A papE-cas12i3-5m fusion protein and its application in rice single gene and multi gene editing

CN122609542APending Publication Date: 2026-08-21INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202610807140.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-12-13
Publication Date
2026-08-21

AI Technical Summary

Technical Problem

然而,在He等人的研究中,通过将Trex2外切酶与FrCas9融合,其在水稻稳定植株中可以产生更大片段的基因组删除但编辑效率没有进一步提升 (He et al. 2024)

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The application discloses a PapE-Cas12i3-5M fusion protein and application thereof in single-gene and multi-gene editing of rice, and belongs to the field of biological gene editing. The technical problem solved by the application is how to edit multiple genes. The sequence of the disclosed PapE-Cas12i3-5M fusion protein is SEQ ID No. 10. The PapE-Cas12i3-5M fusion protein of the application can not only improve the editing efficiency of single genes, but also edit multiple genes, and has good editing efficiency. The application can be used for crop gene function research and creation of new crop germplasm by aggregating multiple excellent alleles.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] This application is a divisional application of 202411838860.2, the original application being filed on December 13, 2024, and entitled "A Fusion Protein and Its Application in Single and Multiple Gene Editing in Rice". Technical Field

[0002] This invention belongs to the field of biological gene editing, specifically relating to a PapE-Cas12i3-5M fusion protein and its application in single-gene and multi-gene editing in rice. Background Technology

[0003] The CRISPR / Cas system, especially the class II system, has advantages such as ease of operation and high efficiency, and has been developed into an important tool for gene editing. This includes CRISPR / Cas9 (Bortesi et al. 2016, Liu et al. 2023, Shan et al. 2013), CRISPR / Cas12a (Xu et al. 2017, Zheng et al. 2023, Tang et al. 2017), CRISPR / Cas12b (Ming et al. 2020), and CRISPR / Cas12i3 (Lv et al. 2024, Zhang et al. 2023). The development of these tools has greatly accelerated the progress of crop gene function research and crop breeding. Multi-gene editing technology based on the CRISPR / Cas system can simultaneously perform targeted editing of multiple genes, enabling rapid and efficient aggregation of multiple superior alleles in a single generation. In recent years, the establishment of CRISPR / Cas-based multi-gene editing systems has provided new opportunities for the genetic improvement of crops such as rice, wheat, and maize (Li et al. 2024, Li et al. 2019, Wang et al. 2017, Lorenzo et al. 2023, Luo et al. 2021, Li et al. 2021, Pan et al. 2024).

[0004] In CRISPR / Cas12-like systems, Cas proteins, guided by crRNA, typically cleave specific sites in the genome in an interleaved manner, producing sticky 5'-ends after cleavage (Zetsche et al., 2015). Type I V CRISPR / Cas12i3 recognizes the 5'-TTN-3' PAM sequence and can edit "AT"-rich non-coding regions. Lv et al. successfully knocked out four endogenous genes in rice using the CRISPR / Cas12i3 system, but the overall editing efficiency was low (Lv et al., 2024). Subsequently, Duan et al. developed the Cas12i3-5M (S7R / D233R / D267R / N369R / S433R) variants through rational design, which significantly improved the editing efficiency of Cas12i3 in rice, soybean, and pepper. Specifically, Cas12i3-5M achieved an editing efficiency of approximately 75% at all three rice endogenous gene targets (Duan et al., 2024). The development of the Cas12i3-5M variants provides important technical support for the further widespread application of CRISPR / Cas12i3 in crops. However, there are currently no reports on the simultaneous editing of multiple genes or multiple targets using Cas12i3-5M.

[0005] Studies have shown that fusing exonucleases with Cas proteins can improve editing efficiency and increase the length of deleted genomic fragments (Liang et al. 2023, Wu et al. 2020). Exonucleases can hydrolyze the protruding ends of double-strand breaks. Based on the cleavage characteristics of Cas12i3, fusing 5'–3' exonucleases with Cas12i3 is expected to further improve editing efficiency. Currently, commonly used exonucleases for digesting single-stranded or double-stranded DNA in the 5' to 3' direction include bacteriophage T5 exonuclease (T5E) (Liang et al. 2023), T7 exonuclease (T7E) (Zhang et al. 2024), as well as herpes simplex virus 1 (HSV1) UL12 exonuclease (UL12) (Schreiber et al. 2024), UL12-like exonuclease (PapE) from Papiinealpha herpesvirus II, T7E-like exonuclease (ME15) from bacteriophage IME15 (Schreiber et al. 2024), and triproto-repair exonuclease 2 (Trex2) (Pan et al. 2024), etc. However, in the study by He et al., by fusing the Trex2 exonuclease with FrCas9, larger segments of the genome could be deleted in stable rice plants, but the editing efficiency was not further improved (He et al. 2024). Summary of the Invention

[0006] The technical problem to be solved by this invention is how to improve the editing efficiency of the rice genome and how to edit multiple genes.

