Yak myoblast cells with overexpressed ddx6 gene and enhanced hypoxic proliferation and application thereof

Abstract

The application belongs to the field of plateau livestock biotechnology and gene expression regulation cell engineering technology, and discloses a yak myoblast cell with overexpressed DDX6 gene and enhanced hypoxic proliferation capacity and application thereof. The application clones a complete coding sequence (CDS region) of yak DEAD-box helicase 6 (DDX6) gene, constructs a lentivirus overexpression vector and a short hairpin RNA (shRNA) interference vector targeting the DDX6 gene, optimizes lentivirus transduction core parameters of yak embryonic myoblast cells, constructs yak myoblast cell stable strains with overexpressed and interfered DDX6 gene, simultaneously establishes a standard cobalt chloride-induced yak myoblast cell hypoxic model, and finally determines the regulation effect of DDX6 on the cell cycle and proliferation of yak myoblast cells in a hypoxic environment through multi-dimensional function verification. The obtained yak myoblast cell with overexpressed DDX6 gene can stably relieve hypoxic-induced G1 phase cycle arrest and significantly restore and improve the cell proliferation capacity. The application is beneficial to molecular marker assisted breeding of yak meat production traits, gene editing of fine breed cultivation, and can significantly shorten the breeding cycle of yak fine breeds.

Description

Technical Field

[0001] This invention belongs to the fields of plateau animal husbandry biotechnology and gene expression regulation cell engineering technology, specifically involving a yak myoblast that overexpresses the DDX6 gene to enhance its hypoxia proliferation capacity and its application. Background Technology

[0002] Skeletal muscle is the core tissue that determines the meat production performance of livestock. Its growth and development during the embryonic period directly determines the number of muscle fibers and the final meat production capacity of adult individuals. The proliferative activity of skeletal muscle myoblasts and the orderly progression of the cell cycle are the core driving forces for the growth and development of skeletal muscle and the expansion of the number of muscle fibers during the embryonic period. It is also the core in vitro cell model for conducting research on the molecular mechanism of yak skeletal muscle development, functional gene verification, and molecular marker-assisted breeding.

[0003] Existing research has confirmed that the high-altitude hypoxic environment significantly induces G1 phase cell cycle arrest in yak myoblasts, greatly inhibiting cell proliferation activity. This is a core limiting factor restricting the growth and development of yak skeletal muscle and improving meat production performance. In existing technologies, studies on the regulation of bovine myoblast proliferation and differentiation have identified some functional genes and non-coding RNAs. Zhang et al. found that LncPRRX1 promotes bovine myoblast proliferation by regulating the miRNA-137 / CDC42 axis (Zhang W, Sun B, Zhao Y, et al. Proliferation of bovine myoblast by LncPRRX1 via regulation of the miR-137 / CDC42 axis. Int J Biol Macromol. 2022;220:33-42.doi:10.1016 / j.ijbiomac.2022.08.018); Song et al. found that miR-483 is a negative regulator of bovine myoblast proliferation and differentiation (Song C, Yang Z, Dong D, et al. miR-483 inhibits bovine myoblast cell proliferation and differentiation via IGF1 / PI3K / AKT signal pathway. JCell Physiol. 2019;234(6):9839-9848. doi:10.1002 / jcp.27672). Existing research and patented technologies mostly focus on the regulation of myoblast differentiation and myotube formation. Research on the core regulatory targets of yak myoblast proliferation and cell cycle progression under hypoxic conditions is extremely scarce. The reported regulatory schemes generally suffer from poor targeting, low regulatory efficiency, and unclear mechanisms of action, making it impossible to achieve precise and controllable regulation of the cell cycle. Furthermore, there are no stable gene expression regulation engineered cell models that can be used for long-term mechanism research and industrial applications.

[0004] DEAD-box helicase 6 (DDX6) is a core member of the DEAD-box RNA helicase family, located in the cytoplasmic processing body (P-body). It possesses ATP-dependent RNA helicase activity and is widely involved in multiple RNA metabolic processes, including mRNA splicing, degradation, translation regulation, and miRNA silencing. It is a core molecule in the post-transcriptional regulation of gene expression within cells. Existing research confirms that DDX6 participates in the proliferation and cell cycle regulation of various cell types, but its function exhibits strong tissue-cell specificity, species specificity, and cell physiological state dependence: In colorectal cancer cells, DDX6 significantly regulates the transcriptional activity of TCF and the expression levels of Wnt target genes. Downregulating DDX6 through RNA interference significantly reduces the viability of colorectal cancer cells and arrests the cell cycle in the S phase. In the human cervical cancer cell line HeLa, DDX6 expression is upregulated during cell proliferation but downregulated during differentiation; knocking down DDX6 leads to cell cycle arrest in the S phase, thereby inhibiting cell growth. Furthermore, the interaction between DDX6 and eIF4E suggests that the gene translation initiation process involved in cell proliferation may be regulated. In mouse embryonic stem cells, DDX6 is essential for maintaining normal cell morphology and proliferation, and also plays an important role in miRNA-mediated translational repression.

[0005] Existing publicly disclosed patents related to the DDX family are all concentrated in the biomedical field. Chinese patent application CN202511603813.4 discloses the use of a DDX39B protein inhibitor in the preparation of a drug for treating acute leukemia; CN202610148712.0 discloses a veterinary drug composition targeting DDX5 protein against avian adenovirus and its application. To date, there are no reports on the application of DDX6 in the regulation of myoblasts in livestock animals. Therefore, revealing the expression characteristics and biological functions of DDX6 in yak myoblasts, and investigating whether it regulates the cell cycle and proliferation of yak myoblasts under hypoxic conditions, has significant practical importance and application value.

[0006] The existing technology has the following core defects and application gaps, which are all technical problems that this invention specifically addresses: First, there is a lack of basic research on the yak DDX6 gene, and its sequence characteristics and basic biological functions are unknown in this field. Current research on DDX6 focuses on model organisms such as humans and mice, and there are no reports on the cloning of the coding sequence or analysis of the expression characteristics of the yak DDX6 gene. This lack of knowledge regarding the sequence characteristics, species specificity, and tissue expression patterns of the yak DDX6 gene makes it impossible to conduct functional research and application development in myoblasts. This is the most fundamental obstacle restricting the application of this gene in yak genetic breeding.

[0007] Second, current technologies have not revealed the bidirectional regulatory role of DDX6 in the proliferation and cell cycle of yak myoblasts, and there is no corresponding targeted regulation technology. Studies have only confirmed the cell type-specific function of DDX6 in model organisms, but its role in yak myoblasts is completely unknown; moreover, it is impossible to conceive of a bidirectional regulatory effect that can alleviate hypoxia-induced G1 phase arrest by overexpressing DDX6 and achieve G2 / M phase arrest by interfering with DDX6, resulting in a lack of application of this targeted regulation technology and corresponding gene-targeted regulation cell models.

[0008] Third, current technologies lack both a standardized hypoxia model for yak myoblasts adapted to mechanism research and efficient, stable targeted regulation methods and supporting cell models for cell cycle arrest in yak myoblasts under high-altitude hypoxic environments. Current research often directly applies hypoxia treatment protocols to common lowland cattle breeds without specific optimization for the cellular physiological characteristics of yaks, a species unique to the high-altitude region. This results in extremely poor model stability and batch-to-batch consistency, failing to accurately simulate the physiological effects of high-altitude hypoxia on yak myoblasts. Meanwhile, the most commonly used hypoxia incubator modeling method in existing research has insurmountable technical defects: First, the hypoxia environment is extremely unstable. Once cells leave the hypoxia incubator, the intracellular hypoxia core marker molecule HIF1α degrades within minutes, and the hypoxia-induced cellular physiological state disappears rapidly, which is completely unfavorable for exploring the molecular mechanisms of cell cycle regulation. Second, environmental fluctuations during experimental operations have a great impact. In routine operations such as cell medium change, sample collection, and detection, cells are repeatedly put into and taken out of the hypoxia incubator. It takes several hours to restore a stable hypoxia environment after each operation. This not only makes the hypoxia treatment conditions completely uncontrollable, but also causes non-specific fluctuations in cell cycle and proliferation state, which seriously affects the accuracy and reproducibility of experimental results.

[0009] Fourth, existing technologies lack a standardized system for constructing stable DDX6 expression-regulated yak myoblast transgenic cell lines and a comprehensive quality control system. Current technologies do not optimize the core parameters of lentiviral transduction for yak embryonic myoblasts, failing to achieve optimal gene expression regulation with minimal cytotoxicity. Furthermore, the lack of a comprehensive mycoplasma contamination quality control standard for RNA-binding protein-related experiments results in poor reproducibility and low reliability, hindering the stable and reproducible large-scale preparation of cell models and failing to meet the core requirement of batch-to-batch consistency of cell materials in life science experiments.

[0010] Therefore, there is an urgent need to provide a yak myoblast model that overexpresses the DDX6 gene. This cell can stably alleviate G1 phase cell cycle arrest induced by hypoxia, significantly enhance and restore the proliferative capacity of myoblasts, and at the same time establish a supporting standardized construction and quality control system to provide core cell models and technical support for the study of molecular mechanisms of yak skeletal muscle growth and development and molecular breeding of plateau livestock. Summary of the Invention

[0011] Based on the shortcomings of the existing technology, the present invention provides yak myoblasts overexpressing the DDX6 gene, which can stably alleviate G1 phase cell cycle arrest induced by hypoxia, significantly enhance and restore the proliferative capacity of myoblasts, and realize the proliferative capacity of yak myoblasts under hypoxia conditions.

