Engineered mesenchymal stem cells and uses thereof
Patent Information
- Application Number
- CN202610221051.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-24
- Publication Date
- 2026-08-21
AI Technical Summary
[0007]本发明要解决的技术问题是为了克服现有技术中细胞治疗促血管因子表达不足和基因治疗载体安全性低、转染效率差的缺陷,提供一种工程化的间充质干细胞及其应用
[0032]本发明的积极进步效果在于:本发明通过将编码VEGF-A和bFGF的组合或HGF的modRNA转染至间充质干细胞,显著提升MSC的促血管因子分泌能力,使局部血管生成因子浓度大幅提高,解决了天然MSC自身促血管因子分泌不足的问题,有效促进缺血组织的血管新生和血流恢复。采用经密码子优化的编码序列,进一步提高了mRNA的翻译效率和蛋白表达量,相比野生型序列具有更好的治疗效果。本发明制备的工程化间充质干细胞可用于治疗不适合手术的下肢缺血患者。
Smart Images

Figure CN122609513A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedicine, specifically to an engineered mesenchymal stem cell and its applications. Background Technology
[0002] Peripheral arterial disease (PAD) is one of the most common vascular diseases, characterized by stenosis or occlusion of peripheral arteries, primarily affecting the lower extremities. PAD has long been a global health problem impacting people's lives and quality of life, with a global incidence of 3%–10%, increasing with age. Among these, critical limb ischemia (CLI) is the most severe clinical manifestation of PAD, leading to tissue necrosis, amputation, and even death. Currently, surgical-based bypass grafting and endovascular therapy are the preferred and standard strategies for restoring blood perfusion in PAD patients. However, their application has some limitations: (1) the optimal timing and indications remain controversial; (2) some patients may experience severe postoperative complications; and (3) some patients are not suitable for revascularization. In fact, 20%–40% of CLI patients already have severely damaged blood vessels and cannot undergo surgical treatment, with many requiring amputation to prevent other complications. Therefore, there is an urgent need to seek better treatment strategies.
[0003] In recent years, numerous studies have demonstrated that stem cell transplantation offers new insights into the treatment of ischemic diseases and tissue repair and regeneration. Among these, mesenchymal stem cells (MSCs) are widely used in cell therapy and tissue engineering due to their advantages such as wide availability, ease of culture, and low immunogenicity, improving lower limb ischemia and promoting nerve repair after cerebral infarction. Research on the mechanisms of stem cell action indicates that transplanted cells primarily exert their therapeutic effects through paracrine effects. For example, MSCs can secrete vascular endothelial growth factor (VEGF), fibroblast growth factor (FGF), hepatocyte growth factor (HGF), and interleukin-6, promoting angiogenesis. In addition to soluble factors, studies have shown that extracellular vesicles (EVs) released by stem cells also possess angiogenic capabilities. MSC-EVs, for instance, are rich in various pro-angiogenic microRNAs and proteins, and have been shown to have similar therapeutic effects to MSCs in various ischemic animal models. Although stem cell therapy has achieved positive results in treating ischemic injury and promoting tissue repair and regeneration, there are still technical limitations, particularly the insufficient secretion of pro-angiogenic factors by MSC cells and the lack of disease specificity, which limit its therapeutic effects.
[0004] Gene therapy is also a focal area of research in the treatment of lower limb ischemia (PAD) both domestically and internationally. Currently, there are only two commercially available gene-based PAD treatment strategies. One uses a non-viral supercoiled plasmid encoding VEGF, which was approved in Russia in 2011 and in Ukraine in 2013. The other uses a viral vector encoding hepatocyte growth factor (HGF), which was approved in Japan in 2019, making it the world's first approved HGF gene therapy for treating CLI. However, existing clinical studies show inconsistent efficacy of gene therapy for lower limb ischemia. Due to the failure of single-factor therapy to meet expectations, dual-factor therapy has gradually attracted attention. In addition, various problems with plasmid vectors or virus-mediated methods, such as high cost, complex preparation, and low transfection efficiency, also limit their global application.
[0005] Synthetic chemically modified mRNA (modRNA) involves the chemical modification of in vitro synthesized mRNA at the nucleotide level. Compared to traditional viral or plasmid vectors, it offers unparalleled advantages, enabling rapid, efficient, and pulsed expression of target proteins after entering cells, without the risk of gene integration. This makes modRNA a highly promising novel gene therapy vector in recent years, demonstrating unique advantages in gene editing, tumor immunotherapy, and vaccine development. Furthermore, the 2023 Nobel Prize in Physiology or Medicine was awarded to Professors Katalin Kario and Drew Weissan, pioneers of mRNA modification technology. This technology boasts advantages such as arbitrary sequence design, rapid and remarkable efficacy, pulsed expression, no need for viral vectors, non-nucleus entry, and high safety.
[0006] In summary, mesenchymal stem cells have natural advantages as cell therapy carriers, including wide availability, low immunogenicity, and the ability to secrete pro-angiogenic factors, but the amount of pro-angiogenic factors they secrete is limited. ModRNA, as a gene delivery carrier, has technical advantages such as high-efficiency expression, pulsed release, and high safety, but lacks an effective cell carrier delivery system. Summary of the Invention
[0007] The technical problem to be solved by the present invention is to overcome the shortcomings of insufficient expression of pro-angiogenic factors in cell therapy and low safety and poor transfection efficiency of gene therapy vectors in the prior art, and to provide an engineered mesenchymal stem cell and its application.
[0008] This invention compares the therapeutic effects of AI-VEGFA and AI-bFGF dual-factor modRNA therapy with HGF modRNA therapy. The use of modRNA technology combined with electroporation to transfect mesenchymal stem cells significantly improved transfection efficiency and enhanced protein translation and expression levels. Through systematic evaluation, the selected treatment regimens provide a new therapeutic strategy for improving lower limb ischemia symptoms.
[0009] The present invention solves the above-mentioned technical problems through the following technical solution: A first aspect of the present invention provides an engineered mesenchymal stem cell, the mesenchymal stem cell comprising a modRNA encoding angiogenic factors, wherein the angiogenic factors are selected from: (1) A combination of VEGFA and bFGF, and / or, (2) HGF.
[0010] In some embodiments of the present invention, the mesenchymal stem cells as described in claim 1 are characterized in that the mesenchymal stem cells are selected from mesenchymal stem cells derived from umbilical cord, adipose tissue, bone marrow, or placenta, preferably from human umbilical cord.
[0011] In some embodiments of the present invention, when the angiogenic factor is a combination of VEGFA and bFGF, the mass ratio of VEGFA to bFGF is 1:3 to 3:1, for example, 1:1.
[0012] In some embodiments of the present invention, the starting sequence of the modRNA is selected from one or more of the following: The nucleotide sequence of the VEGFA is as shown in SEQ ID NO: 7 or 8; The nucleotide sequence of the bFGF is as shown in SEQ ID NO: 5 or 6; and, The nucleotide sequence of the HGF is as shown in SEQ ID NO: 9.
[0013] In some embodiments of the present invention, the polynucleotide modification is selected from one or more of the following: pseudouridine modification, N1-methyl-pseudouridine modification, 5-methoxyuridine modification, N1-methyladenosine modification, N6-methyladenosine modification, and 5-methylcytidine modification; the polynucleotide modification is preferably N1-methyl-pseudouridine modification.
[0014] In some embodiments of the present invention, the modRNA further comprises one or more of a 5'-cap structure, a 5'UTR, a 3'UTR, and poly(A).
