated at 2% (v / v, volume percentage) into a 500 mL shake flask containing 50 mL of fermentation medium and incubated at 37°C and 220 rpm. When the OD600 reached 0.6–0.8, the culture was transferred to 28°C and incubated for another 48 hours. Samples were then centrifuged, and the quinic acid content was determined by HPLC. For organic acid determination, 1 mL of fermentation broth was centrifuged at 12000 rpm for 2 min. The supernatant was diluted appropriately, and the diluted solution was aspirated into a 1 mL syringe with a 0.22 µm microporous membrane attached to the syringe tip. The first three drops were discarded, and the remaining liquid was filtered and transferred to a HPLC bottle. Finally, the content was determined using HPLC. Chromatographic column conditions: Bio-Rad Aminex HPX-87H column (300 mm × 7.8 mm, 8 μm), elution with 5 mmol / L sulfuric acid buffer, column temperature 30℃, flow rate 0.5 mL / min, differential detector used for quinic acid detection, retention time approximately 10 min. Results showed that strain QA-06 achieved a quinic acid yield of 3.52 g / L under shake-flask fermentation conditions. The HPLC peak of the corresponding fermentation sample showed the same retention time as the quinic acid standard, and the quantitative result calculated from the standard curve was 3.52 g / L, demonstrating that the constructed high-throughput quinic acid chassis has quinic acid accumulation capabilities.
[0057] Example 2: Construction of External Modules First, to introduce the caffeic acid biosynthesis pathway, the tyrosine ammonia lyase (TAL) gene RgTAL from Rhodotorula glutinis was codon-optimized and cloned with the endogenous 4-hydroxyphenylacetate 3-hydroxylase (HpaBC) gene from Escherichia coli BL21(DE3) into the low-copy expression vector pACYC-Duet1 (pACYC-Duet1 is a commercially available plasmid), thus constructing the plasmid pACYC-RgTAL-HpaBC (e.g., ...). Figure 3 As shown in the diagram, it is used to promote the conversion of L-tyrosine to caffeic acid. Specifically: RgTAL catalyzes the formation of p-coumaric acid from L-tyrosine; HpaBC catalyzes the hydroxylation of p-coumaric acid to caffeic acid.
[0058] Simultaneously, the 4-coumarate-CoA ligase (4CL, preferably At4CL) gene and the hydroxycinnamoyl-CoA quinate transferase (HQT) gene, derived from plants, were cloned into the dual expression vector pETDuet-1 to construct the plasmid pETDuet-HQT-At4CL (e.g., ...). Figure 4 (As shown). Among them: At4CL catalyzes the formation of caffeic acid from caffeoyl-CoA; HQT catalyzes the reaction of caffeoyl-CoA with quinic acid to form chlorogenic acid.
[0059] The specific method for constructing the plasmid vector uses seamless cloning and includes the following steps: using an empty vector as a template to amplify the target fragment by PCR, and then using seamless cloning to construct the target plasmid vector after homologous recombination of the target gene fragment with the vector.
[0060] Taking the construction of the pACYC-RgTAL-HpaBC plasmid vector as an example: Primers RgTAL-F / R, HpaBC-F / R, ACYC-RgTAL-F / R, and ACYC-HpaBC-F / R were used to amplify the target fragment. Using the obtained target fragment as a template, primers ACYC-RgTAL-F and RgTAL-R, and ACYC-HpaBC-F and HpaBC-R were used to amplify overlapping fragments. These overlapping fragments underwent homologous recombination in the recombination system and were then transformed into *E. coli* DH5α. Due to the different resistance of pACYC-RgTAL-HpaBC and pETDuet-HQT-At4CL vectors, bacterial cells were plated on LB agar plates containing 25 μg / mL chloramphenicol resistance or 50 μg / mL ampicillin, and incubated at 37℃ for 12-16 h. Positive colonies were verified by colony PCR, and the target vector sequence was further confirmed by plasmid extraction and sequencing.
[0061] The construction steps for the pETDuet-HQT-At4CL plasmid vector are the same as those for the pACYC-RgTAL-HpaBC plasmid vector and will not be described again. The primer sequences used are shown in Table 5. All recombinases used were from the ClonExpress® II OneStep Cloning Kit series. Recombination conditions: 37℃, 30 min. The recombination system is shown in Table 3. Table 3
[0062] The plasmids pACYC-RgTAL-HpaBC and pETDuet-HQT-At4CL were co-transformed into the chassis strain QA-06, and the engineered strain CGA-00 was obtained by screening.