[0007] To solve the above-mentioned technical problems, the present invention first provides a fusion protein containing an exonuclease and Cas12i3-5M, wherein the exonuclease is UL12, T5E, ME15 or PapE.

[0008] In the aforementioned fusion protein, UL12 can be one of the following: A1), A2), or A3). A1) The amino acid is the protein at positions 20-344 of SEQ ID No. 6; A2) A protein that has the same function as SEQ ID No. 6, with one or more amino acid residues substituted and / or deleted and / or added at positions 20-344; A3) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of A1) or A2); The T5E can be B1), B2), or B3 as follows: B1) The amino acid is the protein located at positions 20-309 of SEQ ID No. 8; B2) Proteins that have the same function by substituting and / or deleting and / or adding one or more amino acid residues at positions 20-309 of SEQ ID No. 8; B3) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of B1) or B2); The PapE can be one of the following: C1), C2), or C3). C1) Amino acid is the protein located at positions 20-625 of SEQ ID No. 10; C2) A protein having the same function by substituting and / or deleting and / or adding one or more amino acid residues from position 20 to 625 of SEQ ID No. 10; C3) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of C1) or C2); The ME15 can be D1), D2), or D3 as follows: D1) The amino acid is the protein at positions 20-322 of SEQ ID No. 12; D2) A protein with the same function by substitution and / or deletion and / or addition of one or more amino acid residues at positions 20-322 of SEQ ID No. 12; D3) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of D1) or D2); The Cas12i3-5M can be E1), E2), or E3 as follows: E1) The amino acid is the protein at positions 42-1089 of SEQ ID No. 4; E2) A protein that has the same function by substituting and / or deleting and / or adding one or more amino acid residues from position 42 to 1089 of SEQ ID No. 4; E3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of E1) or E2).

[0009] The protein in A2) above is a protein that shares 75% or more amino acid sequence identity with the protein in A2) and has the same function. The protein in B2) above is a protein that shares 75% or more amino acid sequence identity with the protein in B2) and has the same function. The protein in C2) above is a protein that shares 75% or more amino acid sequence identity with the protein in C2) and has the same function. The protein in D2) above is a protein that shares 75% or more amino acid sequence identity with the protein in D2) and has the same function. The protein in E2) above is a protein that shares 75% or more amino acid sequence identity with the protein in E2) and has the same function. Identity refers to the similarity of amino acid sequences. Amino acid sequence identity can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in advanced BLAST2.1, by using blastp as the procedure, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, and setting the Gapexistence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity calculation for a pair of amino acid sequences, the identity value (%) can be obtained. The identity of 75% or higher is defined as 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.

[0010] The proteins in A2), B2), C2), D2), and E2) above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0011] The tags described in A3), B3), C3), D3), and E3) can be polypeptides or proteins fused with the target protein using in vitro DNA recombination technology, to facilitate the expression, detection, tracing, and / or purification of the target protein. These tags can be Poly-Arg, Poly-His, FLAG, Strep-tag II, c-myc, MBP tag, HA tag, GST tag, and / or SUMO tag, etc.

[0012] The aforementioned fusion proteins may also contain nuclear localization signals and / or linker peptides.

[0013] The exonuclease, Cas12i3-5M, and nuclear localization signal can be directly linked or linked via common linker peptides, as long as it does not affect the function of the base editor. Here, "linkage" refers to a peptide bond formed between proteins or polypeptides through a C-terminal amino acid residue of one protein or polypeptide and an N-terminal amino acid residue of another protein or polypeptide.

[0014] In an embodiment of the present invention, the linker peptide is the polypeptide represented by positions 345-406 of SEQ ID No. 6.

[0015] The sequence of the nuclear positioning signal may be bits 2-19 of SEQ ID No. 6 and / or bits 1478-1521 of SEQ ID No. 6.

[0016] The aforementioned fusion protein may be UL12-Cas12i3-5M fusion protein, T5E-Cas12i3-5M fusion protein, PapE-Cas12i3-5M fusion protein, or ME15-Cas12i3-5M fusion protein. The UL12-Cas12i3-5M fusion protein is a protein whose amino acid composition is SEQ ID No. 6; The T5E-Cas12i3-5M fusion protein is a protein whose amino acid composition is SEQ ID No. 8; The PapE-Cas12i3-5M fusion protein is the protein whose amino acid composition is SEQ ID No. 10. The ME15-Cas12i3-5M fusion protein is the protein with amino acids that is SEQ ID No. 12.