[0012] To achieve the objectives of this invention, the complete coding sequence (CDS region) of the yak DEAD-box helicase 6 (DDX6) gene was cloned. A lentiviral overexpression vector targeting the DDX6 gene and a short hairpin RNA (shRNA) interference vector were constructed. Core parameters for lentiviral transduction adapted to yak embryonic myoblasts were optimized, and stable transgenic lines of yak myoblasts overexpressing and interfering with the DDX6 gene were constructed. Simultaneously, a standardized cobalt chloride (CoCl2)-induced hypoxia model of yak myoblasts was established. Finally, through multi-dimensional functional validation, the regulatory role of DDX6 on the cell cycle and proliferation of yak myoblasts under hypoxic conditions was clarified. The obtained yak myoblasts overexpressing the DDX6 gene could stably alleviate hypoxia-induced G1 phase cell cycle arrest and significantly restore and enhance cell proliferation capacity.

[0013] On one hand, the present invention provides the following technical solution: a yak myoblast overexpressing the DDX6 gene, wherein the cells are obtained by stably overexpressing the yak DDX6 gene in yak embryonic skeletal myoblasts through a lentivirus-mediated overexpression system; the CDS region of the yak DDX6 gene is obtained by PCR amplification and cloning, and its specific shRNA interference target sequence is shown in SEQ ID NO.1; SEQ ID NO.1: DDX6 shRNA interference target DNA sequence GAGTATGACCACCACTATTAA The DDX6 interfering DNA sequences are shown in SEQ ID NO. 2 and 3: The justice chain is 5'-TGAGTATGACCACCACTATTAATTCAAGAGATTAATAGTGGTGGTCATACTCTTTTTTC-3' The ansense chain is 5'-TCGAGAAAAAAGAGTATGACCACCACTATTAATCTCTTGAATTAATAGTGGTGGTCATACTCA-3' The DNA sequence of the yak DDX6 gene CDS is shown in SEQ ID NO.4: SEQ ID NO.4 The yak embryonic skeletal muscle myoblasts were isolated from the leg skeletal muscle tissue of 2-3 month old yak embryos. The complete culture medium for culturing the myoblasts was formulated as follows: by volume percentage, 10% FBS, 1% penicillin-streptomycin-amphoteric B, 1% L-Alanyl-L-Glutamine and 88% DMEM basal medium.

[0014] The method for constructing yak myoblasts overexpressing the DDX6 gene specifically includes the following steps: Step 1: Total RNA extraction and cDNA synthesis from yak myoblasts Frozen primary yak embryonic skeletal muscle myoblasts were revived and seeded at an appropriate density in cell culture dishes. The cells were cultured in the aforementioned complete myoblast culture medium at 37 ℃ and 5% CO2. Cells cultured for 0, 1, 2, 3, and 4 days were collected, and total RNA was extracted using the Trizol method. Complementary DNA (cDNA) was synthesized via reverse transcription. This step aims to obtain cDNA templates at different time points during the proliferation of yak myoblasts, providing fundamental materials for subsequent DDX6 gene cloning and temporal expression analysis.

[0015] Step 2: Amplification and sequence analysis of the CDS region of the yak DDX6 gene. Based on the predicted reference sequence of the yak DDX6 gene in the NCBI database, specific PCR amplification primers were designed (see Table 1). Using the cDNA obtained in step 1 as a template, PCR amplification was performed using high-fidelity DNA polymerase, and sequencing was performed to obtain the complete CDS region sequence of the yak DDX6 gene with the correct sequence. The purpose of this step is to clone the complete CDS region sequence of the yak DDX6 gene, providing a target gene template for the subsequent construction of lentiviral vectors.

[0016] Step 3: Temporal expression analysis of DDX6 during myoblast proliferation. Based on the CDS region sequence of the yak DDX6 gene obtained in step 2, specific real-time quantitative polymerase chain reaction (RT-qPCR) primers were designed. Using cDNA from 0-4 day yak myoblasts obtained in step 1 as a template and the yak β-Actin gene as an internal reference gene, RT-qPCR was performed to analyze the temporal expression pattern of the DDX6 gene in the proliferation process of yak myoblasts. The purpose of this step is to clarify the correlation between DDX6 gene expression and the proliferation process of yak myoblasts, and to provide an expression characteristic basis for subsequent functional verification.

[0017] Step 4: Construction of DDX6 lentivirus overexpression vector and interference vector Using NotI and BamHI as double restriction sites, and referring to the complete CDS region sequence of the yak DDX6 gene obtained in step 2 as a template, primers for amplifying the DDX6 gene CDS region containing restriction sites were designed and synthesized. PCR amplification was performed using these primers, followed by recovery and purification of the target gene fragment. The target fragment was double-digested, ligated, and transformed with the EF-1a / mCherry&Puro lentiviral vector. Positive single colonies were selected for sequencing verification, and a DDX6 overexpression recombinant plasmid with the correct sequence was obtained. Based on the yak DDX6 gene CDS region sequence obtained in step 2, the shRNA interference target sequence GAGTATGACCACCACTATTAA (SEQ ID NO. 1) was designed, and the corresponding upstream and downstream Oligo sequences were synthesized. 100 Oligomix was prepared by mixing upstream and downstream Oligo molecules in equal volumes with µM of the mixture. After annealing, the mixture was ligated into the U6 / mCherry&Puro lentiviral vector. After transformation, positive single colonies were picked and sequenced for verification, and the correct DDX6 interference recombinant plasmid was obtained. The purpose of this step is to construct a lentiviral vector that specifically overexpresses and interferes with the yak DDX6 gene, providing a core tool for the subsequent construction of stable transgenic strains.

[0018] Step 5 Lentiviral Packaging and Titer Detection The DDX6 overexpression recombinant plasmid and DDX6 interference recombinant plasmid obtained in step 4 were co-transfected into 293T cells with lentiviral packaging plasmids. Six hours after transfection, the culture medium was replaced with fresh myoblast complete culture medium, and the cells were cultured for another 72 hours. The cell culture supernatant was collected, filtered through a 0.45 μm filter membrane, and concentrated by ultracentrifugation to obtain DDX6 overexpression lentivirus and DDX6 interference lentivirus. The lentiviral titers were detected using a serial dilution method. The purpose of this step is to prepare high-titer, high-activity DDX6 overexpression and interference lentiviruses to provide experimental materials for the subsequent construction of stable transgenic lines of yak myoblasts.

[0019] Step 6: Lentiviral optimal infection multiple screening The multiplicity of infection (MOI) refers to the ratio of the number of viruses to the number of cells when infected by lentivirus. Yak myoblasts in the logarithmic growth phase were seeded at the same density into 96-well cell culture plates and cultured at 37 ℃ in a 5% CO2 incubator for 24 h. Overexpressing lentivirus groups with MOI values ​​of 5, 10, and 15, and interfering lentivirus groups with MOI values ​​of 10, 20, and 40 were set up, along with a blank control group. Each group had three replicate wells. Fresh complete myoblast culture medium was replaced after 24 h and 48 h of infection, and the culture was continued for a total of 72 h. Cell counting was then used to analyze the results. Kit-8 (hereinafter referred to as CCK-8) was used to detect cell viability in each group. Combined with the mCherry fluorescence expression under a fluorescence microscope, the optimal MOI value was screened to achieve the best overexpression / interference effect and the lowest cytotoxicity. In this step, it was finally determined that the relative optimal MOI value for overexpression lentivirus and interference lentivirus was 10. The purpose of this step is to optimize and determine the optimal MOI value for lentivirus transduction adapted to yak embryonic myoblasts, so as to minimize the toxicity of lentivirus to cells while ensuring the gene expression regulation effect, and solve the problems of high cytotoxicity and low transfection efficiency of existing lentivirus transduction technology.

[0020] Step 7: Screening of stable yak myoblast transgenic lines Yak myoblasts in the logarithmic growth phase were seeded at an appropriate density into cell culture dishes and cultured for 24 h. Following the optimal MOI of 10 determined in step 6, DDX6-overexpressing lentivirus and DDX6-interfering lentivirus were added, respectively, with an empty lentivirus control group included. After transduction, the culture medium was replaced with fresh myoblast complete medium containing puromycin solution, and the cells were cultured again. This process yielded stable DDX6-overexpressing and DDX6-interfering yak myoblast transfected cell lines. The purpose of this step is to screen with puromycin to remove cells not transduced with lentivirus, obtaining stable yak myoblast transfected cell lines with consistent gene expression regulation efficiency that can be stably passaged, thus addressing the current lack of stable DDX6 expression regulation cell models.

[0021] Step 8: Detection of the transfection effect of yak myoblasts Yak myoblasts obtained in step 7 were collected from the DDX6 overexpression group, interference group, and empty vector control group. Total protein was extracted from a portion of the cells, and the expression level of intracellular DDX6 protein was detected by Western blotting (WB) with a DDX6-specific antibody. Total RNA was extracted from the other portion of the cells, and cDNA was synthesized by reverse transcription. The mRNA transcription level of the intracellular DDX6 gene was detected by RT-qPCR. The purpose of this step is to verify the overexpression and interference effect of the DDX6 gene in the stable cell line at both the protein and mRNA levels, and to ensure that the constructed cell line meets the experimental requirements for subsequent functional verification.