[0063] Single colonies of the engineered strain CGA-00 were picked from glycerol tubes or plates and inoculated into 3-5 mL of LB liquid medium. The culture was incubated at 37°C and 220 rpm for 12–16 h as primary seed culture. Then, a 1-2% inoculum was transferred to a 500 mL shake flask containing 25-50 mL of LB liquid medium and incubated at 37°C and 220 rpm for 6–8 h as secondary seed culture. The secondary seed culture was then inoculated at 2% (v / v) into a 500 mL shake flask containing 50 mL of fermentation medium and incubated at 37°C and 220 rpm for 6 h. After incubation, 0.1 mM IPTG was added to induce expression. The culture temperature was then adjusted to 28°C. At the 12th hour of fermentation, 2 g / L of tyrosine was added to the fermentation medium to bring the cumulative tyrosine content to 4 g / L. After feeding, the culture was maintained at 28°C and 220 rpm until fermentation was complete 48 h after inoculation. After fermentation, the fermentation broth was centrifuged, and the chlorogenic acid content was determined by HPLC. The results showed that the chlorogenic acid yield of the engineered strain CGA-00 reached 298 mg / L under the above shake-flask fermentation conditions.
[0064] Example 3: Obtaining key enzymes HQT and RgTAL mutants and their fermentation production of chlorogenic acid To improve the catalytic efficiency of key enzymes in the chlorogenic acid biosynthesis pathway, this example describes protein engineering modifications of RgTAL and HQT, and evaluates their effects on caffeic acid and chlorogenic acid synthesis. The target mutants were obtained through whole-plasmid amplification, introduced into *E. coli* DH5α competent cells, and plasmids were extracted and sequenced to verify positive transformants.
[0065] The PCR reaction system and amplification conditions are shown in Table 4: Table 4
[0066] Pre-denaturation at 95℃ for 3 min; followed by 30 cycles (95℃ for 15 s, 55℃ for 15 s, 72℃ for 15 s), with an extension at 72℃ for 5 min.
[0067] First, RgTAL is modified by site-directed mutagenesis. For example... Figure 5As shown, based on molecular docking of RgTAL with its ligand tyrosine, alanine scanning was performed on key amino acids to select mutation sites. Using site-directed mutagenesis, the 115th amino acid residue of the RgTAL protein was mutated from glutamine (Q) to leucine (L), obtaining the mutant RgTAL(Q115L); the 247th amino acid residue was mutated from asparagine (N) to histidine (H), obtaining the mutant RgTAL(N247H); further, a double mutant RgTAL(Q115L / N247H) was constructed, yielding the plasmid pACYC-RgTAL(Q115L / N247H)-HpaBC. The nucleotide sequence of the RgTAL double mutant is shown in SEQ ID NO. 6.
[0068] Using plasmid pACYC-RgTAL-HpaBC as a template, recombinant plasmids containing wild-type RgTAL, single mutant RgTAL (Q115L), single mutant RgTAL (N247H), and double mutant RgTAL (Q115L / N247H) were constructed using whole-plasmid PCR. After PCR, the template plasmids were digested with DpnI, and the resulting products were transformed into *E. coli* DH5α competent cells. The cells were plated on LB agar plates containing 25 μg / mL chloramphenicol and incubated at 37°C for 12–16 h. Single colonies were obtained after antibiotic selection and sequenced for verification. After successful verification, the four plasmids were extracted and electroporated into *E. coli* BL21(DE3) to evaluate the effects of different RgTAL mutants on caffeic acid synthesis.
[0069] Single colonies of the engineered strains that were correctly sequenced were inoculated into LB seed medium, and then transferred at a 1–2% inoculation rate to 500 mL shake flasks containing 25–50 mL of LB liquid medium. The cultures were incubated at 37°C and 220 rpm for 6–8 h as secondary seed culture. These were then transferred to fermentation medium at a 1–2% inoculation rate and incubated at 37°C for 6 h. IPTG was then added to a final concentration of 0.1 mM to induce expression. The culture temperature was then adjusted to 28°C. At the 12th h of fermentation, 2 g / L L-tyrosine was added to bring the cumulative tyrosine concentration to 4 g / L. After feeding, the culture conditions were maintained at 28°C and 220 rpm for 48 h post-inoculation until fermentation was complete. After fermentation, the fermentation broth was treated with methanol, centrifuged, and the supernatant was used to determine the caffeic acid yield by HPLC. The results showed that the caffeic acid yield of the control strain containing wild-type RgTAL was 590 mg / L; the caffeic acid yield of the engineered strain containing RgTAL (Q115L) was 623 mg / L, an increase of 5.6% compared to the wild type; the caffeic acid yield of the engineered strain containing RgTAL (N247H) was 615 mg / L, an increase of 4.2% compared to the wild type; and the caffeic acid yield of the engineered strain containing RgTAL (Q115L / N247H) was 689 mg / L, an increase of 16.8% compared to the wild type. These results indicate that the Q115L and N247H sites have a synergistic effect, and the double mutant RgTAL (Q115L / N247H) showed a higher caffeic acid synthesis capacity than either single-site mutant. Therefore, this mutant was selected for subsequent chlorogenic acid synthesis studies. Figure 6 As shown.
