Use of oosp2 protein in in vitro fertilization and culture of cleavage stage embryos

Abstract

The application discloses application of OOSP2 protein in in vitro fertilization and culture of cleavage stage embryos, and belongs to the field of human assisted reproductive technology. The application of human OOSP2 protein or related biological materials thereof includes any one of the following: (1) preparation of a product for promoting fertilization of oocytes; (2) preparation of a product for promoting early embryo development; the related biological materials are nucleic acid molecules capable of expressing the human OOSP2 protein or expression cassettes containing the nucleic acid molecules, recombinant vectors, recombinant bacteria or transgenic cell lines, or substances capable of promoting expression of the human OOSP2 protein and / or increasing activity of the human OOSP2 protein. The application utilizes the human OOSP2 protein, can effectively improve in vitro utilization rate of oocytes, improves the success rate of IVF, and provides a new treatment scheme for infertile patients.

Description

Technical Field

[0001] This invention relates to the field of human assisted reproductive technology, and in particular to the application of OOSP2 protein in in vitro fertilization and cleavage-stage embryo culture. Background Technology

[0002] Although in vitro fertilization (IVF) technology has become a core method for treating infertility, it still faces two major challenges in clinical application: On the one hand, older women generally have low fertilization rates and blastocyst formation rates, as well as increased rates of embryo aneuploidy due to poor oocyte quality; on the other hand, existing commercial culture systems have limited ability to optimize the oocyte microenvironment and cannot effectively improve oocyte utilization.

[0003] OOSP2 protein (oocyte-secreted protein 2), also known as Tmem122 or Plac1l, is a secreted protein that is highly expressed during the maturation of human oocytes (Wagner M, Yoshihara M, Douagi I, Damdimopoulos A, Panula S, Petropoulos S, Lu H, Pettersson K, Palm K, Katayama S, Hovatta O, Kere J, Lanner F, Damdimopoulou P. Single-cell analysis of human ovarian cortex identifies distinct cell populations but nooogonial stem cells. Nat Commun. 2020 Mar 2;11(1):1147.). This protein is 17.971 kDa in size, contains 158 amino acids, and is located on human chromosome 11. Studies have shown that the OOSP2 protein may promote in vitro maturation (IVM) of oocytes by increasing translation efficiency and promoting the expression of proteins related to the small GTPase signaling pathway (Hu W, Zeng H, Shi Y, Zhou C, Huang J, Jia L, Xu S, Feng X, Zeng Y, Xiong T, Huang W, Sun P, Chang Y, Li T, Fang C, Wu K, Cai L, Ni W, Li Y, Yang Z, Zhang QC, Chian R, Chen Z, Liang X, Kee K. Single-cell transcriptome and translateome dual-omics reveals potential mechanisms of human oocyte maturation. Nat Commun. 2022 Aug 30;13(1):5114.). Existing patent CN115873788A discloses the application of human OOSP2 protein in promoting oocyte development, namely, adding recombinant human OOSP2 protein (concentration 150 ng / mL) to oocyte IVM culture medium to improve the maturation rate by promoting germinal follicle rupture and polar body expulsion. However, this patent does not involve the role of human OOSP2 protein in fertilization and early embryonic development.

[0004] There are currently no reports on the role of human-derived OOSP2 in promoting in vitro fertilization and early embryonic development. Summary of the Invention

[0005] To address the shortcomings of existing technologies, this invention provides the application of OOSP2 protein in in vitro fertilization and early embryo culture. This invention extends the application of human OOSP2 protein from the mature stage to the fertilization and early embryonic development stage, effectively and directly optimizing the microenvironment for oocyte fertilization and early embryonic development, thereby promoting in vitro fertilization, improving embryo quality, and increasing the subsequent blastocyst formation rate.

[0006] The technical solution of the present invention is as follows: The first aspect of this invention provides an application of human OOSP2 protein or related biological materials thereof, the application comprising any of the following: (1) Prepare products for promoting egg fertilization; (2) Prepare products for promoting early embryonic development; The relevant biological material is a nucleic acid molecule capable of expressing the human OOSP2 protein or an expression cassette, recombinant vector, recombinant bacteria or transgenic cell line containing the nucleic acid molecule, or a substance capable of promoting the expression of the human OOSP2 protein and / or increasing the activity of the human OOSP2 protein.