[0017] The present invention also provides biomaterials related to the fusion protein, said biomaterials being at least one of the following (H1)-H4): H1) is a nucleic acid molecule encoding the fusion protein; H2) contains an expression cassette containing the nucleic acid molecule described in H1); H3) A recombinant vector containing the nucleic acid molecule described in H1) or a recombinant vector containing the expression cassette described in H2); H4) Recombinant microorganisms containing the nucleic acid molecules described in H1), recombinant microorganisms containing the expression cassette described in H2), or recombinant microorganisms containing the recombinant vector described in H3).

[0018] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA.

[0019] In the nucleic acid molecule described in H1), the nucleic acid molecule encoding the UL12 may be a DNA molecule whose coding sequence is the 58th to 1032nd positions of SEQ ID No. 5 in the sequence listing; The nucleic acid molecule encoding the T5E can be a DNA molecule whose coding sequence is positions 58-927 of SEQ ID No. 7 in the sequence listing; The nucleic acid molecule encoding the PapE can be a DNA molecule whose coding sequence is SEQ ID No. 9 in the sequence listing, positions 58-1875; The nucleic acid molecule encoding ME15 can be a DNA molecule whose coding sequence is positions 58-966 of SEQ ID No. 11 in the sequence listing; The nucleic acid molecule encoding the Cas12i3-5M can be a DNA molecule whose coding sequence is positions 124-3267 of SEQ ID No. 3 in the sequence listing.

[0020] Specifically, the nucleic acid molecule encoding the UL12-Cas12i3-5M fusion protein can be a DNA molecule whose coding strand has the nucleotide sequence shown in SEQ ID No. 5; The nucleic acid molecule encoding the T5E-Cas12i3-5M fusion protein may be a DNA molecule whose coding strand has the nucleotide sequence shown in SEQ ID No. 7; The nucleic acid molecule encoding the PapE-Cas12i3-5M fusion protein may be a DNA molecule whose coding nucleotide sequence is shown in SEQ ID No. 9; The nucleic acid molecule encoding ME15-Cas12i3-5M may be a DNA molecule whose coding strand nucleotide sequence is shown in SEQ ID No. 11.

[0021] In the aforementioned biological materials, the expression cassette refers to DNA capable of expressing the fusion protein in a host cell (such as a plant cell). This DNA may include not only a promoter to initiate transcription of the fusion protein-coding gene, but also a terminator to terminate transcription of the fusion protein-coding gene. Furthermore, the expression cassette may also include an enhancer sequence. Promoters that can be used in this invention include, but are not limited to: constitutive promoters, tissue-, organ-, and development-specific promoters, and inducible promoters. Examples of promoters include, but are not limited to: the Ubiquitin promoter from maize; the constitutive promoter 35S from cauliflower mosaic virus; the wound-inducible promoter from tomato, leucine aminopeptidase ("LAP"); the chemically induced promoter from tobacco, pathogenesis-associated protein 1 (PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-thiohydroxy acid S-methyl ester)); the tomato protease inhibitor II promoter (PIN2) or the LAP promoter (both induced by methyl jasmonic acid); heat shock promoters (US Patent 5,187,267); tetracycline-inducible promoters (US Patent 5,057,422); seed-specific promoters, such as the millet seed-specific promoter pF128 (CN101063139B (Chinese Patent 2007 1 0099169.7)); and promoters specific to seed storage proteins (e.g., beta-gammaglobulin, napin, oleosin, and soybean beta-conglycin). Promoters. They can be used alone or in combination with other plant promoters. All references cited herein are cited in full. Suitable transcription terminators include, but are not limited to: Agrobacterium carmine synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator, and carmine and octopine synthase terminator.

[0022] In one embodiment of the present invention, the promoter in the expression cassette described in H2) is a ubiquitous promoter and the terminator is an E9 terminator.

[0023] In the aforementioned biological materials, the carrier may be a plasmid, a granule, a bacteriophage, or a viral vector.

[0024] In the above-mentioned biological materials, the recombinant vector described in H3 may also contain a crRNA expression cassette, which can transcribe crRNA targeting the target gene.

[0025] The crRNA expression cassette contains a DNA fragment of tRNA shown at positions 1327-1403 of SEQ ID No. 13, a DR sequence of Cas12i3 crRNA shown at positions 1404-1439 or 1417-1439, and a DNA fragment of HDV shown at positions 1448-1515.