[0070] Furthermore, HQT was modified by site-directed mutagenesis. Using site-directed mutagenesis, the 39th amino acid residue of the HQT protein was mutated from arginine (R) to lysine (K), obtaining the mutant HQT(R39K); the 352nd amino acid residue was mutated from aspartic acid (D) to glutamic acid (E), obtaining the mutant HQT(D352E); and a double mutant HQT(R39K / D352E) was further constructed. The nucleotide sequence of the HQT double mutant is shown in SEQ ID NO. 5.
[0071] Using plasmid pETDuet-HQT-At4CL as a template, recombinant plasmids containing wild-type HQT, single mutant HQT (R39K), single mutant HQT (D352E), and double mutant HQT (R39K / D352E) were constructed using whole-plasmid PCR. After PCR, the template plasmid was digested with DpnI, and the resulting product was transformed into *E. coli* DH5α competent cells. The cells were plated on LB agar plates containing 50 μg / mL ampicillin and incubated at 37°C for 12–16 h. Single colonies were obtained after antibiotic selection and sequenced for verification. After verification, four plasmids were extracted and co-electroporated with the plasmid pACYC-RgTAL(Q115L / N247H)-HpaBC containing RgTAL(Q115L / N247H) into the high-quinic acid flux chassis strain QA-06 to construct four engineered strains for chlorogenic acid fermentation production.
[0072] Single colonies of the above-mentioned engineered strain were inoculated into LB seed medium and cultured overnight at 37°C. Then, 1–2% of the inoculum was transferred to 500 mL shake flasks containing 25–50 mL of LB liquid medium and cultured at 37°C and 220 rpm for 6–8 h as secondary seed culture. This secondary seed culture was then transferred to fermentation medium at a 1–2% inoculum and cultured at 37°C for 6 h. IPTG was added to a final concentration of 0.1 mM to induce expression, followed by continued culture at 28°C. Twelve h after inoculation, 2 g / L tyrosine was added to a final concentration of 4 g / L, and the culture was continued at 28°C for 48 h. After fermentation, the fermentation broth was treated with methanol, centrifuged, and the supernatant was used to determine the chlorogenic acid yield by HPLC. The results showed that, in the context of carrying the RgTAL(Q115L / N247H) mutant, the chlorogenic acid yield of the engineered strain containing wild-type HQT was 354 mg / L; the chlorogenic acid yield of the engineered strain containing HQT(R39K) was 362 mg / L, an increase of 2.3% compared to the wild type; the chlorogenic acid yield of the engineered strain containing HQT(D352E) was 427 mg / L, an increase of 20.6% compared to the wild type; and the chlorogenic acid yield of the engineered strain containing HQT(R39K / D352E) was the highest, reaching 524 mg / L, an increase of 48.0% compared to the wild type. Figure 6 As shown. Figure 6 The effect of different mutants on the yield of the target product.
[0073] CGA-00: QA-06 + pACYC-RgTAL-HpaBC + pETDuet-HQT-At4CL, which is a combined engineered strain of wild-type RgTAL and wild-type HQT.
[0074] CGA-01: QA-06 + pACYC-RgTAL(Q115L / N247H)-HpaBC + pETDuet-HQT-At4CL, which is an engineered strain containing RgTAL mutant and wild-type HQT.
[0075] CGA-02: QA-06 + pACYC-RgTAL(Q115L / N247H)-HpaBC + pETDuet-HQT(R39K / D352E)-At4CL, which is a strain containing a double-mutant key enzyme combination of RgTAL mutant and HQT mutant.
[0076] Under the same fermentation conditions, the chlorogenic acid titer of the all-wild-type key enzyme combination engineered strain CGA-00 was 298 mg / L. After replacing the wild-type RgTAL with RgTAL (Q115L / N247H), the chlorogenic acid titer of the resulting engineered strain CGA-01 increased to 354 mg / L, an increase of 18.8% compared to CGA-00. Further, after replacing the wild-type HQT with HQT (R39K / D352E), the chlorogenic acid titer of the resulting engineered strain CGA-02 increased to 524 mg / L, an increase of 48.0% compared to CGA-01 and 75.8% compared to CGA-00. The above results indicate that, under the same chassis strain, the same culture medium, the same induction conditions, and the same fermentation time, the combination of HQT(R39K / D352E) and RgTAL(Q115L / N247H) can significantly improve the efficiency of chlorogenic acid synthesis. The HQT(R39K / D352E) double mutant is not a simple replacement of two single-point mutants, but rather exhibits a significant synergistic effect under the same chassis, the same plasmid configuration, and the same fermentation conditions, which can further improve the efficiency of chlorogenic acid production by the condensation of caffeoyl-CoA and quinic acid. Figure 7 A comparative graph showing the chlorogenic acid production of wild-type key enzyme combination engineered strain CGA-00, RgTAL mutant engineered strain CGA-01, and double mutant key enzyme combination strain CGA-02.