[0022] Furthermore, to address the technical shortcomings of existing yak myoblast hypoxia models, which are immature and unsuitable for molecular mechanism research, this invention establishes a standardized CoCl2-induced yak myoblast hypoxia model. The specific construction method is as follows: Yak myoblasts at a rate of 1 × 10 5 Cells were seeded at a density of [number] cells / mL in 96-well plates, gently shaken, and incubated at 37 °C in a 5% CO2 incubator for 24 h. The old culture medium was removed, and myoblast complete culture medium containing 0, 100, 150, 200, 250, 300, 350, and 400 μM CoCl2 were added, with three biological replicates for each concentration. The medium was replaced with fresh medium corresponding to the CoCl2 concentration every 24 h. After 72 h of culture, cell viability was assessed using the CCK-8 assay. Based on the cell viability results, a CoCl2 concentration of 150 μM was selected for identifying the hypoxia model. Following the same method, cells were cultured in 10 cm culture dishes, with the myoblast complete culture medium containing 150 μM CoCl2 replaced every 24 h. The control group used myoblast complete culture medium without CoCl2, with three biological replicates per group. After culturing for 72 h, the culture medium was removed, and cells from each group were collected. Total protein and total RNA were extracted from the cells. The protein expression level and mRNA transcription level of the hypoxia-inducible factor 1α (HIF1α), a core marker of hypoxia, were detected by Western blotting and RT-qPCR. The purpose of this method is to establish a stable hypoxia model of yak myoblasts through CoCl2 chemical induction, which completely solves the core defects of existing hypoxia incubator modeling methods, such as unsustainable hypoxia environment, large interference in experimental operation, and unfavorable conditions for molecular mechanism exploration. This provides a stable and controllable hypoxia treatment system for subsequent DDX6 functional verification.

[0023] Furthermore, to address the issue of mycoplasma contamination interfering with RNA-binding protein-related experimental results in existing technologies, this invention establishes a comprehensive mycoplasma contamination quality control system adapted for DDX6 functional studies. Specifically, in all cell experiments of this invention, isothermal amplification mycoplasma detection kits are used to detect mycoplasma contamination in the cell culture supernatant at two critical points: before cell plating and before sample collection. Subsequent experimental operations or indicator detection can only proceed after the detection results confirm the absence of mycoplasma contamination. The purpose of this system is to completely eliminate the interference of mycoplasma contamination on cell proliferation, metabolic state, and RNA-related experimental results through comprehensive mycoplasma contamination quality control, ensuring the accuracy, reliability, and reproducibility of DDX6 functional verification experimental results.

[0024] Furthermore, to clarify the regulatory effect of DDX6 on the cell cycle and proliferation of yak myoblasts under hypoxic conditions, the present invention employs the following technical solution for functional verification: 1. Verification of the effect of DDX6 on the cell cycle of yak myoblasts under hypoxia This experiment consisted of four experimental groups: a control group (Yak myoblasts, normally cultured), a hypoxia treatment group (Hypoxia, HX, Yak myoblasts treated with 150 μM CoCl2), a hypoxia overexpression DDX6 group (HX+oeDDX6, DDX6 overexpressing stable yak myoblasts treated with 150 μM CoCl2), and a hypoxia interference DDX6 group (HX+shDDX6, DDX6 interference yak myoblasts treated with 150 μM CoCl2). Each group had three biological replicates. After seeding, cells in each group were cultured for 24 h, then starved for 24 h using serum-depleted medium. After starvation, the old medium was removed and replaced with complete myoblast medium. The complete myoblast medium for each hypoxia group contained 150 μM CoCl2, and the medium was changed every 24 h. When the cell confluence reached 70%-80%, 5-ethynyl-2'-deoxyuridine (EdU) combined with 4',6-diamidino-2-phenylindole (DAPI) staining was used, and flow cytometry was employed to assess the effect of DDX6 on the cell cycle progression of yak myoblasts under hypoxic conditions. Simultaneously, cells from each group were collected, total RNA was extracted, and the transcriptional levels of cell cycle-related genes CCNA2, CCNB1, CCNE1, CDK1, CCND1, and MCM6 were detected using RT-qPCR. The purpose of this protocol was to clarify that overexpression of DDX6 can effectively alleviate hypoxia-induced G1 phase cell cycle arrest in yak myoblasts, and that interference with DDX6 can induce G2 / M phase arrest in yak myoblasts, demonstrating a bidirectional regulatory effect, while also revealing its molecular mechanism of cell cycle regulation.

[0025] 2. Verification of the effect of DDX6 on the proliferation of yak myoblasts under hypoxia This experiment involved the same groupings as the cell cycle verification experiment described above, with three biological replicates in each group. The following three methods were used to verify the regulatory effect of DDX6 overexpression on the proliferation of yak myoblasts under hypoxic conditions from multiple dimensions: ① The CCK-8 assay was used to detect cell viability and assess cell proliferation activity in each group; ② An Agilent xCELLigence RTCAS16 real-time label-free cell function analyzer was used to continuously monitor the growth curves of each group for 72 hours to assess cell proliferation progress in real time; ③ RT-qPCR was used to detect the mRNA transcription levels of the proliferation marker genes PCNA and MKI67 in each group. The purpose of this protocol is to definitively demonstrate, from three dimensions—cell viability, real-time growth progress, and expression of proliferation marker genes—that overexpression of DDX6 can significantly enhance and restore the proliferation capacity of yak myoblasts under hypoxic conditions, thus clarifying its core biological function.

[0026] Table 1 Gene Primer Sequences

[0027] Advantages of this invention: 1. The complete CDS region sequence of the yak DDX6 gene was cloned, and its temporal expression pattern in the proliferation process of yak myoblasts was clarified, revealing the bidirectional regulatory effect of DDX6 on yak myoblasts: overexpression of DDX6 can effectively alleviate the G1 phase cell cycle arrest induced by hypoxia, while interference with DDX6 will induce G2 / M phase arrest.

[0028] 2. A low-toxicity, high-efficiency, and stable DDX6-targeted expression regulation system for stable transgenic yak myoblasts was constructed, overcoming the core deficiency of existing technologies that lack standardized target gene regulation cell models. This invention, targeting the physiological characteristics of yak embryonic myoblasts, optimized and determined the optimal MOI value of 10 for lentiviral transduction, and correspondingly optimized the working concentration and screening cycle of puromycin. This achieved optimal gene overexpression / interference effects with minimal cytotoxicity. The constructed stable transgenic cells can be stably passaged, exhibit uniform target gene regulation efficiency, and stable phenotypes. This solves the problems of high cytotoxicity, low transfection efficiency, and inability to obtain stable passaged cell lines in existing technologies using lentiviral transduction, providing a standardized and reproducible core cell model for long-term mechanistic research and gene function verification of yak myoblasts.

[0029] 3. A standardized hypoxic cell model and a complete experimental quality control system adapted for molecular mechanism research were established, overcoming the technical shortcomings of existing technologies, such as uncontrollable hypoxic models and poor reliability of experimental results. This invention establishes a yak myoblast hypoxic model through CoCl2 chemical induction, overcoming the inherent defects of traditional hypoxic incubator modeling methods, including unsustainable hypoxic environments, significant experimental interference, rapid degradation of intracellular hypoxic marker molecules, and inability to adapt to molecular mechanism research. The model is stable and controllable, easy to operate, and exhibits good batch consistency. Simultaneously, a complete mycoplasma contamination quality control system was established, performing mycoplasma contamination detection at key points throughout the experimental cycle. This completely eliminates the interference of mycoplasma contamination on cell proliferation and RNA metabolism, especially suitable for functional studies of RNA-binding proteins such as DDX6, significantly improving the accuracy, reliability, and reproducibility of experimental results.

[0030] 4. This invention provides a highly efficient targeted regulation scheme for hypoxia-induced cell cycle arrest and proliferation inhibition in yak myoblasts, overcoming the technical bottlenecks of low regulation efficiency and poor targeting in existing technologies. This invention demonstrates that overexpression of DDX6 can increase the proliferation level of yak myoblasts under hypoxic conditions, effectively reversing hypoxia-induced G1 phase cell cycle arrest and stably restoring and enhancing cell proliferation capacity. Compared to existing technologies that rely on exogenous cytokine addition and non-core target gene regulation, this invention's targeted regulation scheme has significant advantages in terms of strong targeting, high regulation efficiency, and stable effects, providing a novel technical means for the efficient in vitro expansion of yak myoblasts and the regulation of skeletal muscle growth and development.

[0031] 5. The yak myoblasts overexpressing the DDX6 gene constructed in this invention can serve as core tool cells and be widely applied in research fields such as the molecular mechanism of yak skeletal muscle growth and development, the mechanism of hypoxia adaptation in plateau livestock, functional gene verification, and gene editing breeding, thus improving the research system of plateau-characteristic livestock biotechnology. At the industrial economic level, this invention clarifies the core regulatory target of DDX6, providing core technical support for molecular marker-assisted breeding of yak meat production traits and gene editing breeding of superior breeds. It can significantly shorten the breeding cycle of superior yak breeds, improve the meat production performance and industrial economic benefits of yak farming, and help increase the income of plateau farmers and herdsmen.