[0026] In the crRNA expression cassette, the promoter may be the 35S complex promoter shown in positions 1-1326 of SEQ ID No. 13, and / or the terminator may be the tH4 terminator shown in positions 1516-1765 of SEQ ID No. 13.

[0027] The crRNA expression cassette may be as shown in SEQ ID No. 13.

[0028] The recombinant vector described in H3 also contains an Hpt gene expression cassette.

[0029] In the aforementioned biological materials, the microorganisms may be yeast, bacteria, algae, or fungi. Among them, bacteria may be Agrobacterium.

[0030] The application of the fusion protein in rice gene editing is also within the scope of protection of this invention.

[0031] The application of the biomaterials in rice gene editing is also within the scope of protection of this invention.

[0032] In the above applications, the gene may be a single gene or multiple genes.

[0033] The plurality of genes can be 2, 3, 4, 5, 6, 7, 8, 9, or more.

[0034] When performing multiple gene editing, the target sequence can be spaced using the DNA sequence of tRNA and / or the DNA sequence of the nuclease HDV.

[0035] The fusion proteins of this invention can all improve editing efficiency, among which the UL12-Cas12i3-5M strategy has the highest single-gene knockout efficiency, with editing efficiency increased by up to 12.46 times and 1.25 times compared with Cas12i3 and Cas12i3-5M, respectively, and the average editing efficiency reaching up to 98.61% ± 2.41%. Furthermore, this invention utilizes Cas12i3-5M, T5E-Cas12i3-5M, UL12-Cas12i3-5M, PapE-Cas12i3-5M, and ME15-Cas12i3-5M to edit multiple genes in rice. The results show that the fusion proteins of this invention can all improve multi-gene editing efficiency, among which UL12-Cas12i3-5M maintains the highest editing efficiency in various gene tandem combinations, with editing efficiencies of 82.76%, 61.36%, 52.94%, and 51.07% for simultaneous editing of three, four, five, and six genes, respectively. The establishment of the above-mentioned efficient multi-gene editing system for rice provides an important tool and technical support for using CRISPR / Cas12i3 to conduct crop gene function research and create new crop germplasm by aggregating multiple superior alleles in one generation.

[0036] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way. Attached Figure Description

[0037] Figure 1 Target gene structure diagram.

[0038] Figure 2 Editing vector structure diagram. crRNA1, crRNA2, crRNA3, crRNA4, crRNA5, and crRNA6 represent DNA fragments containing different single gene target sequences, and 3×(HSC) indicates the vector used for editing. OsHRC , OsSBEIIb and OsCKX2 Three genes, 4×(HSCA) indicates that it is used for editing. OsHRC , OsSBEIIb , OsCKX2 and OsARF4 Four genes, 5×(HSCAA) indicates that it is used for editing. OsHRC , OsSBEIIb , OsCKX2 , OsARF4 and OsARE1 Five genes, 6×(HSCAAB) indicates that it is used for editing. OsHRC , OsSBEIIb , OsCKX2 , OsARF4 , OsARE1 and OsBADH2 Six genes.

[0039] Figure 3 The efficiency of single-gene editing in rice mediated by different strategies. Data labeled with different letters showed significant differences, while data labeled with the same letter showed no significant differences.

[0040] Figure 4 The deletion fragment length types generated by the Cas12i3, Cas12i3-5M, T5E-Cas12i3-5M, UL12-Cas12i3-5M, PapE-Cas12i3-5M and ME15-Cas12i3-5M strategies at 6 genomic loci.

[0041] Figure 5 The efficiency of simultaneous editing of three, four, five, and six genes mediated by different strategies. Detailed Implementation

[0042] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials, reagents, and instruments used in the following examples are commercially available. All quantitative experiments in the following examples were performed in at least three replicates. Data were processed using SPSS 11.5 statistical software, and one-way ANOVA was performed. Unless otherwise specified, in the following examples, the first position of each nucleotide sequence in the sequence listing is the 5′ terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3′ terminal nucleotide of the corresponding DNA / RNA.

[0043] Table 1. Target Gene Information Table

[0044] Note: The first three letters of "target sequence" indicate the PAM sequence.

[0045] Table 2. Primer Summary Table

[0046] Example 1 1. Materials and Methods 1.1 Experimental Materials The rice variety used for conversion: Zhonghua 11.

[0047] The Agrobacterium-mediated transformation expression vector used was pHUE411.