[0077] In summary, this invention has obtained mutants with higher catalytic performance by directionally modifying the key enzymes RgTAL for precursor synthesis and HQT for final product synthesis. RgTAL (Q115L / N247H) can significantly improve the supply capacity of caffeic acid, and HQT (R39K / D352E) can further improve the synthesis efficiency of chlorogenic acid. The combined enhancement effect of the two is beneficial to improving the fermentation yield of chlorogenic acid by engineered bacteria.
[0078] Chinese patent publication CN117645981A discloses tobacco-derived HQT mutants, indicating that some HQT mutants can reduce byproducts and increase chlorogenic acid production. Specifically, P200A, P200M, P200D, A284E, T361D, and P200M / A284E reduce byproducts by 10.6%, 27.2%, 11.2%, 28.3%, 10.5%, and 45.6%, respectively, and increase chlorogenic acid production by 33 mg / L, 62 mg / L, 32 mg / L, 63 mg / L, 35 mg / L, and 88 mg / L, respectively. This prior art demonstrates that HQT mutation is indeed an important direction for improving chlorogenic acid synthesis.
[0079] Compared to existing technologies, this invention does not merely modify the HQT enzyme alone, but simultaneously introduces two mutants, RgTAL (Q115L / N247H) and HQT (R39K / D352E), into the high-quinic acid flux chassis. RgTAL (Q115L / N247H) increases caffeic acid production from 590 mg / L to 689 mg / L, an increase of 16.8%. With fixed expression of RgTAL (Q115L / N247H), HQT (R39K / D352E) further increases chlorogenic acid production from 354 mg / L to 524 mg / L, an increase of 48.0%. Therefore, the advantage of this invention lies in simultaneously enhancing caffeic acid precursor supply and chlorogenic acid terminal condensation reaction, forming a dual-enzyme synergistic modification system of "key enzyme for precursor synthesis + key enzyme for final product synthesis".
[0080] The relevant sequences are as follows: Table 5. Sequence List Used in This Invention
[0081] SEQ ID NO.1: aroG, a key gene mutant of endogenous 3-deoxy-D-arabinohepenolate-7-phosphate synthase in Escherichia coli fbr SEQ ID NO.2:RgTAL SEQ ID NO.3: Arabicopsis thaliana 4CL1 coding sequence GenBank MT134263 SEQ ID NO.4:HQT SEQ ID NO.5: HQT(R39K / D352E) ATGGGAAGTGAAAAATGATGAAAAATTATATCAAGGAATCAACATTAGTAAAACCATCAAACCAAACACCAACAAAAAGACTTTGGAGTTCTAACTTAGATTTAATAGTGGGA AAAATTCATCTTTTAACAGTATATTTCTATAAACCAAATGGATCTTCAAATTTCTTTGATTCAAAAATAATGAAAGAAGCATTAAGTAATGTTCTTGTTTCATTTTACCCAATGGCTGGAAGATTAGCTAGAGATGAACAAGGAAGAATTGAGATAAATTGTAATGGAGAAGGAGTTTTATTTGTTGAAGCTGAAAGTGATGCTTTTGTTGATGATTTTGGTGATTTTACTCCAAGTTTGGAACTTAGGAAACTTATTCCTACTGTTGACACTTCTGGTGATATTTCTACTTTCCCCCTCATCATCTTTCAGGTTACTCGTTTCAAATGTGGTGGAGTTTCACTTGGTGGAGGAGTATTCCACACTTTATCAGATGGTCTCTCATCAATTCACTTCATCAACACATGGTCCGATATAGCCCGAGGCCTCTCCGTCGCCATCCCGCCGTTCATCGACCGGACCCTCCTCCGTGCACGGGACCCACCAACATCGTCTTTCGAGCACGTCGAGTATCATCCTCCTCCATCTCTAATTTCATCATCAAAAAGCTTAGAATCCACTAGCCCAAAGCCTAGTACCACAACCATGTTAAAATTCTCTAGTGACCAACTTGGGCTTCTAAAGTCCAAGTCCAAACATGATGGTAGCACTTACGAAATCCTCGCGGCCCATATTTGGCGTTGCACGTGCAAGGCACGTGCACTGTCCGACGATCAATTGACCAAATTACATGTGGCCACTGATGGTAGGTCTAGGCTTTGCCCTCCTTTGCCACCAGGTTACTTAGGAAATGTTGTGTTCACAGGCACACCTATGGCAAAATCAAGTGAACTTTTACAAGAACCATTGACAAATTCAGCCAAGAGAATTCATAGTGCATTATCAAAAATGGATGACAATTACCTAAGATCAGCTCTCGATTACCTCGAATTACTGCCC