[0015] In some preferred embodiments of the present invention, the modRNA also satisfies at least one of the following conditions: (i) The 5'UTR contains the nucleotide sequence as described in SEQ ID NO: 1; (ii) The 3'UTR contains the nucleotide sequence as described in SEQ ID NO: 2; (iii) The poly(A) tail is composed of 120-150 adenosine nucleotides, preferably 120; and, (iv) The 5'-cap structure is a Cap1 structure, preferably m7(3'-OMe)Gppp(2'-OMe)ApG.
[0016] A second aspect of the present invention provides an isolated modRNA encoding angiogenesis factors selected from: (1) A combination of VEGFA and bFGF, and / or, (2) HGF.
[0017] In some preferred embodiments of the present invention, the starting sequence of the modRNA is selected from one or more of the following: The nucleotide sequence of the VEGFA is as shown in SEQ ID NO: 7 or 8; The nucleotide sequence of the bFGF is as shown in SEQ ID NO: 5 or 6; and, The nucleotide sequence of the HGF is as shown in SEQ ID NO: 9.
[0018] In some embodiments of the present invention, the polynucleotide modification is selected from one or more of the following: pseudouridine modification, N1-methyl-pseudouridine modification, 5-methoxyuridine modification, N1-methyladenosine modification, N6-methyladenosine modification, and 5-methylcytidine modification; the polynucleotide modification is preferably N1-methyl-pseudouridine modification.
[0019] In some embodiments of the present invention, the modRNA further comprises one or more of a 5'-cap structure, a 5'UTR, a 3'UTR, and poly(A).
[0020] In some preferred embodiments of the present invention, the modRNA also satisfies at least one of the following conditions: (i) The 5'UTR contains the nucleotide sequence as described in SEQ ID NO: 1; (ii) The 3'UTR contains the nucleotide sequence as described in SEQ ID NO: 2; (iii) The poly(A) tail is composed of 120-150 adenosine nucleotides, preferably 120; and, (iv) The 5'-cap structure is a Cap1 structure, preferably m7(3'-OMe)Gppp(2'-OMe)ApG.
[0021] A third aspect of the present invention provides a method for preparing mesenchymal stem cells as described in the first aspect of the present invention, the method comprising transfecting the modRNA into the mesenchymal stem cells, culturing and harvesting the transfected mesenchymal stem cells.
[0022] In some preferred embodiments of the present invention, the transfection is liposome transfection, nanoparticle-mediated transfection, particle bombardment, microinjection, or electroporation.
[0023] In some more preferred embodiments of the present invention, the transfection is more preferably electroporation.
[0024] A fourth aspect of the present invention provides a pharmaceutical composition comprising mesenchymal stem cells as described in the first aspect of the present invention or modRNA as described in the second aspect of the present invention, and pharmaceutically acceptable carriers and / or excipients.
[0025] The fifth aspect of the present invention provides the use of mesenchymal stem cells as described in the first aspect of the present invention, modRNA as described in the second aspect of the present invention, or pharmaceutical compositions as described in the fourth aspect of the present invention in the preparation of a medicament for promoting angiogenesis.
[0026] In some embodiments of the present invention, the drug is used to treat ischemic diseases.
[0027] In some embodiments of the present invention, the ischemic disease is lower limb ischemia.
[0028] In some embodiments of the present invention, the lower limb ischemia is chronic lower limb ischemia or acute lower limb ischemia.
[0029] In some embodiments of the present invention, the chronic lower limb ischemia is chronic limb-threatening ischemia.
[0030] Based on common knowledge in the field, the above-mentioned preferred conditions can be combined arbitrarily to obtain various preferred embodiments of the present invention.
[0031] The reagents and raw materials used in this invention are all commercially available.
[0032] The significant advantages of this invention are as follows: By transfecting mesenchymal stem cells (MSCs) with modRNA encoding a combination of VEGF-A and bFGF or HGF, the invention significantly enhances the secretion capacity of pro-angiogenic factors by MSCs, resulting in a substantial increase in local angiogenic factor concentrations. This addresses the problem of insufficient secretion of pro-angiogenic factors by natural MSCs, effectively promoting angiogenesis and blood flow restoration in ischemic tissues. The use of codon-optimized coding sequences further improves mRNA translation efficiency and protein expression levels, resulting in better therapeutic effects compared to wild-type sequences. The engineered mesenchymal stem cells prepared by this invention can be used to treat lower limb ischemia patients who are unsuitable for surgery. Attached Figure Description
[0033] Figure 1Preparation and identification of modRNAs. A: Gel electrophoresis analysis of the plasmid, enzyme digestion products, and PCR products of modGFP (left), and modRNA purity test results (right); B: Gel electrophoresis analysis of the plasmid, enzyme digestion products, and PCR products of modHGF (left), and modRNA purity test results (right); C: Gel electrophoresis analysis of the plasmid, enzyme digestion products, and PCR products of modbFGF (left), and modRNA purity test results (right); D: Gel electrophoresis analysis of the plasmid, enzyme digestion products, and PCR products of modVEGFA (left), and modRNA purity test results (right).
[0034] Figure 2 The electrotransfection efficiency and fluorescence expression of GFP modRNA in hMSCs are shown in Figure 1. A: Fluorescence observation under an inverted microscope (bar=200 µm) at 24 h, 48 h, 72 h, 96 h, and 120 h after GFP modRNA electrotransfection into hMSCs; B: Flow cytometry quantitative analysis of the electrotransfection efficiency of GFP modRNA 24 h after electrotransfection into hMSCs; C: Trend of average fluorescence intensity at different time points after GFP modRNA electrotransfection into hMSCs. The blank control group is the cell group without GFP modRNA.
[0035] Figure 3 This section describes the protein secretion of hMSCs after electroporation with HGF modRNA. A: Dynamic changes in HGF protein in the supernatant culture medium after HGF modRNA electroporation into hMSCs; B: Total amount of HGF protein secreted cumulatively after HGF modRNA electroporation into hMSCs. : P <0.0001.
[0036] Figure 4 The following describes the protein secretion of hMSCs after electroporation with AI-bFGF modRNA. A: Dynamic changes in bFGF protein in the supernatant culture medium after electroporation with AI-bFGF modRNA into hMSCs; B: Total amount of bFGF protein secreted cumulatively after electroporation with AI-bFGF modRNA into hMSCs. : P <0.05; : P <0.0001; ns: P >0.05.
[0037] Figure 5 The protein secretion of hMSCs after electroporation with AI-VEGFA modRNA, and the amount of VEGFA protein in the supernatant culture medium 24 h after electroporation with AI-VEGFA modRNA into hMSCs. : P <0.0001.
[0038] Figure 6 The effect of modRNA electroporation into hMSCs on the migration of HUVECs in conditioned medium. A: Images of HUVEC migration promoted by cell supernatant from different modRNA electroporation groups (bar=250 µm); B: Percentage of wound healing at 12 h; C: Percentage of wound healing at 24 h; The negative control group was the Luciferase modRNA treatment group; : P <0.05; : P <0.01; : P <0.001; : P <0.0001.
[0039] Figure 7 The following data show the effect of conditioned medium on HUVECs forming tubular structures after modRNA electroporation into hMSCs. A: Cell supernatant from different modRNA electroporation groups promotes the formation of tubular structures in HUVECs (bar=250 µm); B: Statistical count of the number of branch nodes in tubular structures; C: Statistical count of the total length of branches in tubular structures; : P <0.05; the negative control group was the Luciferase modRNA treatment group; : P <0.01; : P <0.001; : P <0.0001.
[0040] Figure 8 The effect of modRNA electrotransfection into hMSCs on SMC proliferation in conditioned medium. A: Images of SMC proliferation promoted by cell supernatant in different modRNA electrotransfection groups (bar=50 µm); B: Statistical analysis of EdU-labeled cell proliferation percentage; the negative control group was the Luciferase modRNA treatment group; : P <0.05; : P <0.0001.