[0048] 1.2 Experimental Methods 1.2.1 Target gene selection and target design Rice endogenous genes were retrieved using the EnsemblPlants database (http: / / plants.ensembl.org / Oryza_sativa / Info / Index). OsHRC, OsSBEIIb , OsCKX2, OsARE1, OsBADH2, OsDEP1 and OsARF4 The nucleotide sequences were obtained, and the above candidate genes were cloned from 11 flower samples in the receptor material. Target gene information is shown in Table 1. Target sites were designed based on the PAM sequence "TTN" of Cas12i3. Target site information is shown in [Table 1]. Figure 1 .

[0049] 1.2.2 Construction of Single Gene Editing Vectors In the pHUE411 vector, the Cas protein is derived from corn ( Zea mays The L.) ubiquitin gene promoter initiates transcription, the E9 terminator terminates transcription, and it contains a 35S-Hpt-Nos expression cassette for tissue culture screening. The basic vectors pHUE411-Cas12i3 and pHUE411-Cas12i3-5M were obtained by replacing the Cas9 receptor on the vector. Further, pHUE411-Cas12i3-5M was fused with an exonuclease to construct the basic vector pHUE411-Exo-Cas12i3-5M. The primers used are shown in Table 2.

[0050] (1) Construction of basic vectors: Using artificially synthesized DNA fragments containing the Cas12i3 gene and the Cas12i3-5M gene as templates, the Cas12i3 and Cas12i3-5M fragments were amplified using primers Ubi-Cas12i3-F / E9t-Cas12i3-R and FastPfu high-fidelity enzyme (TransGold, Beijing, China). The amplification products were purified and recovered to obtain homologous recombination fragments. Restriction endonucleases were used to... Avr II (NEB, Beijing, China) and Sca I (NEB, Beijing, China) double-digested the plasmid pHUE411, and purified and recovered the linearized pHUE411 vector after digestion. Using the pEASY-Uni Seamless Cloning Assembly Kit (TransGold, Beijing, China), the Cas12i3 and Cas12i3-5M fragments were ligated into the linearized pHUE411 vector to obtain the basic vectors pHUE411-Cas12i3 and pHUE411-Cas12i3-5M.

[0051] The pHUE411-Cas12i3 vector is a recombinant vector obtained by replacing the Cas9 gene in the pHUE411 vector with the Cas12i3 fusion gene, and this vector can express the Cas12i3 fusion protein shown in SEQ ID No. 2; the pHUE411-Cas12i3-5M vector is a recombinant vector obtained by replacing the Cas9 gene in the pHUE411 vector with the Cas12i3-5M fusion gene, and this vector can express the Cas12i3-5M fusion protein shown in SEQ ID No. 4.

[0052] The Cas12i3 fusion gene, as shown in SEQ ID No. 1, encodes the Cas12i3 fusion protein shown in SEQ ID No. 2. In SEQ ID No. 2, positions 2-19 represent the nuclear localization signal peptide (NLS), positions 20-41 represent the 3xFlag tag, positions 42-1089 represent the Cas12i3 protein, and positions 1090-1133 represent the nuclear localization signal peptide (NLS). The Cas12i3-5M fusion gene, as shown in SEQ ID No. 3, encodes the Cas12i3-5M fusion protein shown in SEQ ID No. 4. In SEQ ID No. 4, positions 2-19 represent the nuclear localization signal peptide (NLS), positions 20-41 represent the 3xFlag tag, positions 42-1089 represent the Cas12i3-5M protein, and positions 1090-1133 represent the nuclear localization signal peptide (NLS).

[0053] (2) Construction of intermediate vector: To efficiently and accurately release crRNA, the transcription of crRNA was initiated by the strong composite promoter 35S-CmYLCV-U6 (35S composite promoter), and the transcription was terminated by the tH4 terminator. The crRNA was separated by tRNA and the nuclease HDV. A homologous recombination fragment of 35S composite-tRNA-DR-PmeI-HDV-tH4 was prepared, and its sequence is shown in SEQ ID No. 13. In SEQ ID No. 13, positions 1-1326 represent the 35S composite promoter, positions 1327-1403 represent the DNA sequence of tRNA, positions 1404-1439 represent the DR sequence of Cas12i3 crRNA, positions 1440-1447 represent the recognition sequence of PmeI, positions 1448-1515 represent the DNA sequence of HDV, and positions 1516-1765 represent the sequence of the tH4 terminator. The homologous recombination fragment tandemly formed from 35S composite-tRNA-DR-PmeI-HDV-tH4 was then combined with... PmeThe backbone vectors obtained by digesting pHUE411-Cas12i3 and pHUE411-Cas12i3-5M with enzyme I were subjected to homologous recombination to obtain intermediate vectors pHUE411-Cas12i3-35S composite-tRNA-DR-PmeI-HDV-tH4 and pHUE411-Cas12i3-5M-35S composite-tRNA-DR-PmeI-HDV-tH4.