[0032] The DNA sequence of the yak DDX6 gene CDS, its interfering DNA sequence, the primer DNA sequence, and the oligonucleotide mixture DNA sequence are shown in the sequence listing. Attached Figure Description

[0033] Figure 1The image shows the agarose gel electrophoresis results of the PCR amplification product of the yak DDX6 gene. Specific amplification primers were designed based on the coding region sequence of the yak DDX6 gene, and the expected amplification product length was approximately 1681 bp. Agarose gel electrophoresis showed that the PCR amplification product bands were clear and uniform, with no non-specific amplification bands, and the band size was completely consistent with the expected product length, confirming the successful amplification of the target fragment of the yak DDX6 gene.

[0034] Figure 2 This figure shows the temporal expression results of the DDX6 gene during the proliferation process of yak myoblasts. Real-time quantitative PCR was used to detect the mRNA transcription level of the DDX6 gene in yak myoblasts from day 0 to day 4 of proliferation. The results showed that the transcription level of the DDX6 gene initially increased and then decreased with the progression of cell proliferation, reaching a relatively high level at 24 h of culture. These results suggest that the DDX6 gene may play an important regulatory role in the early stage of yak myoblast proliferation.

[0035] Figure 3 The image shows the lentiviral titer determination results. Lentiviral titers were determined using immunofluorescence assay. The virus infection time in 293T cells was 72 h. The assay included LV8N-DDX6 overexpressing lentivirus, LV10N-DDX6 interfering lentivirus, LV8N-NC negative control lentivirus, and LV10N-NC negative control lentivirus. Four viral dilution gradients (10⁻¹, 10⁻², 10⁻³, and 10⁻⁴) were used for cell infection experiments. The titer determination results showed that the titers of LV8N-DDX6, LV10N-DDX6, and LV10N-NC lentiviruses all reached 10⁸ TU / mL, while the titer of LV8N-NC lentivirus reached 10⁹ TU / mL.

[0036] Figure 4Immunofluorescence results of lentiviruses with different multiplicity of infection (MOI) transfected into yak myoblasts. To screen for the optimal MOI for lentivirus transfection into yak myoblasts, lentiviruses with different MOIs were added to the complete culture medium of yak myoblasts for transfection experiments. The transfection groups and MOI gradients were set as follows: the LV8N-DDX6 overexpression lentivirus group and the LV8N-NC negative control lentivirus group both had MOI gradients of 5, 10, and 15; the LV10N-DDX6 interference lentivirus group and the LV10N-NC negative control lentivirus group both had MOI gradients of 10, 20, and 40. 72 h after transfection, the fluorescence expression of cells in each group was observed and photographed using an inverted fluorescence microscope. The results showed that, under the same MOI, the number of fluorescently positive yak myoblasts transfected with LV8N-DDX6 was significantly higher than that in the LV8N-NC group; when MOI=10, the number of fluorescently positive yak myoblasts transfected with LV10N-DDX6 was significantly lower than that in the LV10N-NC group; when the MOI of LV10N lentivirus exceeded 20, the overall cell number decreased significantly, indicating that lentiviruses with higher multiplicity of infection have certain cytotoxicity to yak myoblasts.

[0037] Figure 5 The figures show the cell viability of yak myoblasts transfected with lentiviruses of different multiplicity of infection (MOIs). The CCK-8 assay was used to detect the effect of lentivirus transfection with different MOIs on yak myoblast viability. Figure A shows the effect of LV8N-DDX6 overexpressing lentiviruses of different MOIs on yak myoblast viability; Figure B shows the effect of LV10N-DDX6 interfering lentiviruses of different MOIs on yak myoblast viability. *P<0.05, **P<0.01. The results showed that at MOIs of 5 and 10, the viability of myoblasts transfected with LV8N-DDX6 was significantly higher than that of the LV8N-NC control group (P<0.05, A); at an MOI of 10, the viability of myoblasts transfected with LV10N-DDX6 was significantly lower than that of the LV10N-NC control group (P<0.01, B). Based on the cell viability results, the optimal MOI for both LV8N-DDX6 and LV10N-DDX6 lentiviruses was determined to be 10 for subsequent cell transfection experiments.

[0038] Figure 6The image shows the results of lentivirus transfection of yak myoblasts. To verify the transfection efficiency of lentivirus at MOI=10, the expression level of DDX6 in yak myoblasts was detected by Western blot (WB) and real-time quantitative PCR (RT-qPCR). A and B represent the relative expression levels of DDX6 protein detected by Western blot; C represents the relative transcription level of the DDX6 gene detected by RT-qPCR. Control is the blank control group, oeDDX6 is the group transfected with LV8N-DDX6 overexpressing lentivirus at MOI=10, and shDDX6 is the group transfected with LV10N-DDX6 interfering lentivirus at MOI=10. Different uppercase letters indicate statistically significant differences (P<0.01), and different lowercase letters indicate statistically significant differences (P<0.05). The results showed that the gene transcription level and relative protein expression of DDX6 in the oeDDX6 group were significantly higher than those in the LV8N-NC negative control group (P<0.01); the gene transcription level and relative protein expression of DDX6 in the shDDX6 group were significantly lower than those in the LV10N-NC negative control group (P<0.05). These results confirm that LV8N-DDX6 overexpression lentivirus can effectively upregulate DDX6 expression in yak myoblasts, and LV10N-DDX6 interfering lentivirus can effectively downregulate DDX6 expression in yak myoblasts. An infection condition with an MOI of 10 can be applied to all subsequent experiments.

[0039] Figure 7 Figure 1 shows the identification results of the CoCl2-induced hypoxia model of yak myoblasts. To construct and identify the CoCl2-induced hypoxia model of yak myoblasts, cell viability was detected using the CCK-8 assay, and the expression level of HIF-1α was detected by Western blot (WB) and real-time quantitative PCR (RT-qPCR). In the figure, A represents the viability of yak myoblasts after treatment with different concentrations of CoCl2; B represents the expression level of HIF-1α protein detected by Western blot; and C represents the transcription level of the HIF-1α gene detected by real-time quantitative PCR. **P<0.01. The results showed that the viability of yak myoblasts decreased with increasing CoCl2 concentration. The inhibition rate of cell viability by 150 μM CoCl2 was approximately 14.67%, while that by 300 μM CoCl2 was 34.39%. The inhibition rate of cell viability reached over 72% when the CoCl2 concentration exceeded 350 μM (A). Subsequently, Western blotting revealed positive expression of HIF-1α protein in the 150 μM CoCl2 treatment group (B), and its gene transcription level was significantly higher than that in the control group (P<0.01, C). Considering both cytotoxicity and model effectiveness, 150 μM CoCl2 was determined to be the optimal concentration for subsequent hypoxia model construction.

[0040] Figure 8 The image shows the results of mycoplasma contamination detection in yak myoblasts. The mycoplasma detection kit was used with isothermal amplification, and the sample was yak myoblast culture medium. A mycoplasma positive control was also included. The results showed no positive reaction in the yak myoblast culture medium sample, while the positive control showed a positive reaction, confirming that the yak myoblasts used in this experiment were free of mycoplasma contamination.

[0041] Figure 9 The image shows the results of yak myoblast cell cycle detection using the EdU-DAPI method. To investigate the effect of DDX6 on the yak myoblast cell cycle under hypoxic conditions, the cell cycle distribution was detected using the EdU-DAPI method combined with flow cytometry. Control was the normoxic control group, HX was the hypoxic model group, HX+oeDDX6 was the group transfected with LV8N-DDX6 overexpressing lentivirus under hypoxic conditions, and HX+shDDX6 was the group transfected with LV10N-DDX6 interfering lentivirus under hypoxic conditions. *P<0.05, **P<0.01. The results showed that the proportion of cells in S phase (P<0.01) and G2 / M phase (P<0.05) in the HX group was significantly lower than that in the Control group, while the proportion of cells in G0 / G1 phase was significantly higher than that in the Control group (P<0.01). The proportion of cells in S phase in the HX+oeDDX6 group was significantly higher than that in the HX group and the HX+shDDX6 group (P<0.01), while the proportion of cells in G0 / G1 phase was significantly lower than that in the HX group (P<0.01), and the proportion of cells in G2 / M phase was significantly lower than that in the HX+shDDX6 group (P<0.01). The proportion of cells in S phase (P<0.01) and G0 / G1 phase (P<0.05) in the HX+shDDX6 group was significantly lower than that in the HX group, while the proportion of cells in G2 / M phase was significantly higher than that in the HX group (P<0.01).

[0042] Figure 10The figure shows the effect of DDX6 on the transcriptional levels of yak myoblast cell cycle-related genes under hypoxic conditions. To investigate the regulatory role of DDX6 on the transcriptional levels of yak myoblast cell cycle-related genes under hypoxic conditions, real-time quantitative PCR (RT-qPCR) was used for detection. In the figure, A represents the CCND1 gene, B represents the CCNE1 gene, C represents the CCNA2 gene, D represents the MCM6 gene, E represents the CCNB1 gene, and F represents the CDK1 gene. Control represents the normoxic control group, HX represents the hypoxic model group, HX+oeDDX6 represents the hypoxic overexpression of DDX6 group, and HX+shDDX6 represents the hypoxic interference of DDX6 group. *P<0.05, **P<0.01. The results showed that, compared with the Control group, the transcriptional level of CCND1 in the HX group was significantly increased (P<0.01), while the transcriptional levels of CCNA2, MCM6, CCNB1, and CDK1 were significantly decreased (P<0.01), and there was no significant difference in CCNE1. The transcriptional levels of the above six genes in the HX+oeDDX6 group were significantly higher than those in the HX group and the HX+shDDX6 group (P<0.05 or P<0.01). The transcriptional level of CCNE1 in the HX+shDDX6 group was significantly higher than that in the HX group (P<0.01), while the transcriptional levels of the other five genes were significantly lower than those in the HX group (P<0.05 or P<0.01).