[0007] Preferably, the method of promoting egg fertilization includes at least one of the following: increasing sperm penetration rate, reducing polysperm fertilization rate, promoting oocyte activation, and increasing normal fertilization rate.

[0008] Preferably, the early embryo includes a 2-cell stage, a 4-cell stage, a cleavage embryo, a morula, and a blastocyst.

[0009] Preferably, the product is at least one of in vitro fertilization culture medium and cleavage-stage embryo culture medium.

[0010] Preferably, the human OOSP2 protein is any one of the following: a. A protein with an amino acid sequence as shown in SEQ ID No. 1; b. A protein having the same function as the amino acid sequence shown in SEQ ID No. 1, by substitution and / or deletion and / or addition of one or more amino acid residues; c. Proteins that have 99%, 95%, 90%, 85%, or 80% or more of the same amino acid sequence as any of the amino acid sequences specified in ab and have the same function; d. A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of any of the proteins defined in ac.

[0011] Preferably, the nucleic acid molecule capable of expressing the human OOSP2 protein is any of the following DNA molecules: I. The DNA molecule shown in SEQ ID No. 2; II. A DNA molecule that hybridizes under stringent conditions with the DNA molecule defined in I and encodes the human OOSP2 protein; III. A DNA molecule that has 99%, 95%, 90%, 85%, or 80% identity with the DNA sequence defined in I or II and encodes the human OOSP2 protein.

[0012] The second aspect of this invention protects a method for promoting oocyte fertilization in vitro, comprising: placing oocytes in a culture medium containing human OOSP2 protein at a final concentration of 150 ng / mL, and then completing fertilization by sperm-egg co-incubation (IVF) or intracytoplasmic sperm injection (ICSI).

[0013] Preferably, the human OOSP2 protein is any one of the following: a. A protein with an amino acid sequence as shown in SEQ ID No. 1; b. A protein having the same function as the amino acid sequence shown in SEQ ID No. 1, by substitution and / or deletion and / or addition of one or more amino acid residues; c. Proteins that have 99%, 95%, 90%, 85%, or 80% or more of the same amino acid sequence as any of the amino acid sequences specified in ab and have the same function; d. A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of any of the proteins defined in ac.

[0014] The third aspect of this invention protects a method for in vitro culture of early embryos, comprising culturing fertilized eggs in a culture medium containing human OOSP2 protein at a final concentration of 150 ng / mL until the pronuclear stage, and then transferring the embryos to a conventional embryo culture medium without human OOSP2 protein for further culture until the cleavage embryo or blastocyst stage.

[0015] Preferably, the human OOSP2 protein is any one of the following: a. A protein with an amino acid sequence as shown in SEQ ID No. 1; b. A protein having the same function as the amino acid sequence shown in SEQ ID No. 1, by substitution and / or deletion and / or addition of one or more amino acid residues; c. Proteins that have 99%, 95%, 90%, 85%, or 80% or more of the same amino acid sequence as any of the amino acid sequences specified in ab and have the same function; d. A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of any of the proteins defined in ac.

[0016] The beneficial technical effects of this invention are as follows: The novel fertilization medium and cleavage-stage embryo culture medium of this invention effectively improve the in vitro fertilization rate, normal fertilization rate (2PN rate), D3 usable embryo rate, D3 high-quality embryo rate, and blastocyst formation rate, especially showing good results in older women and subjects with poor oocyte quality. Utilizing human-derived OOSP2 protein can effectively improve the in vitro oocyte utilization rate, enhance the success rate of assisted reproductive technologies, and provide a new treatment option for infertile patients. Detailed Implementation

[0017] The present invention will now be described in detail with reference to the embodiments.

[0018] The embodiments provided below are intended as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods, performed according to the techniques or conditions described in the literature or according to the product instructions. Unless otherwise specified, the materials, reagents, etc., used in the following embodiments are commercially available.

[0019] The amino acid sequence of the human OOSP2 protein involved in the following examples is shown in SEQ ID No. 1, and its encoding gene is shown in SEQ ID No. 2.