[0054] (3) Construction of knockout vectors: DR-HRC-F / HDV-HRC-R, DR-SBEIIb-F / HDV-SBEIIb-R, DR-CKX2-F / HDV-CKX2-R, DR-ARE1-F / HDV-ARE1-R, DR-BADH2-F / HDV-BADH2-R, and DR-DEP1-F / HDV-BADH2-R were annealed to obtain DR-HRC-HDV, DR-SBEIIb-HDV, DR-CKX2-HDV, DR-ARE1-HDV, DR-BADH2-HDV, and DR-DEP1-HDV fragments, respectively. The DR-HRC-HDV, DR-SBEIIb-HDV, DR-CKX2-HDV, DR-ARE1-HDV, DR-BADH2-HDV, and DR-DEP1-HDV fragments were then further conjugated with primers DR-HRC-F / HDV-HRC-R, DR-SBEIIb-HDV, DR-CKX2-HDV, DR-ARE1-HDV, DR-BADH2-HDV, and DR-DEP1-HDV fragments, respectively. Pme I. The intermediate vectors pHUE411-Cas12i3-35S composite-tRNA-DR-PmeI-HDV-tH4 and pHUE411-Cas12i3-5M-35S composite-tRNA-DR-PmeI-HDV-tH4, after enzyme digestion, were ligated to obtain the knockout vector. Figure 2 ).

[0055] The vectors for editing each gene obtained from pHUE411-Cas12i3-35S composite-tRNA-DR-PmeI-HDV-tH4 were designated as follows: pHUE411-Cas12i3-35S composite-tRNA-DR-PmeI-HDV-tH4-OsHRC, pHUE411-Cas12i3-35S composite-tRNA-DR-PmeI-HDV-tH4-OsSBEIIb, pHUE411-Cas12i3-35S composite-tRNA-DR-PmeI-HDV-tH4-OsCKX2, pHUE411-Cas12i3-35S composite-tRNA-DR-PmeI-HDV-tH4-OsARE1, and pHUE411-Cas12i3-35S. The vectors composite-tRNA-DR-PmeI-HDV-tH4-OsBADH2 and pHUE411-Cas12i3-35S, along with composite-tRNA-DR-PmeI-HDV-tH4-OsDEP1, can express the Cas12i3 fusion protein and be used for editing. OsHRC , OsSBEIIb , OsCKX2 , OsARE1 , OsBADH2 and OsDEP1 Gene.

[0056] The vectors for editing each gene obtained from pHUE411-Cas12i3-5M-35S composite-tRNA-DR-PmeI-HDV-tH4 were designated as follows: pHUE411-Cas12i3-5M-35S composite-tRNA-DR-PmeI-HDV-tH4-OsHRC, pHUE411-Cas12i3-5M-35S composite-tRNA-DR-PmeI-HDV-tH4-OsSBEIIb, pHUE411-Cas12i3-5M-35S composite-tRNA-DR-PmeI-HDV-tH4-OsCKX2, pHUE411-Cas12i3-5M-35S composite-tRNA-DR-PmeI-HDV-tH4-OsARE1, and pHUE411-Cas12i3-5M-35S. The vectors composite-tRNA-DR-PmeI-HDV-tH4-OsBADH2 and pHUE411-Cas12i3-5M-35S, along with composite-tRNA-DR-PmeI-HDV-tH4-OsDEP1, can express the Cas12i3-5M fusion protein and be used for editing. OsHRC , OsSBEIIb , OsCKX2 , OsARE1 , OsBADH2 and OsDEP1 Gene.

[0057] Following the method in step (1), the following are added: pHUE411-Cas12i3-5M-35S composite-tRNA-DR-PmeI-HDV-tH4-OsHRC, pHUE411-Cas12i3-5M-35S composite-tRNA-DR-PmeI-HDV-tH4-OsSBEIIb, pHUE411-Cas12i3-5M-35S composite-tRNA-DR-PmeI-HDV-tH4-OsCKX2, pHUE411-Cas12i3-5M-35S composite-tRNA-DR-PmeI-HDV-tH4-OsARE1, pHUE411-Cas12i3-5M-35S composite-tRNA-DR-PmeI-HDV-tH4-OsBADH2, pHUE411-Cas12i3-5M-35S In each vector of composite-tRNA-DR-PmeI-HDV-tH4-OsDEP1, the Cas12i3-5M fusion gene was replaced with the UL12-Cas12i3-5M fusion gene, T5E-Cas12i3-5M fusion gene, PapE-Cas12i3-5M fusion gene, and ME15-Cas12i3-5M fusion gene, respectively. This resulted in proteins expressing UL12-Cas12i3-5M, T5E-Cas12i3-5M, PapE-Cas12i3-5M, and ME15-Cas12i3-5M, which were then used for editing. OsHRC , OsSBEIIb , OsCKX2 , OsARF4 , OsARE1 , OsBADH2 and OsDEP1 24 gene knockout vectors ( Figure 2 ).