[0043] Figure 11 Figure A shows the effect of DDX6 on the proliferation activity and growth curve of yak myoblasts under hypoxic conditions. To investigate the effect of DDX6 on the proliferation capacity of yak myoblasts under hypoxic conditions, cell proliferation activity was detected by the CCK-8 assay, and cell growth curves were measured using the Agilent xCELLigence RTCA S16 system. In the figure, A represents the cell proliferation activity detected by the CCK-8 assay; B represents the cell growth curve, where Cell Index is proportional to the cell number; Control is the normoxic control group, HX is the hypoxic model group, HX+oeDDX6 is the hypoxic overexpression DDX6 group, and HX+shDDX6 is the hypoxic interference DDX6 group; *P<0.05, **P<0.01. The results showed that, compared with the Control group, the cell proliferation activity in the HX group was significantly reduced (P<0.01); the cell proliferation activity in the HX+oeDDX6 group was significantly higher than that in the HX group and the HX+shDDX6 group (P<0.01), while the HX+shDDX6 group was significantly lower than that in the HX group (P<0.05) (A). The cell growth trend was HX+oeDDX6 group > Control group > HX group > HX+shDDX6 group; the cell indexes in the HX group and the HX+shDDX6 group reached their peaks at approximately 65 h and 22.5 h, respectively, and then decreased, while the cell indexes in the HX+oeDDX6 group and the Control group continued to increase within 72 h (B).

[0044] Figure 12 The figure shows the effect of DDX6 on the transcriptional levels of genes related to yak myoblast proliferation under hypoxic conditions. To investigate the regulatory role of DDX6 on the transcriptional levels of genes related to yak myoblast proliferation under hypoxic conditions, real-time quantitative PCR (RT-qPCR) was used for detection. In the figure, A represents the PCNA gene, B represents the MKI67 gene, and C represents the DDX6 gene; Control was the normoxic control group, HX was the hypoxic model group, HX+oeDDX6 was the hypoxic overexpression DDX6 group, and HX+shDDX6 was the hypoxic interference DDX6 group; **P<0.01. The results showed that the transcriptional levels of PCNA and MKI67 genes in the HX group were significantly lower than those in the Control group (P<0.01); the transcriptional levels of both genes in the HX+oeDDX6 group were significantly higher than those in the HX and HX+shDDX6 groups (P<0.01), and the transcriptional levels in the HX+shDDX6 group were significantly lower than those in the HX group (P<0.01). The transcriptional level of the DDX6 gene was HX+oeDDX6 group > HX group > HX+shDDX6 group, and the differences among the three groups were significant (P<0.01), with the HX group being significantly higher than the Control group (P<0.01). Detailed Implementation

[0045] To better illustrate the present invention, the following examples are provided: All reagents and consumables used in this invention are commercially available products, and all cell experimental operations were performed under sterile conditions. The complete myoblast proliferation culture medium consisted of, by volume percentage: 10% FBS, 1% penicillin-streptomycin-amphoteric B, 1% L-Alanyl-L-Glutamine, and 88% DMEM basal medium. Example 1

[0046] 1. Extraction of total RNA from untreated myoblasts and cloning of the DDX6 gene (1) Cell resuscitation. The frozen myoblasts were removed from liquid nitrogen and quickly placed in a 37°C water bath to thaw. After thawing, the cells were mixed and the cell suspension was transferred to a centrifuge tube containing complete myoblast culture medium. After centrifugation at 1600 r / min for 6 min, the supernatant was removed and the cell pellet was retained. The cells were resuspended in fresh complete myoblast culture medium.

[0047] (2) Cell density determination. Take 1 μL of the cell suspension from step (1) and mix it with 9 μL of trypan blue. Transfer the mixture into a Countess cell counting chamber and measure the cell suspension density using a Countess II cell counter.

[0048] (3) Cell proliferation culture. Based on the measured cell density, take an appropriate amount of the above cell suspension and add it to a 10 cm culture dish containing complete myoblast culture medium, so that the final cell concentration is 1 × 10⁻⁶.5 Cells / mL, gently shake to mix. Incubate in a CO2 cell culture incubator at 37 °C for 24 h, and collect cells as day 0. Replace the remaining culture dishes with fresh myoblast complete culture medium. Then collect cells every 24 h, replacing the remaining culture dishes with fresh myoblast complete culture medium, until day 3.

[0049] (4) RNA sample processing. Remove the culture medium from the sample to be collected, add an appropriate amount of sterile PBS preheated to 37 ℃ to wash the cells, repeat twice. Add an appropriate amount of RNAiso Plus to dissolve completely at room temperature, transfer to a 1.5 mL enzyme-free conical centrifuge tube, and freeze at -80 ℃ for later use.

[0050] (5) Thaw the RNA sample at room temperature, transfer it into a 1.5 mL enzyme-free conical centrifuge tube and let it stand at room temperature for 5 min. Centrifuge at 12000 r / min for 5 min, keep the supernatant and discard the precipitate.

[0051] (6) Add an appropriate amount (20% of the volume of the supernatant from the previous step) of chloroform solution that has been pre-cooled at 4 °C and shake vigorously. Let stand at room temperature for 10 min.

[0052] (7) Centrifuge at 4 ℃ and 12000 r / min for 15 min, aspirate the supernatant and transfer it into a new 1.5 mL enzyme-free conical centrifuge tube.

[0053] (8) Add an appropriate amount (equal to the amount in the previous step) of isopropanol that has been pre-cooled at 4 ℃, mix by inverting the container, and let stand at room temperature for 10 min. Centrifuge at 4 ℃ and 12000 r / min for 10 min, and discard the supernatant.

[0054] (9) Add 1 mL of 75% ethanol that has been pre-cooled at 4°C, shake the bottom precipitate to remove it from the tube wall, centrifuge at 4°C and 12000 r / min for 5 min and remove the supernatant. Repeat this step once.

[0055] (10) Remove as much residual ethanol as possible and allow it to evaporate completely in a clean, well-ventilated area. Add 20 μL of enzyme-free water to dissolve the precipitate, mix well, and then use NanoDrop One C to measure the RNA concentration and mass, ensuring 1.8 μL. <OD260 / OD280<2.0。

[0056] Myoblast cDNA synthesis was performed according to the PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time) instructions, as follows: (11) Perform the operation on ice. Add 2 μL of 5× gDNA Eraser Buffer, 1 μL of gDNA Eraser and 800 ng of myoblast RNA solution to a 0.2 mL enzyme-free PCR tube, and add enzyme-free water to a final volume of 10 μL.

[0057] (12) Incubate for 2 min at 42 ℃ in a dry thermostat after instantaneous separation.

[0058] (13) Add 1 μL of PrimeScript RT Enzyme Mix I, 4 μL of RTPrimer Mix, 4 μL of 5× PrimeScript Buffer 2 (for Real Time) and 1 μL of enzyme-free water to the above PCR tube.

[0059] (14) Place in a PCR instrument, 37 ℃ for 15 min, 85 ℃ for 5 s, temporarily store at 4 ℃, and store at -20 ℃ or -80 ℃ for long term.

[0060] 2. Amplification and sequence analysis of the CDS region of the yak DDX6 gene PCR primers for DDX6 (Primer-1) were designed using Primer Premier 5.0. Primer sequences, annealing temperatures, and reference sequences are shown in Table 1. PCR amplification of the CDS region of the yak DDX6 gene was performed using TaKaRa Taq™, the above-mentioned untreated myoblast cDNA, and Primer-1.

[0061] According to the instructions, the PCR reaction system (50 μL reaction volume) is as follows: 0.25 μL TaKaRa Taq, 5 μL 10×PCR Buffer, 4 μL dNTP Mixture, 2 μL template, 2 μL F / R, and enzyme-free water to a final volume of 50 μL. The PCR reaction conditions are as follows: pre-denaturation 98 ℃ for 5 min; denaturation 98 ℃ for 10 s, annealing for 30 s, extension 72 ℃ for 2 min, 35 cycles; final extension 72 ℃ for 10 min, 4 ℃ forever.

[0062] Five μL of PCR amplification product was taken and the DNA fragment length was determined by 1.0% agarose gel electrophoresis. The results were observed and photographed using an iBright CL1000 gel imaging system. After confirming that the quality was acceptable and there were no extraneous bands, the PCR amplification product was bidirectionally sequenced and assembled.

[0063] 3. Temporal expression of DDX6 during myoblast proliferation RT-qPCR primers for DDX6 were designed using Primer Premier 5.0 (Primer-2). RT-qPCR of yak DDX6 was performed using TB Green® Premix Ex Taq™ (Tli RNaseH Plus), the above-mentioned untreated myoblast cDNA, and LightCycler® 96 to observe the temporal expression of DDX6 in untreated myoblasts from 0 d to 4 d.