[0020] SEQ ID No. 1:

[0021] SEQ ID No. 2: atggcgttag aagtcttgat gctcctcgct gtcttgattt ggaccggtgc tgagaacctccatgtgaaaa taagttgctc tctggactgg ttgatggtct cagttatccc agttgcagaa agcagaaatctgtatatatt tgcggatgaa ttacatctgg gaatgggctg ccctgcaaat cggatacata catatgtatatgagtttata tatcttgttc gtgattgtgg catcaggaca agggtagttt ctgaggaaac tctcctttttcaaaccgagc tgtactttac cccaaggaat atagatcatg accctcagga aatccatttg gagtgttccacctctaggaa atcagtgtgg cttacaccag tttctactga gaatgaaata aaattggatc ctagtccttttattgctgac tttcagacaa cagcagaaga gttaggatta ttatcttcta gtccaaactt gctctga A method for promoting oocyte fertilization in vitro includes: placing oocytes in a culture medium containing human OOSP2 protein at a final concentration of 150 ng / mL, and then completing fertilization by sperm-egg co-incubation (IVF) or intracytoplasmic sperm injection (ICSI).

[0022] The culture medium used at this time can be selected from either Vitrolife's G-IVF™ PLUS culture medium containing a final concentration of 150 ng / mL human OOSP2 protein or LifeGlobal fertilization fluid containing a final concentration of 150 ng / mL human OOSP2 protein.

[0023] A method for in vitro culture of early embryos includes: first placing oocytes (or fertilized eggs) after fertilization into a culture medium containing human OOSP2 protein at a final concentration of 150 ng / mL and culturing them to the pronuclear stage; then washing the fertilized eggs and transferring them to a conventional embryo culture medium without human OOSP2 protein and culturing them to the cleavage embryo or blastocyst stage.

[0024] The culture medium used at this time can be selected from any one of the following: Vitrolife's G-IVF™ PLUS culture medium containing a final concentration of 150 ng / mL human OOSP2 protein, Vitrolife's G-1™ PLUS culture medium containing a final concentration of 150 ng / mL human OOSP2 protein, or LifeGlobal one-step culture medium containing a final concentration of 150 ng / mL human OOSP2 protein.

[0025] The standard embryo culture medium can be selected from Vitrolife's G-1™ PLUS medium, G-2™ PLUS medium, or LifeGlobal one-step culture medium.

[0026] Example 1: Human-derived OOSP2 protein promotes oocyte fertilization and early embryonic development I. Experimental Materials and Methods This invention included 37 subjects (all of whom signed informed consent forms). To eliminate heterogeneity among different donors, this invention adopted a self-controlled design, namely: one ovulation induction cycle for the same subject was set as the control group (conventional culture, without the addition of OOSP2 protein), and another ovulation induction cycle was set as the experimental group (OOSP2 protein was added to the culture system). The experimental results of the experimental group and the control group were statistically analyzed and compared.

[0027] (1) In vitro ovulation induction When the dominant follicle reaches a diameter of 18 mm, 10,000 IU of human chorionic gonadotropin (HCG) is injected to promote follicle maturation. Oocyte retrieval is performed 36–38 hours after HCG injection to obtain a mature cumulus-oocyte complex (COC).

[0028] (2) Pre-fertilization culture The COC obtained in step (1) was washed three times with G-IVF™ PLUS medium (purchased from Vitrolife). During the experimental cycle, the COC was transferred to G-IVF™ PLUS medium containing a final concentration of 150 ng / mL human OOSP2 protein. During the control cycle, the COC was transferred to G-IVF™ PLUS medium without OOSP2 protein. The COCs were then incubated at 37°C and 6% CO2 for 2–4 h.

[0029] (3) Fertilization procedure Insemination can be performed using one of the following two techniques: a. IVF fertilization (conventional in-vitro fertilization): In the experimental group, the COC cultured before fertilization in step (2) was co-cultured with capacitated sperm in G-IVF™ PLUS medium containing a final concentration of 150 ng / mL OOSP2. In the control group, the COCs were cultured in G-IVF™ PLUS medium without OOSP2. Fertilized eggs were obtained after culturing at 37℃ and CO2 for 16–18 h.