[0058] The UL12-Cas12i3-5M fusion gene, as shown in SEQ ID No. 5, encodes the UL12-Cas12i3-5M fusion protein shown in SEQ ID No. 6. In SEQ ID No. 6, positions 2-19 represent the nuclear localization signal peptide (NLS), positions 20-344 represent the UL12 protein, positions 345-406 represent the linker peptide, positions 408-429 represent the 3xFlag tag, positions 430-1477 represent the Cas12i3-5M protein, and positions 1478-1521 represent the nuclear localization signal peptide (NLS).

[0059] The T5E-Cas12i3-5M fusion gene, as shown in SEQ ID No. 7, encodes the T5E-Cas12i3-5M fusion protein shown in SEQ ID No. 8. In SEQ ID No. 8, positions 2-19 represent the nuclear localization signal peptide (NLS), positions 20-309 represent the T5E protein, positions 310-371 represent the linker peptide, positions 373-394 represent the 3xFlag tag, positions 395-1442 represent the Cas12i3-5M protein, and positions 1443-1486 represent the nuclear localization signal peptide (NLS).

[0060] The PapE-Cas12i3-5M fusion gene, as shown in SEQ ID No. 9, encodes the PapE-Cas12i3-5M fusion protein shown in SEQ ID No. 10. In SEQ ID No. 10, positions 2-19 represent the nuclear localization signal peptide (NLS), positions 20-625 represent the PapE protein, positions 626-687 represent the linker peptide, positions 689-710 represent the 3xFlag tag, positions 711-1758 represent the Cas12i3-5M protein, and positions 1759-1802 represent the nuclear localization signal peptide (NLS).

[0061] The ME15-Cas12i3-5M fusion gene, as shown in SEQ ID No. 11, encodes the ME15-Cas12i3-5M fusion protein shown in SEQ ID No. 12. In SEQ ID No. 12, positions 2-19 represent the nuclear localization signal peptide (NLS), positions 20-322 represent the ME15 protein, positions 323-384 represent the linker peptide, positions 386-407 represent the 3xFlag tag, positions 408-1455 represent the Cas12i3-5M protein, and positions 1456-1499 represent the nuclear localization signal peptide (NLS).

[0062] 1.2.3 Construction of Multi-Gene Editing Vectors This experiment designed three genes respectively ( OsHRC - OsSBEIIb - OsCKX2 ), four genes ( OsHRC - OsSBEIIb - OsCKX2-OsARF4 ), five genes ( OsHRC - OsSBEIIb - OsCKX2-OsARF4-OsARE1 ) and six genes ( OsHRC - OsSBEIIb - OsCKX2-OsARF4-OsARE1-OsBADH2The tandem strategy uses the strong composite promoter 35S-CmYLCV-U6 (35S composite) to initiate the transcription of crRNA, tandemly using tRNA and nuclease HDV as spacers, and terminates the transcription with the tH4 terminator.

[0063] Using the synthesized HDV-tRNA sequence as a template, HRC-HDV-F / SBEIIb-DR-R, SBEIIb-HDV-F / CKX2-DR-R, CKX2-HDV-F / ARF4-DR-R, ARF4-HDV-F / ARE1-DR-R, and ARE1-HDV-F / BADH2-DR-R were used to amplify two-gene tandem fragments, namely fragment 1, fragment 2, fragment 3, fragment 4, and fragment 5, which were then purified and recovered. Then, using fragment 1+fragment 2, fragment 1+fragment 2+fragment 3, fragment 1+fragment 2+fragment 3+fragment 4, and fragment 1+fragment 2+fragment 3+fragment 4+fragment 5 as templates, amplification was performed using primers DR-HRC-F / HDV-CKX2-R, DR-HRC-F / HDV-ARF4-R, DR-HRC-F / HDV-ARE1-R, and DR-HRC-F / HDV-BADH2-R, respectively, to obtain fragments with three, four, five, and six genes tandemly.

[0064] The synthesized HDV-tRNA sequence is: GGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATGCTTCGGCATGGCGAATGGGACAACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA. Positions 1-68 represent the HDV DNA fragment, and positions 69-145 represent the tRNA DNA fragment.