[0064] According to the instructions, the RT-qPCR reaction system (20 μL reaction volume) is as follows: 10 μL TB Green Premix ExTaq II (Tli RNaseH Plus) (2X), 0.8 μL RT-qPCR Primer-F / R, 2 μL template, and enzyme-free water to a final volume of 20 μL. The RT-qPCR reaction conditions are as follows: 95 ℃ for 30 s; 95 ℃ for 5 s, 60 ℃ for 20 s, 40 cycles; 95 ℃ for 1 s, 65 ℃ for 15 s, 95 ℃ for 1 s.

[0065] 2 -ΔΔCt DDX6 gene transcription levels were calculated using three biological replicates and four technical replicates per sample. One-way ANOVA was performed using SPSS 26.0, and LSD was used to compare differences between groups. Graphpad Pism 9.5 was used for plotting.

[0066] 4. Construction of the DDX6 lentivirus vector (1) Construction of DDX6 overexpression lentiviral vector Based on the accurate CDS sequence of the yak DDX6 gene obtained according to this invention, restriction enzyme primers were designed and synthesized using NotI and BamHI as restriction sites. These primers were synthesized by Shanghai Jima Pharmaceutical Technology Co., Ltd. Oligo (50 µM) was mixed in equal volumes to prepare an oligonucleotide mix. Oligo is an abbreviation for oligonucleotide, and in this overexpression vector construction, it specifically refers to a single-stranded DNA primer custom-synthesized for amplifying the CDS region of the DDX6 gene containing restriction sites. Multiple Oligo primers were mixed and amplified (see Table 2). The core purpose was to improve the specificity and fidelity of long-fragment target gene amplification, ensuring the complete amplification of the target fragment that meets the vector construction requirements, and reducing the risk of non-specific amplification and base mutation.

[0067] EC-DDX6 cloning PCR ① Reaction system: 6 μL Oligo mix, 5 μL 10× Pfu Buffer (+Mg 2+), 1 μL dNTP, 1 μL LV8N-DDX6-1, 1 μL LV8N-DDX6-36, 0.3 μL Pfu DNA polymerase, 36 μL sterile water. EC-DDX6 cloning PCR ① reaction conditions: 95 ℃, 3 min; 94 ℃, 30 s, 55 ℃, 30 s, 72 ℃, 30 s, 30 cycles; 72 ℃, 5 min.

[0068] EC-DDX6 cloning PCR ② reaction system: 1 μL EC-DDX6 cloning PCR ① product, 5 μL 10× PfuBuffer (+Mg 2+ ), 1 μL dNTP, 1 μL LV8N-DDX6-1, 1 μL LV8N-DDX6-36, 0.3 μL Pfu DNA polymerase, 41 μL sterile water. The reaction conditions were the same as those for EC-DDX6 cloning PCR ①. The products were subjected to agarose gel electrophoresis, and the DDX6 gene fragment containing the restriction enzyme sites was recovered by gel electrophoresis.

[0069] Using LV8N (EF-1a / mCherry & Puro) as a vector, the fragments were digested with NotI and BamHI restriction endonucleases. The digestion reaction mixture consisted of 5 μL 10× Buffer, 15 μL EC-DDX6, 1 μL NotI, 1 μL BamHI, and 28 μL sterile water. The reaction was carried out at 37 °C for 2 h, followed by gel recovery. The fragments were ligated into the linearized LV8N vector using the ClonExpress® Entry One Step Cloning Kit.

[0070] Thaw DH5α competent cells stored at -80 °C on ice. Add 10 μL of the recombinant ligation product, mix gently, and place on ice for 30 min. Incubate at 42 °C for 45 s in a water bath, then quickly place on ice for 2 min. Add 700 μL of antibiotic-free LB medium, mix well, and incubate at 37 °C and 200 r / min for 1 h in a shaker. Prepare solid LB plates containing 100 μg / mL Ampicillin. Spread 200 μL of cultured bacteria onto the LB plates, seal with sealing film, and incubate upright at 37 °C for 20 min, then invert overnight. Pick single colonies and transfer them to 2 mL EP tubes containing 1 mL of LB liquid medium (containing 100 μg / mL Ampicillin), and incubate at 37 °C and 200 r / min for 6 h in a shaker.

[0071] Plasmids were extracted using a plasmid miniprep kit, followed by double enzyme digestion for identification. The double enzyme digestion reaction mixture consisted of 1 μL 10× Buffer, 1 μL plasmid, 0.5 μL NotI, 0.5 μL BamHI, and 7 μL sterile water. After incubation at 37 °C for 1 h, agarose gel electrophoresis was performed. Colony PCR was performed using positive clones, and the products were sequenced. The bacterial strain was preserved in 15% glycerol. After confirming the sequence was correct, large-scale plasmid extraction was performed.

[0072] (2) Construction of DDX6 interference lentiviral vector The shRNA interference target sequence GAGTATGACCACCACTATTAA was designed based on the CDS sequence of yak DDX6, using LV10N (U6 / mCherry & Puro) as the vector. An LV10N-shRNA DNA template was designed and synthesized, with ampicillin resistance. DNA oligosaccharides were dissolved in TE buffer (pH 8.0) at a concentration of 100 μM.

[0073] Annealing reaction system: 5 μL 10× DNA Annealing Buffer, 5 μL Sense strand (100 μM), 5 μL Antisense strand (100 μM), 35 μL sterile water. Annealing reaction conditions: 95 ℃ for 5 min; 85 ℃ for 5 min; 75 ℃ for 5 min; 70 ℃ for 5 min. After annealing, shRNA template (10 μM) was obtained, which was diluted to a concentration of 0.2 μM. Linearized vector LV10N (U6 / mCherry & Puro) was prepared using restriction endonucleases (XhoI and HpaI), and then ligated to double-stranded DNA oligosaccharide using Fermentas T4 DNA ligase. The ligation product was used to transform *E. coli* competent cells, positive clones were identified by PCR and sequenced for verification, followed by plasmid extraction.

[0074] 5. Lentiviral packaging and titer detection (1) Passage 293T cells into 15 cm culture dishes and incubate overnight in a carbon dioxide cell culture incubator.

[0075] (2) Add the overexpression or interference shuttle plasmid and packaging plasmid (pGag / Pol, pRev, pVSV-G) to 1.5 mL of DMEM basal medium (serum-free) in proportion and mix well. Add 0.3 mL of RNAi-mate to 1.5 mL of DMEM basal medium (serum-free) and mix well. After standing at room temperature for 5 min, mix the two tubes and stand at room temperature for 25 min.

[0076] (3) Remove the culture medium from the 15 cm culture dish, replace it with 8 mL of DMEM basal medium (serum-free), add the plasmid mixture dropwise into the culture dish, gently shake the culture dish, and incubate in a carbon dioxide cell culture incubator for 6 h.

[0077] (4) Remove the culture medium and replace it with 18 mL of DMEM medium containing 10% FBS. Incubate the cells in a cell culture incubator for 72 h.

[0078] (5) Collect the culture medium, centrifuge at 4000 r / min for 4 min at 4 ℃, filter the supernatant through a 0.45 μm filter membrane, centrifuge at 20000 r / min for 2 h at 4 ℃, and store at -80 ℃ after aliquoting.

[0079] (6) 293T cells were subjected to 3 × 10 4 The cells were seeded at a density of 1 cell per well in 96-well plates, mixed well, and incubated in a CO2 cell culture incubator for 24 h.

[0080] (7) Dilute the lentivirus stock solution to 10 g / L. -1 10 -2 10 -3 10 -4 These are the four concentrations.

[0081] (8) Remove the culture medium from the 96-well plate, add 0.1 mL of diluted lentivirus to each well, and set up a blank control group. Incubate in a CO2 cell culture incubator for 24 h. Remove the lentivirus solution, replace it with DMEM medium containing 10% FBS, and incubate in a CO2 cell culture incubator for 72 h.

[0082] (9) FACS counts the number of fluorescent cells and calculates the viral titer.

[0083] 6. Lentiviral MOI Screening Yak myoblasts at a rate of 1 × 10 5Cells were seeded at a density of [number] cells / mL in 96-well plates, gently shaken, and incubated at 37 °C in a 5% CO2 incubator for 24 h. The old culture medium was removed and replaced with a fresh half-volume of complete myoblast medium (50 μL per well in a 96-well plate). LV8N-DDX6 (overexpressing lentivirus) and LV8N-NC (negative control) with MOIs of 5, 10, and 15, and LV10N-DDX6 (interfering lentivirus) and LV10N-NC (negative control) with MOIs of 10, 20, and 40, were added to the medium. The blank control was directly supplemented with the full volume of complete myoblast medium. Each titer was repeated three times. Four h later, the transfected cells were supplemented with the remaining half of the culture medium (50 μL per well in a 96-well plate). The blank control was left untreated. After culturing for 20 h and 44 h (i.e., 24 h and 48 h after lentivirus transfection), all old culture medium was removed and replaced with fresh myoblast complete culture medium. Transfected cells were then treated with 0.02% 10 mg / mL puromycin solution (working concentration 2 μg / mL). After culturing for another 24 h (i.e., 72 h after lentivirus transfection), observation and photography were performed using an inverted fluorescence microscope. The old culture medium was then removed and replaced with fresh myoblast complete culture medium, and 10 μL of CCK-8 reagent was added to each well. Cells were incubated at 37 ℃ for 30 min, and the cells were analyzed using a microplate reader at OD500. 450 Measure the absorbance.