GAATTATCGGCTTTAATCCGTGGACCGACGTACTTTGCTAGCCCTAATCTTAATATTAATAGTTGGACTAGATTGCCTGTTCATGATTCAGATTTTGGATGGGGAAGGCCAATTCATATGGGACCAGCTTGCATTTTATATGAAGGGACAGTTTATATATTGCCAAGTCCAAATAGTAAAGATAGGAACTTGCGTTTGGCTGTTTGTTTAGATGCTGATCACATGCCACTATTTGAGAAGTATTTGTATGAATTTTGA SEQ ID NO.6:RgTAL(Q115L / N247H) ATGGCGCCTCGCCCGACTTCGCAAAGCCAGGCCCGCACTTGCCCGACGACGCAGGTTACCCAAGTTGATATCGTTGAGAAAATGTTGGCGGCTCCTACTGATAGCACGCTGGAGCTGGACGGTTATAGCCTGAATCTGGGTGATGTCGTGAGCGCTGCGCGTAAGGGTCGTCCTGTCCGTGTCAAAGATAGCGATGAAATCCGCAGCAAAATCGACAAGAGCGTTGAATTCCTGCGCAGCCAACTGAGCATGTCGGTTTACGGTGTGACGACCGGCTTTGGCGGCTCCGCGGACACGCGCACGGAGGACGCAATTAGCCTGCAAAAGGCGTTGCTGGAACAC CTGCTGTGTGGTGTGTTGCCGAGCAGCTTCGACAGCTTTCGCTTGGGTCGTGGTCTGGAGAATAGCCTGCCGTTGGAAGTCGTTCGCGGTGCAATGACCATTCGTGTGAATTCGCTGACCCGTGGCCATAGCGCTGTTCGTCTGGTTGTTCTGGAAGCACTGACGAACTTTCTGAACCACGGTATTACCCCGATTGTTCCGCTGCGCGGTACGATCTCCGCGAGCGGCGATCTGTCTCCACTGTCGTACATTGCAGCGGCGATTAGCGGTCACCCGGATAGCAAAGTTCACGTGGTCCATGAAGGCAAAGAGAAGATCCTGTACGCGCGCGAAGCGATGGCGCTGTTTAACCTGGAGCCGGTGGTTTTGGGTCCGAAGGAGGGCCTGGGTCTGGTG CAC SEQ ID NO.7: pACYC-RgTAL-HpaBC full plasmid sequence SEQ ID NO.8: pETDuet-HQT-At4CL full plasmid sequence Although embodiments of the invention have been disclosed for illustrative purposes, those skilled in the art will understand that various substitutions, variations, and modifications are possible without departing from the spirit and scope of the invention and the appended claims. Therefore, the scope of the invention is not limited to the contents disclosed in the embodiments.
Claims
1. A recombinant *Escherichia coli* strain containing a multi-enzyme mutant for fermentation to produce chlorogenic acid, characterized in that: The recombinant *E. coli* strain used was *Escherichia coli* BL21(DE3), with the 3-dehydroquinic acid dehydratase encoding gene *aroD* knocked out. The genome then integrated and expressed the quinic acid / shikimate-5-dehydrogenase encoding gene *ydiB* and the feedback-relieved 3-deoxy-D-arabinohepenolate-7-phosphate synthase encoding gene *aroG*. fbr The enzyme expressed the following genes: phosphoenolpyruvate synthase (ppsA), 3-dehydroquinic acid synthase (aroB), and transketolase I (tktA); and expressed the tyrosine ammonia-lyase mutant RgTAL (Q115L / N247H), 4-hydroxyphenylacetic acid-3-hydroxylase HpaBC, 4-coumarate-coenzyme A ligase At4CL, and hydroxycinnamoyl-coenzyme A quinic acid transferase mutant HQT (R39K / D352E). Among them, the aroG fbr The nucleotide sequence of the RgTAL (Q115L / N247H) is shown in SEQ ID NO.1, the nucleotide sequence of the At4CL is shown in SEQ ID NO.3, and the nucleotide sequence of the HQT (R39K / D352E) is shown in SEQ ID NO.