[0030] b. ICSI fertilization (intracytoplasmic sperm injection): Using standard micromanipulation techniques, a single sperm was directly injected into the cytoplasm of mature oocytes to complete ICSI fertilization. Following ICSI, oocytes in the experimental group were cultured in G-1™ PLUS medium (purchased from Vitrolife) containing a final concentration of 150 ng / mL human OOSP2 protein, while those in the control group were cultured in G-1™ PLUS medium without OOSP2. Fertilized eggs were obtained after 16–18 h of culture at 37°C and 6% CO2.

[0031] (4) Embryo culture The following day, after fertilization, the fertilized eggs obtained in step (3) were washed three times with G-1™ PLUS culture medium that does not contain OOSP2 protein. The fertilized eggs were then transferred to 50–100 μL of fresh G-1™ PLUS culture medium microdroplets and cultured at 37°C and 6% CO2 until cleavage (day 3). Embryos requiring blastocyst culture were transferred to fresh G-2™ PLUS culture medium (purchased from Vitrolife) on day 3 and cultured until day 5–6.

[0032] II. Experimental Results We statistically analyzed and compared various laboratory outcome indicators for the same subject across different stimulation cycles. Statistical indicators included: ICSI MII rate, fertilization rate, 2PN fertilization rate, cleavage rate, 2PN cleavage rate, D3 usable embryo rate, D3 high-quality embryo rate, blastocyst formation rate, usable blastocyst rate, high-quality blastocyst rate, and embryo euploidy rate. We further analyzed the levels of these indicators in older subjects (≥35 years) and younger subjects (<35 years), and the results are shown in Tables 1-4.

[0033] Table 1. Self-comparison before and after ICSI cycle for the same subject (32 cases in total)

[0034] As shown in Table 1, a total of 267 oocytes were obtained in the control group. Among them, 218 were mature oocytes at the MII stage, with a maturation rate (MII rate) of 81.65%. Of these mature oocytes, 133 were fertilized, with a total fertilization rate of 61.01% (133 / 218); 116 were normally fertilized (2PN), with a normal fertilization rate of 53.21% (116 / 218). After fertilization, a total of 121 embryos underwent cleavage, with a total cleavage rate of 90.98% (121 / 133); of these, 110 embryos from 2PN underwent cleavage, with a cleavage rate of 94.83% (110 / 116). By day 3 (D3), the usable embryo rate was 75.20% (91 / 121), and the high-quality embryo rate was 62.73% (69 / 110). During the blastocyst culture stage, 78 embryos were further cultured, of which 46 formed blastocysts, resulting in a blastocyst formation rate of 58.97%. The usable blastocyst rate was 67.39% (31 / 46), and the high-quality blastocyst rate was 41.30% (19 / 46). Chromosome analysis was performed on 22 embryos, revealing 5 euploid embryos, resulting in an euploidy rate of 22.73% (5 / 22).

[0035] In contrast, a total of 295 oocytes were obtained in the experimental group. Among them, 240 were mature oocytes at the MII stage, with a maturation rate (MII rate) of 81.36%, which was basically the same as the control group. Of the mature oocytes, a total of 189 were fertilized, increasing the overall fertilization rate to 78.75% (189 / 240); the number of normally fertilized (2PN) oocytes was 181, significantly increasing the normal fertilization rate to 75.42% (181 / 240), both significantly higher than the control group. After fertilization, the overall cleavage rate reached 98.94% (187 / 189), with the cleavage rate of 2PN embryos reaching 98.90% (179 / 181), also higher than the control group. By day 3 (D3), the usable embryo rate was 80.75% (151 / 187), and the high-quality embryo rate was 66.48% (119 / 179), both better than the control group. During the blastocyst culture stage, 135 embryos were further cultured, of which 104 formed blastocysts, resulting in a blastocyst formation rate of 77.04%, significantly better than the control group. The usable blastocyst rate was 71.15% (74 / 104), and the high-quality blastocyst rate was 50.00% (52 / 104). Chromosome analysis of 29 embryos revealed 13 euploid embryos, significantly increasing the euploidy rate to 44.83% (13 / 29).