[0041] Figure 9This study illustrates the bioluminescence expression kinetics of cells in hMSCs after electroporation of modRNA. A: Bioluminescence imaging of cells in different modRNA electroporation groups after labeling with Dil dye; B: Time progression of expression kinetics in cells in different modRNA electroporation groups after labeling with Dil dye; C: Total photon flux statistics of different modRNA electroporation groups on day 14; The negative control group was the Luciferase modRNA treatment group. P < 0.05; P < 0.01.
[0042] Figure 10 Gross images and HE staining of tissue samples taken from subcutaneous angiogenesis experiments after modRNA electroporation into hMSCs; gross view (left) and HE staining (right) of tissue samples taken one week after matrix thrombus implantation (bar=100 µm); the negative control group was the Luciferase modRNA treatment group.
[0043] Figure 11 This study investigated the effect of modRNA electroporation into hMSCs on promoting subcutaneous angiogenesis. A: CD31 / α-SMA staining image (bar=50 µm) 1 week after matrix gel embolization; B: Vessel density statistics 1 week after matrix gel embolization; C: Mature vessel density statistics 1 week after matrix gel embolization; The negative control group was the Luciferase modRNA treatment group. : P <0.05; : P <0.01; : P <0.001.
[0044] Figure 12 Gross appearance of mouse hind limbs and hind limb necrosis score after modRNA electroporation into hMSCs. A: Gross appearance of mouse hind limbs at various time points; B: Limb necrosis rate on day 14; C: Tissue necrosis score on day 14; The negative control group was the Luciferase modRNA treatment group.
[0045] Figure 13 To assess the effect of modRNA electroporation into hMSCs on the recovery of blood flow in the lower limbs of mice. A: Laser Doppler blood flow imaging of the plantar retina (ROI); B: Laser Doppler perfusion assessment (ischemic side / non-ischemic side); C: Laser Doppler perfusion statistics on day 14; The negative control group was the Luciferase modRNA treatment group; : P <0.001; : P <0.0001.
[0046] Figure 14 This image shows the gross observation of the gastrocnemius muscle in the hind limb of mice after electroporation of modRNA into hMSCs. A: Gross observation of the gastrocnemius muscle on day 14; B: Percentage of gastrocnemius muscle weight (ischemic side / non-ischemic side); The negative control group was the Luciferase modRNA treatment group; ns: P >0.05.
[0047] Figure 15 To illustrate the necrosis of ischemic hind limb tissue in mice after modRNA electroporation into hMSCs, HE staining of gastrocnemius muscle tissue was performed (bar=50 µm); the negative control group was the Luciferase modRNA treatment group.
[0048] Figure 16 The extent of fibrosis in ischemic hind limb tissue of mice after electroporation of modRNA into hMSCs. A: Masson staining of gastrocnemius muscle tissue (bar=100 µm); B: Percentage of fibrotic area in gastrocnemius muscle tissue; The negative control group was the Luciferase modRNA treatment group; : P <0.05; : P <0.01; : P <0.0001.
[0049] Figure 17 Histological evaluation of angiogenesis in ischemic hindlimbs after electroporation of modRNA into hMSCs. A: CD31 / α-SMA immunofluorescence staining (bar=100 µm); B: Vessel density statistics; C: Mature vessel density statistics; The negative control group was the Luciferase modRNA treatment group; : P <0.01; : P <0.001; : P <0.0001.
[0050] Figure 18 Histological evaluation of apoptosis in ischemic hindlimb cells after modRNA electroporation into hMSCs. A: TUNEL immunofluorescence staining (bar=100 µm); B: TUNEL + Cell count / mm 2 The negative control group was the Luciferase modRNA treatment group; : P <0.0001.
[0051] Figure 19Gross images of various mouse organs and HE staining results. A: Gross view of various mouse organs; B: HE staining of various mouse organs (bar=100 µm); The negative control group was the Luciferase modRNA treatment group.
[0052] Figure 20 This is a schematic diagram illustrating the preparation and application process of engineered mesenchymal stem cells according to the present invention. Detailed Implementation
[0053] In this disclosure, unless otherwise stated, scientific and technical terms used herein have meanings commonly understood by those skilled in the art. Furthermore, the procedures used herein, such as molecular genetics, nucleic acid chemistry, chemistry, molecular biology, biochemistry, cell culture, microbiology, cell biology, genomics, and recombinant DNA, are all standard procedures widely used in their respective fields. To better understand this disclosure, definitions and explanations of relevant terms are provided below: The term "mesenchymal stem cells" (MSCs) refers to a type of adult stem cell with multipotent differentiation potential, capable of differentiating into various cell types such as osteoblasts, chondrocytes, and adipocytes. MSCs can be obtained from a variety of tissue sources, including but not limited to bone marrow, adipose tissue, umbilical cord, placenta, and dental pulp. MSCs are characterized by low immunogenicity, ease of in vitro culture and expansion, homing ability, and paracrine function, making them widely used in cell therapy and tissue engineering.
[0054] The term "umbilical cord-derived mesenchymal stem cells" or "human umbilical cord mesenchymal stem cells" (hUC-MSCs) refers to mesenchymal stem cells isolated and cultured from human umbilical cord tissue (such as Wharton's jelly). Compared to mesenchymal stem cells from other sources, umbilical cord mesenchymal stem cells have advantages such as strong proliferative capacity, low immunogenicity, lack of ethical controversy, and ease of acquisition.
[0055] The term "mRNA" or "messenger RNA" refers to ribonucleic acid molecules that act as carriers of genetic information in cells, transmitting genetic information from DNA to ribosomes for protein synthesis. Mature eukaryotic mRNA typically includes a 5' cap, a 5' untranslated region (5'UTR), an open reading frame (ORF), a 3' untranslated region (3'UTR), and a poly(A) tail.
[0056] The term "chemically modified mRNA" or "modRNA" refers to mRNA synthesized in vitro through chemical modification of nucleotides to improve its stability, reduce immunogenicity, and enhance translation efficiency. Common chemical modifications include pseudouridine (Ψ) modification, N1-methylpseudouridine (m1Ψ) modification, 5-methoxyuridine (5 molU) modification, and N6-methyladenosine (m6A) modification. In this invention, the chemically modified mRNA primarily employs N1-methylpseudouridine as a substitute for uridine.
[0057] The term "angiogenic factors" or "pro-angiogenic factors" refers to bioactive molecules that can promote the formation of new blood vessels or the regeneration of existing blood vessels. They mainly include the vascular endothelial growth factor (VEGF) family, the fibroblast growth factor (FGF) family, and hepatocyte growth factor (HGF). The angiogenesis factors involved in this invention include: "VEGFA" or "Vascular Endothelial Growth Factor A," a major member of the VEGF family and one of the most potent pro-angiogenic factors, which promotes endothelial cell proliferation, migration, and increased vascular permeability by binding to VEGF receptors (mainly VEGFR-2) on the surface of endothelial cells; "bFGF" or "basic Fibroblast Growth Factor" (also known as FGF-2), which, by binding to FGF receptors, not only promotes endothelial cell proliferation and new blood vessel formation but also promotes smooth muscle cell proliferation and vascular maturation; and "HGF" or "Hepatocyte Growth Factor," a multifunctional growth factor that exerts functions such as promoting angiogenesis, tissue regeneration, anti-apoptosis, and anti-fibrosis by binding to its receptor c-Met. The "combination of VEGF-A and bFGF" or "dual-factor combination" refers to a treatment strategy that uses VEGF-A and bFGF simultaneously. VEGF-A mainly promotes capillary formation, while bFGF promotes the recruitment of pericytes and smooth muscle cells to form mature and stable blood vessels. The combined use of the two has a synergistic effect and has a better angiogenesis effect compared to single-factor therapy.