5.
2. The recombinant Escherichia coli according to claim 1, characterized in that: The recombinant *E. coli* strain used *Escherichia coli* BL21(DE3) as the starting strain was first obtained through genome editing to create a high-quinic acid throughput chassis strain. The genome configuration of the chassis strain is as follows: E.coli△aroD yeeL::PproD-ydiB yjgX::PproD- aroG fbr mbhA::PproD-ppsA yghE::Ptrc-aroB yjiV::Ptrc-tktA ; Specifically, the aroD gene was knocked out to block the competitive conversion of 3-dehydroquinic acid to 3-dehydroshikimic acid. Aromatic amino acids or tyrosine were added to the culture medium to ensure the supply of substrates for the caffeic acid pathway. ydiB was expressed under the control of the PproD promoter to promote quinic acid production. aroG... fbr Expression under the control of the PproD promoter enhances DAHP synthesis and relieves feedback inhibition; expression of ppsA under the control of the PproD promoter enhances the supply of phosphoenolpyruvate; expression of aroB under the control of the Ptrc promoter enhances the synthesis of 3-dehydroquinic acid; and expression of tktA under the control of the Ptrc promoter enhances the supply of erythrose-4-phosphate. This improves the upstream metabolic flux of the shikimic acid pathway and the supply capacity of quinic acid precursors. Two chlorogenic acid synthesis expression modules were further introduced into the high-quinic acid throughput chassis strain: The first expression module is pACYC-RgTAL-HpaBC, which contains the tyrosine ammonia-lyase gene RgTAL from Rhodotorula glutinis and the 4-hydroxyphenylacetic acid-3-hydroxylase gene HpaBC from Escherichia coli; RgTAL is used to catalyze the production of p-coumaric acid from L-tyrosine, and HpaBC is used to catalyze the hydroxylation of p-coumaric acid to caffeic acid; The second expression module is pETDuet-HQT-At4CL, which contains the 4-coumaric acid-coenzyme A ligase gene At4CL from Arabianopsis thaliana and the hydroxycinnamoyl-CoA quinic acid transferase gene HQT from Nicotiana; At4CL is used to catalyze the production of caffeic acid from caffeic acid to caffeoyl-CoA, and HQT is used to catalyze the condensation of caffeoyl-CoA with quinic acid to produce chlorogenic acid. Wherein, RgTAL and HQT are mutants modified by protein engineering, RgTAL is RgTAL(Q115L / N247H) and HQT is HQT(R39K / D352E); Finally got: E.coli BL21(DE3)ΔaroD yeeL::PproD-ydiB yjgX::PproD-aroG fbr mbhA::PproD-ppsA yghE::Ptrc-aroB yjiV::Ptrc-tktA carries pACYC-RgTAL(Q115L / N247H)-HpaBC / pETDuet-HQT(R39K / D352E)-At4CL.
3. The recombinant Escherichia coli according to claim 1, characterized in that: The high-quinic acid throughput chassis is based on Escherichia coli BL21(DE3), with overexpression of the E. coli endogenous transketolase I encoding gene tktA; and overexpression of the E. coli endogenous phosphoenolpyruvate synthase encoding gene. ppsA tktA and ppsA are key genes in the biosynthetic center of the shikimate pathway metabolite. Co-expression of these two genes promotes the production of DAHP, the first intermediate in the shikimate pathway. Overexpression of the key gene for endogenous quinic acid / shikimate-5-dehydrogenase in *E. coli* is also crucial. ydiB Overexpression of key genes for endogenous 3-deoxy-D-arabinohepetulose-7-phosphate synthase in Escherichia coli aroG Mutants that relieve feedback inhibition aroG fbr Overexpression of the gene encoding the 3-dehydroquinic acid synthase in the endogenous shikimic acid pathway of Escherichia coli aroB The gene encoding 3-dehydroquinic acid dehydratase is missing. aroD ; Obtain a high-quinic acid flux chassis.
4. The recombinant Escherichia coli according to claim 1, characterized in that: When introducing the key enzyme expression module for chlorogenic acid biosynthesis, the nucleic acid sequence encoding the key enzyme for chlorogenic acid synthesis is introduced into the expression vector and then transferred into the chassis strain; wherein, the key enzyme includes at least RgTAL, which catalyzes the conversion of L-tyrosine to p-coumaric acid, HQT and At4CL, which catalyze the condensation of caffeoyl-CoA with quinic acid to generate chlorogenic acid, and HpaBC, which catalyzes the hydroxylation reaction and promotes the formation of caffeic acid; Alternatively, when combining protein engineering to modify key rate-limiting enzymes, the key rate-limiting enzymes are HQT and RgTAL, which are key rate-limiting enzymes in the chlorogenic acid synthesis process. HQT is mutated at a specific site to obtain the combined mutant HQT (R39K / D352E); RgTAL is mutated at a specific site to obtain the combined mutant RgTAL (Q115L / N247H). The above mutants are used to improve the caffeic acid synthesis capacity and / or chlorogenic acid fermentation titer of the engineered bacteria. Then, a plasmid containing the above two combined mutants is constructed, and the two plasmids are introduced into the recombinant strain to obtain recombinant Escherichia coli containing multi-enzyme mutants for fermentation to produce chlorogenic acid.