[0084] 7. Screening of stable transgenic lines of yak myoblasts Based on the above results, the optimal MOI value for both overexpression and interference lentivirus was determined to be 10. Yak myoblasts were seeded in 10 cm culture dishes using the above method and transfected with overexpression and interference lentiviruses at an MOI of 10 for 24 h. The virus-containing medium was removed, and the cells were replaced with complete myoblast culture medium containing puromycin solution (working concentration 2 μg / mL) every 24 h for a total of 48 h. After removing the medium, the cells were washed once with HBSS, digested with 0.25% trypsin for approximately 2 min, and the digestion was terminated by adding an appropriate amount of FBS. The cells were then collected by centrifugation at 1600 r / min for 6 min, resuspended in complete myoblast culture medium, and passaged. Subsequently, each time cells were revived (18 h after seeding) or the previous generation of cells before plating, the cells were treated with puromycin solution, and fluorescence was observed under a fluorescence microscope. If necessary, RT-qPCR and Western Blot were used to detect DDX6 expression levels to evaluate the transfection effect of yak myoblasts.

[0085] Subsequently, the overexpression group (HX+oeDDX6 group) of this invention used cells transfected with LV8N-DDX6 and selected for stable transfection lines. However, in practice, it was found that cells transfected with LV10N-DDX6 could not be passaged twice, that is, the transfected cells could only be passaged once. Therefore, in subsequent studies, the interference group (HX+shDDX6 group) used cells that had been passaged once after transfection.

[0086] In this invention, all experiments used yak myoblasts that had been passaged no more than 6 times since self-isolation, i.e., yak myoblasts within 6 passages.

[0087] 8. Detection of transfection efficacy of yak myoblasts (1) Cell collection and lysis The experiment consisted of three groups: a control group, a DDX6 overexpression group (oeDDX6, transfected with LV8N-DDX6 overexpressing lentivirus), and a DDX6 interference group (shDDX6, transfected with LV10N-DDX6 interfering lentivirus). Yak myoblasts were seeded in 6 cm culture dishes according to the above method, with three replicates per group. Cells were transfected with the overexpressing and interfering lentiviruses at an MOI of 10 and cultured for 72 h. The culture medium was then removed, and the cells were washed once with HBSS.

[0088] Cells were digested with 0.25% trypsin for approximately 2 minutes. After adding an appropriate amount of FBS to terminate digestion, the cells were transferred to a 1.5 mL sterile conical centrifuge tube and centrifuged at 1600 rpm for 6 minutes to remove the supernatant. Cells were resuspended in an appropriate amount of cell lysis buffer, incubated at 4 °C for 10 minutes, vortexed, and then incubated at 4 °C for another 10 minutes. The cells were centrifuged at 12000 rpm for 20 minutes, and the supernatant was collected. A suitable sample was reserved for BCA measurement.

[0089] (2) BCA determination of protein samples Prepare the BCA working solution according to the instructions. Add 25 μL of protein sample and 200 μL of BCA working solution to each well of a 96-well plate, mix well, and incubate at 37 °C for 30 min using a microplate shaker. After incubating at room temperature for 3 min to remove all air bubbles, then incubate at OD... 585 Measure the absorbance and calculate the protein concentration of each sample based on the standard curve.

[0090] (3) SDS-PAGE gel electrophoresis Cellular protein samples were mixed with SDS-PAGE protein loading buffer (5×) at a ratio of 4:1 and added to 0.2 mL PCR tubes. The tubes were incubated at 95 °C for 8 min using a dry incubator to denature the proteins. A 1.0 mm SDS-PAGE gel was prepared according to the manufacturer's instructions. Protein samples were then loaded onto the gel according to the BCA results and subjected to SDS-PAGE gel electrophoresis at 100 V for approximately 100 min.

[0091] (4) Transfer membrane Assemble the transfer "sandwich" as follows: Place a WB paperless transfer sponge on the red transfer clamp (positive electrode); immerse the PVDF membrane in methanol solution for about 20 seconds to activate it until it becomes translucent, then place it on the sponge from the previous step; remove the SDS-PAGE gel, cut off the stacking gel and the bottom bromophenol blue portion, and lay it flat on the PVDF membrane from the previous step; cover with another WB paperless transfer sponge, close the transfer clamp, and immerse it in transfer buffer to equilibrate at room temperature for 2 minutes. Place the transfer electrophoresis apparatus in ice, add pre-cooled transfer buffer at 4 °C to the tank, insert the transfer clamp, and transfer at 400 mA for about 40 minutes.

[0092] (5) Antibody incubation After transfer, remove the PVDF membrane and wash it once with Western blotting buffer (place on a decolorizing shaker for 5 min). Remove the washing buffer, add 8 mL of QuickBlock™ Western blocking buffer, and incubate on a decolorizing shaker at room temperature for approximately 20 min. Remove the blocking buffer and wash once with Western blotting buffer (place on a decolorizing shaker for 5 min). Add DDX6 antibody (rabbit polyclonal antibody, dilution 1:3000, PA5-27786, Invitrogen, USA) diluted with primary antibody dilution buffer to the incubation chamber, immerse the PVDF membrane, and incubate at 4 ℃ for 12 h. Use β-Actin antibody (rabbit polyclonal antibody, dilution 1:4000, 20536-1-AP, Proteintech, China) as the internal control.

[0093] Remove the primary antibody and wash three times with 8 mL of Western blotting buffer (5 min each time on a decolorizing shaker). Add goat anti-rabbit IgG secondary antibody diluted with Western blotting buffer (1:80000, A0545, SIGMA-ALDRICH, USA) and incubate on a decolorizing shaker at room temperature in the dark for 1 h. Remove the primary antibody and wash three times with 8 mL of Western blotting buffer (5 min each time on a decolorizing shaker).

[0094] (6) Development The PVDF membrane was immersed in the developing solution and incubated in the dark for about 2 minutes. It was then observed and photographed using an iBright CL1000.

[0095] (7) Relative quantification Image Pro Plus 6.0 was used to calculate the grayscale values ​​of the stripes and to perform relative quantitative calculations.

[0096] 9. Establishment and identification of a hypoxia model of yak myoblasts Yak myoblasts at 1×10 5 Cells were seeded at a density of [number] cells / mL in 96-well plates, gently shaken, and incubated at 37 °C in a 5% CO2 incubator for 24 h. The old culture medium was removed, and myoblast complete culture medium containing 0, 100, 150, 200, 250, 300, 350, and 400 μM CoCl2 was added, with three biological replicates for each concentration. Fresh myoblast complete culture medium with the corresponding CoCl2 concentration was added every 24 h. After 72 h of culture, cell viability was assessed using the CCK-8 assay.

[0097] Based on cell viability assay results, a CoCl2 concentration of 150 μM was selected for identifying the hypoxia model. Following the above method, cells were cultured in 10 cm culture dishes, and the myoblast complete medium containing 150 μM CoCl2 was replaced every 24 h. The control group used myoblast complete medium without CoCl2, with three biological replicates per group. After 72 h of culture, the medium was removed, 500 μL of cell lysis buffer was added, and cells were quickly scraped off using a cell scraper and collected in 1.5 mL conical centrifuge tubes. Cells were sonicated at 300 W for 2 s using an ultrasonic cell homogenizer. Immediately, the sample was mixed with SDS-PAGE protein loading buffer (5×) at a 4:1 ratio and added to a 0.2 mL PCR tube. The cells were incubated at 95 ℃ for 8 min in a dry incubator to denature them. The total time from removal of the medium to protein loading should not exceed 5 minutes. A portion of the sample was reserved for BCA assay, and protein samples were loaded proportionally according to the BCA results and subjected to SDS-PAGE gel electrophoresis. Western blotting was used to assess the effectiveness of the hypoxia model establishment. The primary antibody against HIF-1α (rabbit monoclonal antibody, diluted 1:1000, 36169S, Cell Signaling Technology, USA) was used, and the internal control was β-Actin (rabbit polyclonal antibody, diluted 1:4000, 20536-1-AP, Proteintech, China). RT-qPCR was also used to assess the transcriptional level of HIF-1α (Primer-3) cells in this assay.

[0098] 10. Mycoplasma cytogenes detection Since mycoplasma contamination has a significant impact on cell proliferation and metabolism, especially RNA-related assays, all assays in this invention are performed before plating and sample collection. As long as the sample is confirmed to be free of mycoplasma contamination, the assay or assay can proceed.

[0099] This invention uses an isothermal amplification method mycoplasma detection kit to detect mycoplasma contamination in cell culture media. 23 μL of Mycored Buffer and 1 μL of MycoRed Enzyme are added to the bottom of a 0.2 mL PCR tube, followed by a 20 μL Paraffin Oil layer. 1 μL of old culture medium or a positive control (mycoplasma positive control) is added below the surface of the Paraffin Oil. After incubation at 65 °C for 30 min in a dry incubator, the experimental group and the mycoplasma positive control are compared colorimetrically.

[0100] 11. Effects of DDX6 on the cell cycle of yak myoblasts under hypoxia EdU-DAPI was used to assess the effect of DDX6 on the cell cycle of yak myoblasts under hypoxic conditions, and RT-qPCR was used to perform relative quantitative analysis of cell cycle-related genes (Primer-4 to Primer-9).