[0058] The term "ischemic disease" refers to a group of diseases caused by insufficient blood supply to tissues or organs, including lower limb ischemia, myocardial ischemia, cerebral ischemia, renal ischemia, and intestinal ischemia. Ischemia can be caused by atherosclerosis, thromboembolism, vasospasm, or other reasons, leading to tissue hypoxia, metabolic disorders, and in severe cases, tissue necrosis and organ failure.
[0059] The term "lower limb ischemia" refers to a pathological condition caused by insufficient blood supply to the lower limb tissues, which can be divided into acute and chronic types. Chronic lower limb ischemia is mainly caused by "peripheral arterial disease" (PAD). PAD refers to the narrowing, occlusion, or dysfunction of peripheral arteries (mainly lower limb arteries), usually caused by atherosclerosis. Clinical manifestations include asymptomatic, intermittent claudication, rest pain, ulcers, or gangrene. The severity is assessed using the Fontaine staging (stages I-IV) or the Rutherford classification (grades 0-6). "Critical Limb Ischemia" (CLI) or "Chronic Limb-Threatening Ischemia" (CLTI) refers to the most severe clinical manifestation of PAD, usually defined as persistent rest pain (>2 weeks) or ischemic ulcer / gangrene, accompanied by ankle artery pressure <50 mmHg or toe artery pressure <30 mmHg, equivalent to Fontaine stage III-IV or Rutherford stage 4-6. Without timely treatment, it faces a high rate of amputation and mortality. CLI and CLTI are used interchangeably in clinical practice. CLTI is an updated concept of CLI, emphasizing the chronic nature of the disease and its limb-threatening nature.
[0060] The term "promoting angiogenesis" refers to the process of stimulating the formation of new blood vessels through biological, pharmacological, or cell therapy methods, with the aim of improving blood perfusion in ischemic tissues and promoting tissue repair and functional recovery.
[0061] The term "treatment" refers to any relief or beneficial change to a disease, symptom, or pathological state, including but not limited to: preventing the onset or progression of disease, alleviating symptoms, improving pathophysiological parameters, promoting tissue repair, and improving quality of life. In the treatment of lower limb ischemia, therapeutic effects may include: improving blood perfusion, reducing amputation rates, relieving rest pain, improving intermittent claudication, promoting ulcer healing, and increasing walking distance.
[0062] The terms "pharmaceutically acceptable carrier" or "pharmaceuticalally acceptable excipient" refer to components in a pharmaceutical composition other than the active ingredient, which are non-toxic and physiologically acceptable to the subject at the dosage and concentration used. Pharmaceutically acceptable carriers include, but are not limited to: solvents (such as water, physiological saline, Ringer's solution), buffers, isotonic agents, stabilizers, preservatives, cryoprotectants, etc.
[0063] The present invention is further illustrated below by way of embodiments, but the invention is not limited to the scope of the embodiments described herein. Experimental methods in the following embodiments that do not specify specific conditions were performed according to conventional methods and conditions, or as selected according to the product instructions.
[0064] Example
[0065] 1. Materials and Methods
[0066] 1.1 Cell Culture
[0067] Human umbilical cord-derived mesenchymal stromal cells (hMSCs) were derived from umbilical cord specimens collected from newborn infants at delivery. hMSCs were cultured in DMEM / F-12 medium (Hyclone, USA) supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin antibiotics. All cells were incubated at 37°C in a humidified environment with 5% CO2 and passaged when cell confluence reached 80% to 90%. Cells were used in all experiments at passages 3 to 5.
[0068] 1.2 Synthesis and Formulation of modRNA
[0069] modRNAs are synthesized in vitro via T7 RNA polymerase-mediated transcription, using linearized DNA as a template. During in vitro transcription, all uracil is replaced by N1-methylpseudouridine. The RNA was first purified using an Ambion MEGA clear spin column, followed by treatment with Antarctic phosphatase (New England Biolabs) to remove residual 5'-phosphate. The purity and concentration of the modRNA were determined using a NanoDrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA), and the modRNA was resuspended at a concentration of 2 µg / µL for subsequent use.
[0070] The chemically modified mRNA (modRNA) used in this invention comprises, from the 5' end to the 3' end, the following structures in sequence: a 5' cap structure (CAP3111, i.e., Cap 1 AG trimer: m7(3'-OMe)G(5')ppp(5')(2'-OMe)ApG), a 5' untranslated region (5'UTR), a coding region, a 3' untranslated region (3'UTR), and a poly(A) tail (120 adenosine nucleotides).
[0071] mRNA 5'UTR nucleotide sequence: AGGAAUAAACUAGUAUUCUUCUGGUCCCCACAGACUCAGAGAGAACCCGCCACC (SEQ ID NO: 1) 3'UTR nucleotide sequence: UGGCGCGCCUGCAGGAGCGCUGCCUUCUGCGGGGCUUGCCUUCUGGCCAUGCCCUUCUUCUCUCCCUUGCACCUGUACCUCUUGGUCUUUGAAUAAAGCCUGAGUAGGAAG (SEQ ID NO: 2) Coding region sequence: GFP: AUGGUGAGCAAGGGCGAGGAGCUGUUCACCGGGGUGGUGCCCAUCCUGGUCGAGCUGGACGGCGACGUAAACGGCCACAAGUUCAGCGUGUCCGGCGAGGGCGAGGGCGAUGCCACCUACGGCAAGCUGACCCUGAAGUUCAUCUGCACCACCGGCAAGCUGCCCGUGCCCUGGCCCACCCUCGUGACCACCCUGACCUACGGCGUGCAGUGCUUCAGCCGCUACCCCGACCACAUGAAGCAGCACGACUUCUUCAAGUCCGCCAUGCCCGAAGGCUACGUCCAGGAGCGCACCAUCUUCUUCAAGGACGACGGCAACUACAAGACCCGCGCCGAGGUGAAGUUCGAGGGCGACACCCUGGUGAACCGCAUCGAGCUGAAGGGCAUCGACUUCAAGGAGGACGGCAACAUCCUGGGGCACAAGCUGGAGUACAACUACAACAGCCACAACGUCUAUAUCAUGGCCGACAAGCAGAAGAACGGCAUCAAGGUGAACUUCAAGAUCCGCCACAACAUCGAGGACGGCAGCGUGCAGCUCGCCGACCACUACCAGCAGAACACCCCCAUCGGCGACGGCCCCGUGCUGCUGCCCGACAACCACUACCUGAGCACCCAGUCCGCCCUGAGCAAAGACCCCAACGAGAAGCGCGAUCACAUGGUCCUGCUGGAGUUCGUGACCGCCGCCGGGAUCACUCUCGGCAUGGACGAGCUGUACAAGUAA (SEQ ID NO: 3) Luciferase: bFGF original sequence (bFGF): AUGGCAGCCGGGAGCAUCACCACGCUGCCCGCCUUGCCCGAGGAUGGCGGCAGCGGCGCCUUCCCGCCCGGCCACUUCAAGGACCCCAAGCGGCUGUACUGCAAAAACGGGGGCUUCUUCCUGCGCAUCCACCCCGACGGCCGAGUUGACGGGGUCCGGGAGAAGAGCGACCCUCACAUCAAGCUACAACUUCAAGCAGAAGAGAGAGGAGUUGUGUCUAUCAAAGGAGUGUGUGCUAACCGUUACCUGGCUAUGAAGGAAGAUGGAAGAUUACUGGCUUCUAAAUGUGUUACGGAUGAGUGUUUCUUUUUUGAACGAUUGGAAUCUAAUAACUACAAUACUUACCGGUCAAGGAAAUACACCAGUUGGUAUGUGGCACUGAAACGAACUGGGCAGUAUAAACUUGGAUCCAAAACAGGACCUGGGCAGAAAGCUAUACUUUUUCUUCCAAUGUCUGCUAAGAGCUGA (SEQ ID NO: 5) bFGF sequence after codon optimization (AI-bFGF): AUGGCCGCCGGCAGCAUCACCACGCUGCCCGCUUUGCCUGAGGACGGCGGCAGCGGCGCCUUUCCACCCGGCCAUUUUAAGGAUCCGAAGAGGCUGUACUGCAAGAACGGCGGCUUCUUCUUGAGGAUCCACCCUGAUGGCCGGGUGGAUGGCGUGCGGGAGAAGAGCGACCCGCACAUCAAGCUGCAGCUGCAGGCCGAGGAGCGGGGCGUGGUGAGCAUUAAAGGCGUGUGCGCCAACCGGUAUCUGGCCAUGAAGGAGGACGGCCGGUUGCUGGCCAGCAAGUGCGUGACCGACGAGUGUUUCUUCUUCGAGCGGCUGGAGAGCAACAAUUACAACACCUACCGCUCCCGGAAGUACACCAGCUGGUACGUGGCACUGAAGCGGACCGGCCAGUACAAGCUGGGCAGCAAGACCGGCCCCGGCCAGAAGGCCAUUCUCUUCCUGCCUAUGUCUGCUAAGAGUUGA (SEQ ID NO: 6) VEGFA original sequence (VEGFA): AUGAACUUUCUGCUGUCUUGGGUGCAUUGGAGCCUUGCCUUGCUGCUCUACCUCCACCAUGCCAAGUGGUCCCAGGCUGCACCCAUGGCAGAAGGAGGAGGGCAGAAUCAUCACGAAGUGGUGAAGUUCAUGGAUGUCUAUCAGCGCAGCUACUGCCAUCCAAUCGAGACCCUGGUGGACAUCUUCCAGGAGUACCCUGAUGAGAUCGAGUACAUCUUCAAGCCAUCCUGUGUGCCCCUGAUGCGAUGCGGGGGCUGCUGCAAUGACGAGGGCCUGGAGUGUGUGCCCACUGAGGAGUCCAACAUCACCAUGCAGAUUAUGCGGAUCAAACCUCACCAAGGCCAGCACAUAGGAGAGAUGAGCUUCCUACAGCACAACAAAUGUGAAUGCAGACCAAAGAAAGAUAGAGCAAGACAAGAAAAUCCCUGUGGGCCUUGCUCAGAGCGGAGAAAGCAUUUGUUUGUACAAGAUCCGCAGACGUGUAAAUGUUCCUGCAAAAACACAGACUCGCGUUGCAAGGCGAGGCAGCUUGAGUUAAACGAACGUACUUGCAGAUGUGACAAGCCGAGGCGGUGA(SEQ ID NO: 7) The sequence of VEGFA after codon optimization (AI-VEGFA): AUGAACUUCCUGCUGAGCUGGGUGCACUGGAGCCUGGCCCUGCUGCUGUACCUGCACCACGCCAAGUGGAGCCAGGCCGCCCCCAUGGCCGAGGGCGGGGGGCAGAACCACCACGAGGUGGUGAAGUUCAUGGACGUGUACCAGCGCAGCUACUGCCACCCCAUCGAGACGCUGGUGGACAUCUUCCAGGAGUACCCGGACGAGAUCGAGUACAUCUUCAAGCCCAGCUGCGUGCCGCUGAUGCGCUGCGGGGGCUGCUGCAACGACGAGGGCCUGGAGUGCGUGCCCACCGAGGAGAGCAACAUCACCAUGCAGAUCAUGCGCAUCAAGCCGCACCAGGGCCAGCACAUCGGCGAGAUGUCCUUCCUGCAGCACAACAAGUGCGAGUGCCGGCCCAAGAAGGACCGGGCCCGGCAGGAGAACCCCUGCGGCCCGUGCUCCGAGCGGCGGAAGCACCUCUUCGUGCAGGACCCGCAGACCUGCAAGUGCUCCUGCAAGAACACCGACAGCCGCUGCAAGGCCCGGCAGCUGGAGCUGAACGAGCGGACCUGCCGCUGCGACAAGCCGCGGCGCUGA (SEQ ID NO: 8) HGF original sequence: 1.3 Electroporation and Evaluation of modRNA modRNA was introduced into hMSCs using a cell electroporation system (MaxCyte, USA). In the in vitro electroporation method, cells and modRNA were mixed with a specific electroporation buffer and added to an electroporation cuvette. Electroporation was performed using the cell electroporation system, followed by incubation at 37°C for 20 min, and then seeded into six-well plates. 2 µg of modRNA was mixed with the electroporation buffer and electroporated 2 × 10⁶ cells / well. 5 hMSCs were collected. Digested cells were analyzed using a CytoFLEX LX flow cytometer (Beckman Coulter, CA, USA) at 24 h, 48 h, 72 h, 96 h, and 120 h after electrotransfection to evaluate electrotransfection efficiency and average fluorescence intensity.
[0072] 20 μg of GFP modRNA was electrotransfected into hMSCs, incubated at 37°C for 20 min, and then injected intramuscularly into the gastrocnemius muscle. Samples were collected 24 h after electrotransfection to observe the expression of GFP modRNA.
[0073] To collect hMSCs conditioned medium, after electroporation, the cells were cultured in DMEM / F-12 medium supplemented with 2% FBS for 24 h.
[0074] 1.4 Enzyme-linked immunosorbent assay (ELISA)
[0075] The expression dynamics of Luciferase modRNA, HGF, AI-bFGF, and AI-VEGFA, or bFGF and VEGFA, in electroporated hMSCs were quantitatively detected using an HGF, bFGF, and VEGFA ELISA kit (MultiSciences, China). Conditioned culture medium was collected at 24 h, 48 h, and 72 h post-electropy to analyze the protein expression levels of HGF or AI-optimized bFGF, and the protein expression of AI-optimized VEGFA at 24 h.
[0076] 1.5 Tube Formation Experiment
[0077] Matrigel (Corning, USA) was evenly spread in confocal culture dishes at a rate of 150 µL / dish under ice bath conditions, and then incubated at 37°C for 30 min. Human umbilical vein endothelial cells (HUVECs) were then cultured at a rate of 3.5 × 10⁻⁶. 4Cells were seeded at a density of 1 cell / dish in confocal culture dishes and cultured in the medium with the conditions described above. During the experiment, cell morphology changes were observed every 2 hours using a fluorescence inverted microscope (DMI3000 B, Leica, Germany), and three regions were randomly selected for analysis of node number and length using ImageJ software. All tests were repeated three times.
[0078] 1.6 Scratch Test
[0079] Press Human Umbilical Vein Endothelial Cells (HUVECs) 5×10 5 Cells were seeded at a density of 1 cell per well in 6-well plates. When the cell density reached 90%, the wound was scraped with the tip of a 200 µL pipette, the culture medium was aspirated, and the scraped cells were washed with PBS. hMSCs culture media containing different modRNAs were added, and cell migration was observed and photographed at 6 h, 12 h, and 24 h under a fluorescence inverted microscope (DMI3000 B, Leica, Germany).
[0080] 1.7 Proliferation Experiment
[0081] Smooth muscle cells (SMCs) were 1×10 4 Seeds were planted at a density of 100 cells / well in 96-well plates, and cultured for 24 h with the culture medium as described above. The plates were then processed using a Click-It EdU-594 kit (Servicebio, China), and images were acquired by placing the 96-well plates under a laser scanning confocal microscope (TSC SP8, Leica, Germany).