[0036] Table 2. Self-comparison before and after IVF cycle for the same subject (5 cases in total)

[0037] Table 3. Self-comparison of ICSI cycles in elderly subjects (≥35 years old) (27 cases in total)

[0038] Table 4. Self-comparison of ICSI cycles in young patients (<35 years old) (10 cases in total)

[0039] As shown in Tables 1-4, this invention, by introducing human OOSP2 protein, significantly improved the fertilization rate of oocytes and the developmental quality of early embryos in subjects with previously low fertilization rates and poor embryo quality, especially showing good results in older women and subjects with poor oocyte quality.

[0040] The above description is merely a preferred embodiment of the present invention, and the present invention is not limited to the above embodiments. It is understood that other improvements and variations that are directly derived or conceived by those skilled in the art without departing from the spirit and concept of the present invention should be considered to be included within the protection scope of the present invention.

Claims

1. The application of human OOSP2 protein or related biomaterials, characterized in that, The application includes any of the following: (1) Prepare products for promoting egg fertilization; (2) Prepare products for promoting early embryonic development; The relevant biological material is a nucleic acid molecule capable of expressing the human OOSP2 protein or an expression cassette, recombinant vector, recombinant bacteria or transgenic cell line containing the nucleic acid molecule, or a substance capable of promoting the expression of the human OOSP2 protein and / or increasing the activity of the human OOSP2 protein.

2. The application according to claim 1, characterized in that, The method of promoting egg fertilization includes at least one of the following: increasing sperm penetration rate, reducing polysperm fertilization rate, promoting oocyte activation, and increasing normal fertilization rate.

3. The application according to claim 1, characterized in that, The early embryos include the 2-cell stage, 4-cell stage, cleavage embryo, morula, and blastocyst.

4. The application according to claim 1, characterized in that, The product is at least one of in vitro fertilization culture medium and cleavage-stage embryo culture medium.

5. The application according to claim 1, characterized in that, The human OOSP2 protein is any one of the following: a. A protein with an amino acid sequence as shown in SEQ ID No. 1; b. A protein having the same function as the amino acid sequence shown in SEQ ID No. 1, by substitution and / or deletion and / or addition of one or more amino acid residues; c. Proteins that have 99%, 95%, 90%, 85%, or 80% or more of the same amino acid sequence as any of the amino acid sequences specified in ab and have the same function; d. A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of any of the proteins defined in ac.

6. The application according to claim 1, characterized in that, The nucleic acid molecule capable of expressing the human OOSP2 protein is any of the following DNA molecules: I. The DNA molecule shown in SEQ ID No. 2; II. A DNA molecule that hybridizes under stringent conditions with the DNA molecule defined in I and encodes the human OOSP2 protein; III. A DNA molecule that has 99%, 95%, 90%, 85%, or 80% identity with the DNA sequence defined in I or II and encodes the human OOSP2 protein.

7. A method for in vitro fertilization of eggs, characterized in that, include: Oocytes were placed in a culture medium containing human OOSP2 protein at a final concentration of 150 ng / mL, and fertilization was completed by sperm-egg co-incubation (IVF) or intracytoplasmic sperm injection (ICSI).

8. The method according to claim 7, characterized in that, The human OOSP2 protein is any one of the following: a. A protein with an amino acid sequence as shown in SEQ ID No. 1; b. A protein having the same function as the amino acid sequence shown in SEQ ID No. 1, by substitution and / or deletion and / or addition of one or more amino acid residues; c. Proteins that have 99%, 95%, 90%, 85%, or 80% or more of the same amino acid sequence as any of the amino acid sequences specified in ab and have the same function; d. A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of any of the proteins defined in ac.

9. A method for in vitro culture of early embryos, characterized in that, include: Fertilized eggs were cultured in a medium containing human OOSP2 protein at a final concentration of 150 ng / mL until the pronuclear stage. The embryos were then transferred to a conventional embryo culture medium without human OOSP2 protein and cultured until the cleavage or blastocyst stage.

10. The method according to claim 9, characterized in that, The human OOSP2 protein is any one of the following: a. A protein with an amino acid sequence as shown in SEQ ID No. 1; b. A protein having the same function as the amino acid sequence shown in SEQ ID No. 1, by substitution and / or deletion and / or addition of one or more amino acid residues; c. Proteins that have 99%, 95%, 90%, 85%, or 80% or more of the same amino acid sequence as any of the amino acid sequences specified in ab and have the same function; d. A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of any of the proteins defined in ac.

Images