5. The recombinant Escherichia coli according to claim 4, characterized in that: Two functional expression vectors were constructed: plasmid pACYC-RgTAL(Q115L / N247H)-HpaBC, which was used to enhance the supply of caffeic acid precursor; and plasmid pETDuet-HQT(R39K / D352E)-At4CL, which was used to catalyze the generation of caffeoyl-CoA and the condensation reaction of chlorogenic acid.
6. The method for constructing recombinant Escherichia coli according to any one of claims 1 to 5, characterized in that: The steps include the following, and the order of the remaining steps, except for step S1, can be adjusted: S1. Obtain the starting strain Using Escherichia coli BL21(DE3) as the starting strain, electrotransformation competent cells were prepared for subsequent genome editing and plasmid transformation; S2, Knockout of the aroD gene The aroD gene in the genome of the starting strain was knocked out using CRISPR / Cas9, λ-Red homologous recombination or a combination thereof, thereby blocking the conversion of 3-dehydroquinic acid to 3-dehydroshikimic acid and obtaining E. coli BL21(DE3)ΔaroD strain. S3, Integrated ydiB Expression Box The PproD-ydiB expression cassette was integrated into the yeeL pseudogene site of the E. coli BL21(DE3)ΔaroD strain, so that the endogenous quinic acid / shikimic acid-5-dehydrogenase encoding gene ydiB in E. coli was expressed under the control of the PproD promoter, and an engineered strain capable of enhancing quinic acid production was obtained. S4, integrating aroG fbr Expression Box The strain obtained in step S3 integrates the PproD-aroGfbr expression cassette at the pseudogene locus yjgX in its genome, thereby releasing the feedback-inhibited gene encoding the 3-deoxy-D-arabinohepenolate-7-phosphate synthase aroG. fbr Expression under the control of the PproD promoter to enhance the ingress metabolic flux of the shikimic acid pathway; S5, Integrated PPSA Expression Box The PproD-ppsA expression cassette is integrated into the mbhA site of the genomic pseudogene locus of the strain obtained in step S4, so that the phosphoenolpyruvate synthase encoding gene ppsA is expressed under the control of the PproD promoter, thereby increasing the supply level of phosphoenolpyruvate. S6, Integrated aroB Expression Box The Ptrc-aroB expression cassette is integrated into the yghE pseudogene site of the strain obtained in step S5, so that the 3-dehydroquinic acid synthase encoding gene aroB is expressed under the control of the Ptrc promoter, thereby promoting the conversion of DAHP to 3-dehydroquinic acid. S7, Integrated tktA Expression Box The Ptrc-tktA expression cassette was integrated into the yjiV pseudogene locus of the strain obtained in step S6, enabling the expression of the transketolase I encoding gene tktA under the control of the Ptrc promoter, thereby enhancing the supply of erythrose-4-phosphate; thus, a high-quinic acid flux chassis strain was obtained: E. coli BL21(DE3)ΔaroDyeeL::PproD-ydiB yjgX::PproD-aroG fbr mbhA::PproD-ppsA yghE::Ptrc-aroB yjiV::Ptrc-tktA; S8. Constructing a caffeic acid synthesis and expression module The RgTAL gene from Rhodotorula glutinis and the HpaBC gene from Escherichia coli were cloned into the pACYC-Duet1 vector to construct the plasmid pACYC-RgTAL-HpaBC. RgTAL is used to catalyze the production of p-coumaric acid from L-tyrosine, and HpaBC is used to catalyze the hydroxylation of p-coumaric acid to caffeic acid. S9. Constructing a chlorogenic acid condensation expression module The At4CL gene from Arabianopsis thaliana and the HQT gene from Nicotiana were cloned into the pETDuet-1 vector to construct the plasmid pETDuet-HQT-At4CL. At4CL is used to catalyze the production of caffeic acid from caffeoyl-CoA, and HQT is used to catalyze the condensation of caffeoyl-CoA with quinic acid to produce chlorogenic acid. S10. Obtain the key enzyme mutant. Site-directed mutagenesis was performed on the HQT to obtain the combined mutant HQT(R39K / D352E); site-directed mutagenesis was performed on the RgTAL to obtain the combined mutant RgTAL(Q115L / N247H); and the wild-type HQT and RgTAL in the corresponding plasmids were replaced respectively to obtain expression plasmids containing mutant enzymes: pACYC-RgTAL(Q115L / N247H)-HpaBC and pETDuet-HQT(R39K / D352E)-At4CL; S11, Transformation of high-quinic acid flux chassis strain The two expression plasmids obtained in step S10 were co-transformed into the high-quinic acid throughput chassis strain obtained in step S7. After resistance screening, colony PCR, plasmid verification and sequencing confirmation, recombinant Escherichia coli containing multi-enzyme mutants for chlorogenic acid production was obtained. S12. Induced expression and verification of chlorogenic acid synthesis ability. The recombinant Escherichia coli obtained in step S11 was inoculated into fermentation medium and cultured. After 4-6 hours of cell growth, 0.1-0.5 mM IPTG was added to induce the expression of RgTAL (Q115L / N247H), HpaBC, At4CL, and HQT (R39K / D352E). During fermentation, the contents of p-coumaric acid, caffeic acid, quinic acid, and chlorogenic acid were detected, and recombinant Escherichia coli that can efficiently produce chlorogenic acid were screened.