[0082] 1.8 In vivo Matrigel Plug test
[0083] Male BALB / c nude mice (8 weeks old) were purchased from Shanghai Jihui Laboratory Animal Co., Ltd. (Shanghai, China). All animal experiments were reviewed and approved by the Laboratory Animal Management Committee of Shanghai Children's Medical Center, affiliated with Shanghai Jiao Tong University School of Medicine. Nine nude mice were randomly divided into three groups (n=3). Animals were inoculated with hMSCs pretreated with Luciferase modRNA (negative control group); or with hMSCs pretreated with HGF modRNA (single-factor group); or with hMSCs pretreated with AI-bFGF and AI-VEGFA modRNA (two-factor group). 400 µL of Matrigel (Corning, USA) was mixed with 100 µL of hMSCs (100 µL containing 2×10⁻⁶ mc²⁻¹). 6After mixing (20 µg modRNAs), the mixture was subcutaneously injected into the dorsal side of mice to simulate the environment in which cells secrete the target protein in vivo. Both the negative control group and the single-factor group received 20 µg modRNA for 2 × 10⁻⁶ cells. 6 Cells, the dual-factor group consisted of 20 µg bFGF modRNA and 20 µg bFGF modRNA for 2 × 10⁶ cells. 6 One cell. Seven days after implantation, Matrigel plugs were harvested for histological evaluation.
[0084] 1.9 Hindlimb Ischemia Model
[0085] Thirty-two nude mice were randomly divided into four groups (n=8): the PBS group (model control group), the negative control group, the single-factor group, and the two-factor group. After anesthesia with inhaled isoflurane (2-3%), a 1 cm skin incision was made in the right inguinal region. The subcutaneous fascia and adipose tissue were meticulously dissected to fully expose the proximal saphenous artery and the distal femoral artery. The saphenous artery and femoral artery were then freed and double-ligated. The vessels were transected between the two ligation points. Two injections (20 µL / point) of cell suspension were administered intramuscularly at the transected ends, and one injection (60 µL / point) of cell suspension was administered intramuscularly in the ischemic gastrocnemius muscle, for a total of 100 µL. Finally, the skin incision was sutured. The mice were monitored daily, and on postoperative day 14, the animals were sacrificed, and the ischemic gastrocnemius muscle was harvested for histological observation.
[0086] 1.10 Bioluminescence Imaging
[0087] Transplanted hMSCs were bioluminescently imaged using a small animal in vivo bioluminescence imaging system. Fourteen nude mice were randomly divided into four groups (n=3 / 3 / 4 / 4): model control group, negative control group, single-factor group, and dual-factor group. After electroporation, cells were co-incubated with PBS containing dye Dil (Meilun Bio, China) for 10 min. Cells were then injected intramuscularly with 100 µL of cell suspension (containing 2×10⁶ cells / mL). 6 Bioluminescence values were quantified by measuring total photon flux (photons per second) in the ischemic hind limb of mice and images were acquired at 1, 2, 3, 4, 5, 7, 10 and 14 days post-transplantation.
[0088] 1.11 Tissue necrosis score and blood flow analysis
[0089] As previously stated, the tissue necrosis score was: 0, limb salvage; 1, loss of 1-2 toes; 2, loss of 3-5 toes; 3, foot necrosis; 4, severe limb loss. Blood flow imaging was performed using a moorFLPI-2 blood flow imaging system (Moor Instruments, Axminster, UK). Blood flow was recorded on day 1 (before ligation) and at postoperative days 0, 3, 7, and 14. The plantar region was selected as the region of interest for blood flow imaging analysis. Statistical analysis was performed using moorFLPI ReviewV60 software (Moor Instruments, Axminster, UK). Data are presented as the ischemic to non-ischemic perfusion ratio.
[0090] 1.12 Histological evaluation
[0091] The gastrocnemius muscle was embedded in paraffin and cut into 5 µm sections. Hematoxylin-eosin staining (Solarbio, China) and Masson staining (Solarbio, China) were performed according to standard procedures. The fibrosis area was analyzed using ImageJ software.
[0092] Staining was performed using a one-step TUNEL apoptosis detection kit (Servicebio, China), following the manufacturer's instructions. In short, tissue sections were first hydrated with xylene and ethanol solutions of varying concentrations, followed by labeling with TUNEL staining reagent. Finally, the sections were stained with DAPI (Yeasen, China) and images were acquired using a laser scanning confocal microscope (TSC SP8, Leica, Germany).
[0093] For immunofluorescence, sections were subjected to antigen retrieval using citrate buffer (Yeasen, China), followed by infiltration with 0.2% Triton X-100 (Beyotime, China) and blocking with 5% bovine serum albumin (Hyclone, USA). The sections were then incubated overnight with primary antibody at 4°C, followed by incubation with secondary antibody at RT for 2 h, and finally stained with DAPI. The antibodies used in this study included CD31 (ab182981; Abcam, UK), α-SMA (ab7817; abcam, UK), Alexa Fluor 488 goat anti-rabbit (ab181448; Abcam, UK), and Alexa Fluor 555 goat anti-mouse (ab150106; Abcam, UK). Photomicrography was performed using a laser scanning confocal microscope (TSC SP8, Leica, Germany).
[0094] 1.13 Biosafety
[0095] Twelve BALB / c mice were randomly divided into four groups (n=3): a model control group, a negative control group, a single-factor group, and a two-factor group. After hindlimb ischemia modeling, the mice were injected with PBS or hMSCs carrying modRNA suspension. Fourteen days post-surgery, the animals were sacrificed, and the heart, liver, spleen, lungs, and kidneys of each group were harvested after cardiac perfusion for gross observation and further hematoxylin-eosin staining.
[0096] 1.14 Statistical Analysis
[0097] Results are expressed as mean ± standard deviation. The Shapiro-Wilk test was used to test the normality of the data. Differences between groups were assessed by one-way ANOVA combined with the Bonferroni post-hoc test (GraphPad Software, San Diego, CA, USA). P Differences with values less than 0.05 are considered statistically significant.
[0098] 2. Results
[0099] 2.1 Preparation, identification, and protein expression of modRNA
[0100] Linearized plasmids were obtained by digesting GFP, HGF, AI-bFGF, and AI-VEGFA plasmids with enzymes. The sequences of GFP, HGF, AI-bFGF, and AI-VEGFA were then amplified using specific primers and identified by agarose gel electrophoresis. After confirming that the PCR products were single and correctly positioned, in vitro transcription and purification were performed to obtain the target modRNAs. Finally, the concentration and purity of the prepared modRNAs were determined using NanoDrop2000. The results showed that all four modRNAs were successfully prepared with high purity. Figure 1 (AD).
[0101] When hMSCs reached 70-80% fusion, GFP modRNA was introduced into the cells via electroporation. Fluorescence inverted microscopy revealed that most cells effectively expressed green fluorescent protein (GFP) at all time points. Figure 2 (A). After 24 h, flow cytometry analysis showed that the electrotransfection efficiency was as high as 90.20% ± 1.179% (A). Figure 2 Further analysis of protein expression levels at different time points revealed that the average fluorescence intensity of GFP peaked at 24 h, then gradually decreased, but could be expressed for more than 120 h. Figure 2 (C). These results demonstrate that GFP modRNA can achieve rapid and efficient expression of the target protein.