[0101] This experiment consisted of four groups: a control group, a hypoxia treatment group (Hypoxia, HX, supplemented with 150 μM CoCl2), a hypoxia-overexpressing DDX6 group (HX+oeDDX6, supplemented with 150 μM CoCl2, and transfected with LV8N-DDX6 overexpressing lentivirus), and a hypoxia-interfering DDX6 group (HX+shDDX6, supplemented with 150 μM CoCl2, and transfected with LV10N-DDX6 interfering lentivirus), with three biological replicates per group. Subsequent experiments followed this grouping protocol. Yak myoblasts were induced at a rate of 1 × 10⁻⁶. 5 Seeds were inoculated at a density of cells / mL into 6 cm culture dishes, gently shaken, and incubated at 37 °C in a 5% CO2 incubator for 24 h. The old culture medium was removed and replaced with serum-diluted medium, and the cells were incubated for another 24 h. After starvation, the old culture medium was removed and replaced with complete myoblastic culture medium containing 150 μM CoCl2 under hypoxia. The medium was changed every 24 h.

[0102] Cell cycle analysis was performed using the EdU-488 cell proliferation assay kit, DAPI dye, and flow cytometry. The specific methods are as follows: (1) When the cell confluence is 70%-80%, remove half of the culture medium, add an equal volume of preheated 2× EdU working solution, and incubate in a cell culture incubator for 2 h.

[0103] (2) Wash the cells once with HBSS, digest the cells with 0.25% trypsin digestion solution for about 2 min, add an appropriate amount of serum to stop digestion, mix well and transfer to a 1.5 mL sterile conical centrifuge tube.

[0104] (3) Centrifuge at 1600 r / min for 6 min to remove the supernatant, add 1 mL of 4% paraformaldehyde and fix at room temperature for 15 min.

[0105] (4) Centrifuge at 1600 r / min for 6 min to remove fixative, and add 1 mL of EdU washing solution to resuspend the cells.

[0106] (5) Centrifuge at 1600 r / min for 6 min to remove EdU washing solution, add 1 mL EdU permeation solution and permeate at room temperature for 15 min.

[0107] (6) Centrifuge at 1600 r / min for 6 min to remove EdU permeate, add 1 mL EdU washing solution, centrifuge and retain the precipitate.

[0108] (7) Add 0.5 mL of Click reaction solution, gently resuspend and incubate at room temperature in the dark for 30 min.

[0109] (8) Centrifuge at 1600 r / min for 6 min to remove the Click reaction solution, add 1 mL EdU washing solution, centrifuge again to retain the precipitate.

[0110] (9) Add 0.3 mL of DAPI staining reagent, stain at room temperature in the dark for 30 min, filter through a 40 μm cell sieve, and analyze using a flow cytometer.

[0111] (10) Use FlowJo 10.8.1 for statistics and plotting.

[0112] 12. Effects of DDX6 on the proliferation of yak myoblasts under hypoxia (1) CCK-8 Yak myoblasts at a rate of 1 × 10 5 Cells were seeded at a density of 1 cell / mL in 96-well plates, with 5 biological replicates per group. After gentle mixing, the plates were incubated at 37 °C in a 5% CO2 incubator for 24 h. The medium was then replaced with complete myoblast culture medium every 24 h, either without CoCl2 (Control) or containing 150 μM CoCl2 (HX, HX+oeDDX6, and HX+shDDX6). Cell viability was assessed using CCK-8 assays after 72 h of culture.

[0113] (2) Cell growth curve In this experiment, the growth curves of cells in each group were measured using the Agilent xCELLigence RTCA S16 system. 50 μL of complete myoblast culture medium (without CoCl2 and containing 150 μM CoCl2) were added to E-Plate 16-well plates, respectively. After incubation at room temperature for 15 min, the plates were inserted into the xCELLigence RTCA S16 for baseline calibration. Cells were seeded into E-Plate 16-well plates using the same method, and the corresponding culture medium was added to a final volume of 150 μL, with four biological replicates per group. After incubation at room temperature for 30 min, the plates were inserted into the xCELLigence RTCA S16 to begin real-time cell index monitoring. Scans were performed every 30 min for a total of 145 scans, covering a total of 72 h. Cell growth curves were plotted using RTCA Software Lite 2.2.5.

[0114] (3) Detection of transcriptional levels of proliferation-related genes This study used RT-qPCR to detect the transcriptional levels of proliferation-related genes (Primer-10 to Primer-11) and also detected the transcriptional levels of DDX6 (Primer-2) in each group.

[0115] Table 2. Oligonucleotides involved in this invention. .

Claims

1. A type of yak myoblast overexpressing the DDX6 gene, characterized in that, It contains the DNA sequence shown in SEQ ID NO.

4.

2. The application of yak myoblasts overexpressing the DDX6 gene as described in claim 1, characterized in that, It was used to regulate the cell cycle and proliferation of yak myoblasts under hypoxic conditions.

3. The method for constructing yak myoblasts overexpressing the DDX6 gene as described in claim 1, characterized in that, Includes the following steps: Step (1) Extraction of total RNA and synthesis of cDNA from yak myoblasts Frozen primary yak embryonic skeletal muscle myoblasts were revived, inoculated into cell culture dishes, and cultured in a constant temperature incubator using complete myoblast culture medium. Cells cultured for 0 days, 1 day, 2 days, 3 days, and 4 days were collected, and total RNA was extracted from the cells using the Trizol method. Complementary DNA, abbreviated as cDNA, was synthesized through reverse transcription. Step (2) Amplification and sequence analysis of the CDS region of the yak DDX6 gene Using the cDNA obtained in step (1) as a template, DNA polymerase was used for PCR amplification, and sequencing was performed to obtain the complete CDS region sequence of the yak DDX6 gene with the correct sequence. Step (3) Temporal expression analysis of DDX6 during myoblast proliferation Based on the CDS region sequence of the yak DDX6 gene obtained in step (2), specific real-time fluorescence quantitative polymerase chain reaction primers were designed. Using the 0-d to 4-d yak myoblast cDNA obtained in step (1) as a template and the yak β-Actin gene as an internal reference gene, RT-qPCR was performed to analyze the temporal expression pattern of the DDX6 gene in the proliferation process of yak myoblasts. Step (4) Construction of DDX6 lentivirus overexpression vector and interference vector Using NotI and BamHI as double restriction sites, and referring to the complete CDS region sequence of the yak DDX6 gene obtained in step (2) as a template, primers for amplifying the CDS region of the DDX6 gene containing restriction sites were designed and synthesized; PCR amplification was performed using these primers, and then the target gene fragment was recovered and purified; the target fragment was double-digested, ligated and transformed with the EF-1a / mCherry&Puro lentiviral vector, and positive single colonies were selected for sequencing verification to obtain the DDX6 overexpression recombinant plasmid with the correct sequence; based on the CDS region sequence of the yak DDX6 gene obtained in step (2), the shRNA interference target sequence was designed as GAGTATGACCACCACTATTAA, and the corresponding upstream and downstream Oligo sequences were synthesized. The upstream and downstream Oligo sequences were mixed in equal volumes to prepare Oligo mix, annealed and ligated to the U6 / mCherry&Puro lentiviral vector, and positive single colonies were selected for sequencing verification after transformation to obtain the DDX6 interference recombinant plasmid with the correct sequence; Step (5) Lentiviral Packaging and Titer Detection The DDX6 overexpression recombinant plasmid and DDX6 interference recombinant plasmid obtained in step (4) were co-transfected with lentiviral packaging plasmid into 293T cells. After transfection, fresh complete culture medium was replaced and cultured for a longer period. The cell culture supernatant was collected, filtered through a filter membrane, and concentrated by ultracentrifugation to obtain DDX6 overexpression lentivirus and DDX6 interference lentivirus. The lentivirus titer was detected by gradient dilution. Step (6) Lentiviral optimal infection multiple screening Yak myoblasts in the logarithmic growth phase were seeded into 96-well cell culture plates and cultured in a CO2 cell incubator. Overexpression lentivirus groups with MOI values ​​of 5, 10, and 15, and interference lentivirus groups with MOI values ​​of 10, 20, and 40 were set up, along with a blank control group. Each group had three replicate wells. After infection, the culture medium was replaced with fresh myoblast complete culture medium. Cell viability was detected using a Cell Counting Kit-8, and mCherry fluorescence expression was analyzed under a fluorescence microscope to screen for the optimal MOI value that achieved the best overexpression / interference effect and the lowest cytotoxicity. Step (7) Screening of stable yak myoblast transgenic lines Yak myoblasts in the logarithmic growth phase were seeded into cell culture dishes and cultured. DDX6 overexpressing lentivirus and DDX6 interfering lentivirus were added according to the optimal MOI value of 10 determined in step (6), and an empty lentivirus control group was set up. After transduction, the myoblast complete culture medium containing puromycin solution was replaced to obtain stable transgenic strains of DDX6 overexpressing yak myoblasts and DDX6 interfering yak myoblasts. Step (8) Detection of transduction effect of yak myoblasts Yak myoblasts obtained in step (7) were collected from the DDX6 overexpression group, interference group, and empty vector control group. Total protein was extracted from one part of the cells, and the expression level of intracellular DDX6 protein was detected by Western blotting with DDX6-specific antibody. Total RNA was extracted from the other part of the cells, and cDNA was synthesized by reverse transcription. The mRNA transcription level of intracellular DDX6 gene was detected by RT-qPCR. The complete culture medium for myoblasts in steps (1), (6) and (7) consists of 10% FBS, 1% penicillin-streptomycin-amphoteric B, 1% L-Alanyl-L-Glutamine and 88% DMEM basal medium, by volume percentage.

Images