7. The application of the recombinant Escherichia coli as described in any one of claims 1 to 5 in the production of chlorogenic acid through fermentation.
8. A method for producing chlorogenic acid by fermentation using recombinant Escherichia coli as described in any one of claims 1 to 5, characterized in that: Includes the following steps: The secondary seed culture of the recombinant Escherichia coli was inoculated into the fermentation medium at the inoculation amount and cultured at 37°C for 6 h. Then, IPTG inducer with a final concentration of 0.1 mM was added to induce expression. Subsequently, the culture temperature was adjusted to 28°C, and L-tyrosine was added at 12 h of fermentation. Culture continued until 48 h after inoculation.
9. The method according to claim 8, characterized in that: Specifically, the steps include the following: Single colonies of recombinant *E. coli* were picked from glycerol tubes or plates and inoculated into 3–5 mL of LB liquid medium. The culture was then incubated at 37°C and 220 rpm for 12–16 h as primary seed culture. A 1–2% inoculum was then transferred to a 500 mL shake flask containing 25–50 mL of LB liquid medium and incubated at 37°C and 220 rpm for 6–8 h as secondary seed culture. The secondary seed culture was then inoculated at 2% (v / v) into a 500 mL shake flask containing 50 mL of shake flask fermentation medium and incubated at 37°C and 220 rpm for 6 h. After incubation, 0.1 mM IPTG was added to induce expression. The culture temperature was then adjusted to 28°C. At 12 h of fermentation, 2 g / L L-tyrosine was added to bring the cumulative tyrosine content to 4 g / L. After feeding, the culture was maintained at 28°C and 220 rpm for 48 h post-inoculation until fermentation was complete.
10. The method according to claim 8 or 9, characterized in that: The fermentation medium formulation is as follows: D-glucose: 20 g / L, yeast extract: 5-7 g / L, ammonium sulfate: 7.5 g / L, potassium dihydrogen phosphate: 2 g / L, dipotassium hydrogen phosphate trihydrate: 3 g / L, magnesium sulfate heptahydrate: 1 g / L, sodium chloride: 0.5 g / L, citric acid monohydrate: 1.1 g / L, thiamine hydrochloride: 0.1 g / L, L-ascorbic acid: 0.45 g / L, betaine: 5 g / L, trace element solution: 1 mL / L, L-tyrosine: 2 g / L, L-phenylalanine: 1 g / L, L-tryptophan: 1 g / L, solvent is water; in, Formula for trace element solution: FeSO4·7H2O: 10 g / L, ZnSO4·7H2O: 2.2 g / L, MnSO4·H2O: 1.54 g / L, CuSO4·5H2O: 1.0 g / L, (NH4)6Mo7O 24 ·4H2O: 0.5 g / L, H3BO3: 0.5 g / L, CoCl2·6H2O: 0.1 g / L, solvent is water.
Citation Information
Patent Citations
Recombinant escherichia coli for producing chlorogenic acid and application
CN116376796A
Engineering bacterium for synthesizing chlorogenic acid and construction method thereof
CN117187283A
Preparation and application of hydroxycinnamyl coenzyme A quinic acid transferase mutant from tobacco
CN117645981A
Recombinant escherichia coli with improved chlorogenic acid production intensity
CN117660274A
Production of chlorogenic and dactylifric acid species
WO2012126789A1