[0102] Luciferase modRNA (Luc control group), HGF modRNA (HGF experimental group), AI-bFGF modRNA (AI-bFGF group), and AI-VEGFA modRNA (AI-VEGFA group) or bFGF modRNA (bFGF group) and VEGFA modRNA (VEGFA group) were introduced into hMSCs via electroporation. The secretion levels of HGF protein or AI-bFGF protein and AI-VEGFA protein at different time points were detected by ELISA. The results showed that after electroporation of modRNA into hMSCs, cells rapidly expressed the target protein, with expression levels reaching a peak at 24 hours. HGF modRNA or AI-bFGF modRNA could be secreted continuously for more than three days. Figure 3 , Figure 4 It is worth mentioning that the expression level of AI-VEGFA in just 24 hours far exceeded the combined expression levels of HGF modRNA or AI-bFGF modRNA over three days. Figure 5 These data confirm that modRNA can be successfully introduced into hMSCs via electroporation, achieving efficient, rapid, and pulsed expression of the target protein.
[0103] 2.2 Electroporation of hMSCs with single-factor group (HGF modRNA) and dual-factor group (AI-bFGF and AI-VEGFA modRNA) promoted cell function.
[0104] To verify whether the target protein secreted by hMSCs loaded with AI-bFGF and AI-VEGFA modRNA (two-factor group) is more biologically active than that loaded with HGF modRNA (single-factor group), cell supernatants were collected and co-cultured with HUVECs or SMCs, respectively.
[0105] In the scratch test ( Figure 6 Both the single-factor and two-factor groups significantly promoted the migration ability of HUVECs compared to the negative control group, regardless of the 12-hour or 24-hour migration rate. The two-factor group, in particular, demonstrated the strongest promotion of HUVEC migration. The statistical results of the migration rates at 12 hours (54.70±1.067%) and 24 hours (63.41±0.928%) in the two-factor group further confirmed this promoting effect. Figure 6 (BC).
[0106] A similar trend was observed in tube forming experiments. Figure 7Compared to the negative control group, the single-factor group and the two-factor group significantly promoted the formation of tubular structures in HUVECs. Both the number of branch nodes and the total branch length were significantly higher in the single-factor group than in the negative control group. Furthermore, the two-factor group formed more branch nodes (122.20±14.03) and a longer total branch length (14975±929.60 px). Figure 7 (BC), to promote the best tube effect.
[0107] In addition, EdU test results showed ( Figure 8 Although the single-factor group showed a significantly greater effect on promoting cell proliferation compared to the negative control group, the two-factor group showed a more significant effect on promoting cell proliferation (9.206±1.365%), and SMCs under culture conditions exhibited stronger proliferative capacity. Figure 8 B).
[0108] The above results fully demonstrate that the target proteins secreted by hMSCs after loading AI-bFGF and AI-VEGFA modRNA or HGF modRNA have good biological activity.
[0109] 2.3 Electroporation of hMSCs with single-factor group (HGF modRNA) and dual-factor group (AI-bFGF and AI-VEGFA modRNA) effectively promoted cell survival.
[0110] To track and compare the in vivo survival of hMSCs transplanted with modRNA, hMSCs were electrotransfected with modRNA and then co-incubated with PBS containing dye Dil. Cell viability was monitored by in vivo bioluminescence imaging in small animals after intramuscular injection. The results of in vivo bioluminescence imaging in small animals showed (…). Figure 9 (AB), hMSCs carrying modRNA, after intramuscular injection, showed fluorescent signals for nearly 14 days. It is worth noting that in the single-factor group and the two-factor group, the fluorescence quantification statistics on day 14 showed ( Figure 9 The C group showed a higher fluorescence signal compared to the negative control group, indicating that the single-factor group and the double-factor group had better cell survival after transplantation.
[0111] 2.4 Electroporation of hMSCs with single-factor group (HGF modRNA) and two-factor group (AI-bFGF and AI-VEGFA modRNA) promoted subcutaneous angiogenesis.
[0112] To investigate whether hMSCs loaded with AI-bFGF and AI-VEGFA modRNAs can promote angiogenesis in vivo better than hMSCs loaded with HGF modRNAs, this invention uses a BALB / c mouse femoral artery ligation model (lower limb ischemia mouse model). See also Figure 20 The engineered mesenchymal stem cells prepared in section 2.1 were used to treat a lower limb ischemia model. The prepared cell suspension was mixed with Matrigel and injected subcutaneously. One week later, the cells were harvested and stained. As shown in the gross view (…). Figure 10 In the negative control group, the matrix plugs were colorless and transparent with almost no blood vessel attachment; in the single-factor and dual-factor groups, the matrix plugs were reddish with obvious blood vessel growth, indicating good vascularization. HE staining results showed that the single-factor and dual-factor groups had significantly more luminal structures than the negative control group, and both were accompanied by increased cell density. The degree of vascularization was assessed by CD31 / α-SMA staining, and the staining results showed that ( Figure 11 (A) In both the single-factor and dual-factor groups, angiogenesis was significantly increased, with the dual-factor group showing thicker regenerated vessel walls and more intact vessels. Further quantitative analysis also confirmed this conclusion. Figure 11 Regarding BC density, the dual-factor group was significantly higher than the negative control group and the single-factor group; however, in terms of the number of new blood vessels in intact vessel walls, the dual-factor group (23.11±3.672 / mm²) had the highest density. 2 The result was also significantly better than the negative control group (8.222±1.171 cells / mm). 2 ) and single-factor groups (16.00±2.186 cases / mm) 2 The above results suggest that hMSCs loaded with AI-bFGF and AI-VEGFA modRNA, or loaded with HGF modRNA, can effectively promote angiogenesis and restore local blood flow reperfusion.
[0113] 2.5 Electroporation of hMSCs in the single-factor group (HGF modRNA) and the two-factor group (AI-bFGF and AI-VEGFA modRNA) promoted the recovery of blood flow in the lower limbs of mice.
[0114] To evaluate whether hMSCs loaded with AI-bFGF and AI-VEGFA modRNA are more effective than hMSCs loaded with HGF modRNA in treating ischemic diseases, a mouse hind limb ischemia model was established, and the mice were treated via local intramuscular injection. Images of the mouse hind limbs were recorded at various time points. Figure 12 Compared to the negative control group and the single-factor group, the dual-factor group was more effective in protecting against toe injuries or loss caused by ischemia, and had a better cure rate. Figure 12 Group B had a significantly lower limb necrosis score than other groups ( Figure 12 C). Furthermore, laser Doppler flow imaging results showed ( Figure 13Compared with the PBS group and the negative control group, the single-factor group and the dual-factor group showed better limb blood flow reperfusion recovery. The laser Doppler blood flow perfusion statistics on day 14 showed that (AB). Figure 13 The single-factor group (39.68±4.072%) showed better blood flow reperfusion performance than the negative control group (26.79±3.521%), but the dual-factor group (50.71±5.216%) showed the most significant effect in promoting blood flow reperfusion. These results indicate that treatment with hMSCs loaded with AI-bFGF and AI-VEGFA modRNA, or loaded with HGF modRNA, can alleviate lower limb ischemic injury and promote blood flow recovery.
[0115] 2.6 Electroporation of hMSCs in the single-factor group (HGF modRNA) and the two-factor group (AI-bFGF and AI-VEGFA modRNA) reduced hind limb ischemia in mice.
[0116] By harvesting, photographing, and staining gastrocnemius muscle tissue from a BALB / c mouse model of lower limb ischemia, this study further evaluated whether hMSCs loaded with AI-bFGF and AI-VEGFA modRNA could more effectively alleviate lower limb ischemia injury. Gross images and weight percentage statistics of the gastrocnemius muscle on day 14 showed (…). Figure 14 The weight of the gastrocnemius muscle on the ischemic side was less than that on the non-ischemic side (AB), indicating that ischemia is usually accompanied by muscle atrophy. Although the statistical results were not statistically significant, the single-factor group and the two-factor group showed a better trend in protecting muscle tissue from atrophy. HE staining results showed ( Figure 15 The muscle tissue structure in the model control group and the negative control group was severely damaged, with a large number of inflammatory cells infiltrating. The two-factor group showed significantly better results than the single-factor group. The group possessed a more intact tissue structure and a lower degree of necrosis. Furthermore, Masson staining results showed ( Figure 16 The degree of fibrosis in the two-factor group (AB) was significantly lower than that in the negative control group and the single-factor group. These results indicate that treatment with hMSCs loaded with AI-bFGF and AI-VEGFA modRNA, or loaded with HGF modRNA, can effectively protect against ischemic tissue damage.
[0117] 2.7 Electroporation of hMSCs with single-factor group (HGF modRNA) and dual-factor group (AI-bFGF and AI-VEGFA modRNA) promoted angiogenesis and anti-apoptosis in mouse hind limbs.
[0118] To compare the angiogenesis-promoting and anti-apoptotic effects of hMSCs loaded with AI-bFGF and AI-VEGFA modRNA versus hMSCs loaded with HGF modRNA, gastrocnemius muscle tissue from the ischemic side of BALB / c mice was obtained on day 14 post-surgery. The degree of vascularization was analyzed by CD31 / α-SMA immunofluorescence co-staining, and the anti-apoptotic effect was detected by TUNEL staining. The CD31 / α-SMA double-labeling results showed ( Figure 17 Compared with the negative control group and the single-factor group, the dual-factor group significantly promoted angiogenesis, and the formed vascular structures were more complete and the vessel wall thickness was increased, indicating higher vascular maturity. Quantitative analysis further confirmed (A). Figure 17 In terms of angiogenesis density, the dual-factor group was significantly higher than the negative control group and the single-factor group; similarly, in the count of new blood vessels in intact vessel walls, the dual-factor group (50.85±11.02 vessels / mm²) had the highest density. 2 Both were significantly better than the negative control (16.30±2.926 cells / mm). 2 ) and single factor Group (34.90±6.536 pieces / mm) 2 The two-factor group showed a significant advantage in both vascular density and mature vascular density. TUNEL staining results showed ( Figure 18 AB), two-factor group (17.03±2.50 pieces / mm) 2 ) and single-factor group (20.29±3.862 / mm) 2 Compared with the negative control group (31.76±1.679 cells / mm), 2 The apoptosis rate of hMSCs was significantly reduced, but there was no significant difference between the two-factor group and the single-factor group. In conclusion, hMSCs loaded with AI-bFGF and AI-VEGFA modRNA, or loaded with HGF modRNA, not only effectively promoted local tissue angiogenesis and maturation, but also had a significant anti-apoptotic effect.
[0119] 2.8 ModRNA electroporation into hMSCs demonstrates biosafety.
[0120] Finally, to assess the biosafety of modRNA electroporation into hMSCs followed by intramuscular injection into the gastrocnemius muscle in mice, heart, liver, spleen, lung, and kidney tissues were collected from mice in each group 14 days later. Gross images and HE staining results showed that ( Figure 19 Whether injected with PBS or with hMSCs-loaded modRNA cell suspension, no histological changes were observed in the heart, liver, spleen, lungs, and kidneys, indicating that modRNA electroporation into hMSCs did not cause damage to any organs in vivo and demonstrated biosafety.
Claims
1. An engineered mesenchymal stem cell, characterized in that, The mesenchymal stem cells include modRNA encoding angiogenic factors, wherein the angiogenic factors are selected from: (1) A combination of VEGFA and bFGF, and / or, (2) HGF.
2. The mesenchymal stem cells as described in claim 1, characterized in that, The mesenchymal stem cells are selected from mesenchymal stem cells derived from umbilical cord, adipose tissue, bone marrow, or placenta, preferably from human umbilical cord. And / or, when the angiogenic factor is a combination of VEGFA and bFGF, the mass ratio of VEGFA to bFGF is 1:3 to 3:
1.
3. The mesenchymal stem cells as described in claim 1 or 2, characterized in that, The starting sequence of the modRNA is selected from one or more of the following: The nucleotide sequence of the VEGFA is shown in SEQ ID NO: 7 or 8; The nucleotide sequence of the bFGF is shown in SEQ ID NO: 5 or 6; and, The nucleotide sequence of the HGF is shown in SEQ ID NO: 9; Preferably, the modRNA has one or more of the following modifications on its starting sequence: pseudouridine modification, N1-methyl-pseudouridine modification, 5-methoxyuridine modification, N1-methyladenosine modification, N6-methyladenosine modification, and 5-methylcytidine modification; preferably, all uracil in the starting sequence is replaced by N1-methyl-pseudouridine.
4. The mesenchymal stem cells according to any one of claims 1-3, characterized in that, The modRNA also includes one or more of the following: a 5'-cap structure, a 5'UTR, a 3'UTR, and poly(A); Preferably, the modRNA also satisfies at least one of the following conditions: (i) The 5'UTR contains a nucleotide sequence as shown in SEQ ID NO: 1; (ii) The 3'UTR comprises a nucleotide sequence as shown in SEQ ID NO: 2; and, (iii) The poly(A) tail is composed of 120-150 adenosine nucleotides; (iv) The 5'-cap structure is a Cap1 structure, preferably m7(3'-OMe)Gppp(2'-OMe)ApG.
5. An isolated modRNA, characterized in that, The modRNA encodes angiogenesis factors, which are selected from: (1) A combination of VEGFA and bFGF, and / or, (2) HGF.
6. The modRNA as described in claim 5, characterized in that, The starting sequence of the modRNA is selected from one or more of the following: The nucleotide sequence of the VEGFA is shown in SEQ ID NO: 7 or 8; The nucleotide sequence of the bFGF is shown in SEQ ID NO: 5 or 6; and, The nucleotide sequence of the HGF is shown in SEQ ID NO: 9; Preferably, the modRNA has one or more of the following modifications on its starting sequence: pseudouridine modification, N1-methyl-pseudouridine modification, 5-methoxyuridine modification, N1-methyladenosine modification, N6-methyladenosine modification, and 5-methylcytidine modification; preferably, all uracil in the starting sequence is replaced by N1-methyl-pseudouridine.
7. The modRNA as described in claim 5 or 6, characterized in that, The modRNA also includes one or more of the following: a 5'-cap structure, a 5'UTR, a 3'UTR, and poly(A); Preferably, the modRNA also satisfies at least one of the following conditions: (i) The 5'UTR contains the nucleotide sequence as described in SEQ ID NO: 1; (ii) The 3'UTR contains the nucleotide sequence as described in SEQ ID NO: 2; (iii) The poly(A) tail is composed of 120-150 adenosine nucleotides; and, (iv) The 5'-cap structure is a Cap1 structure, preferably m7(3'-OMe)Gppp(2'-OMe)ApG.
8. A method for preparing mesenchymal stem cells as described in any one of claims 1-4, characterized in that, The method includes transfecting the modRNA into the mesenchymal stem cells, culturing and harvesting the transfected mesenchymal stem cells; the transfection is preferably liposome transfection, nanoparticle-mediated, particle bombardment, microinjection or electroporation, more preferably electroporation.
9. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises mesenchymal stem cells as described in any one of claims 1-4 or modRNA as described in any one of claims 5-7, and pharmaceutically acceptable carriers and / or excipients.
10. The use of the mesenchymal stem cells as described in any one of claims 1-4, the modRNA as described in any one of claims 5-7, or the pharmaceutical composition as described in claim 9 in the preparation of a medicament for promoting angiogenesis; preferably, the medicament is used to treat ischemic diseases.
11. The application as described in claim 10, characterized in that, The ischemic disease mentioned is lower limb ischemia; Preferably, the lower limb ischemia is chronic lower limb ischemia or acute lower limb ischemia; The chronic lower limb ischemia is, for example, chronic limb-threatening ischemia.