[0065] Connect the above three-gene, four-gene, five-gene, and six-gene tandem fragments to... Pme I. Four multi-gene tandem knockout vectors were obtained by digesting the intermediate vector pHUE411-Cas12i3-5M-35S composite-tRNA-DR-PmeI-HDV-tH4, each capable of expressing the Cas12i3-5M fusion protein and used for simultaneous editing of three, four, five, and six genes.

[0066] Three genes: OsHRC , OsSBEIIb and OsCKX2 Gene; Four genes: OsHRC , OsSBEIIb , OsCKX2 and OsARF4 Gene; Five genes: OsHRC , OsSBEIIb , OsCKX2 , OsARF4 and OsARE1 Gene; Six genes: OsHRC , OsSBEIIb , OsCKX2 , OsARF4 , OsARE1 and OsBADH2 Gene.

[0067] Following the method in step (1), the Cas12i3-5M fusion gene in each of the above multi-gene tandem knockout vectors was replaced with the UL12-Cas12i3-5M fusion gene, T5E-Cas12i3-5M fusion gene, PapE-Cas12i3-5M fusion gene, and ME15-Cas12i3-5M fusion gene, respectively, to obtain 16 knockout vectors that can express the UL12-Cas12i3-5M fusion protein, T5E-Cas12i3-5M fusion protein, PapE-Cas12i3-5M fusion protein, and ME15-Cas12i3-5M fusion protein and can be used to edit the above two-gene, three-gene, four-gene, five-gene, and six-gene genes.

[0068] Each carrier structure such as Figure 2 As shown.

[0069] 1.2.4 Agrobacterium-mediated genetic transformation and tissue culture process in rice Genetic transformation of rice was carried out using Agrobacterium-mediated transformation. The knockout vectors constructed in steps 1.2.2 and 1.2.3 were transformed into Agrobacterium-mediated transformation of EHA105, and then the Agrobacterium-mediated transformation of Zhonghua 11 rice callus was used. The specific steps are as follows: Take an appropriate amount of good quality Zhonghua 11 rice seeds and place them in a sterile bottle. Disinfect with 70% ethanol solution for 15 minutes, then with 20% sodium hypochlorite solution for 20 minutes. Wash the seeds 4-5 times with sterile water in a sterile laminar flow hood, then soak them in sterile water for 3 hours. Place the disinfected rice seeds on an induction medium and incubate in the dark at 28°C for about 30 days, until callus granules appear on the seed surface. Transfer fresh rice callus granules to a subculture medium and incubate at 28°C in the dark for about 10 days, forming callus granules of moderate size, golden color, and round shape. Then, transfer the well-grown subcultured callus to OD medium. 600Infect the rice callus with EHA105 bacterial suspension containing the knockout vector at a concentration of 0.6-1.0 for 20 minutes. After infection, blot the surface bacterial suspension with filter paper and transfer the callus to a co-culture medium. Incubate in the dark at 28°C for three days. Transfer the co-cultured rice callus to the first round of selection medium (50 mg / L hygromycin) and incubate in the dark at 28°C for 15 days. Transfer the callus to the second round of selection medium (75 mg / L hygromycin) and incubate in the dark at 28°C for 15 days. Incubate the selected callus with good growth to the regeneration medium (50 mg / L hygromycin) and incubate in the light at 28°C for about 14 days. Transfer the regenerated seedlings to the rooting medium and incubate in the light for about 10 days. Then, transplant them into the soil and place them in a greenhouse at 28-30°C with a light cycle of 16 hours of light / 8 hours of darkness to obtain the T0 generation rice.

[0070] 1.2.5 Genotyping of T0 generation regenerated plants Leaves were harvested in clusters from T0 generation rice seedlings. Genomic DNA was extracted using a DNA extraction kit (Tiangen, Beijing, China) as a template. Using the genomic DNA as a template, primers (MU6B-UP-F / Trans-RHRC-R, MU6B-UP-F / Trans-RSBE-R, MU6B-UP-F / Trans-CKX-R, MU6B-UP-F / Trans-ARE1-R, MU6B-UP-F / Trans-RBADH-R, MU6B-UP-F / Trans-DEP1-R, Cas12i-Test-F / Cas12i-Test-R) were used to detect the genomic DNA samples and identify the number of transgenic plants. Based on this, using the genomic DNA of the transgenic plants as templates, PCR amplification was performed on the transgenic plants using genome-specific detection primers (HRC-F / HRC-R, SBE-F1 / SBE-R1, CKX2-F / CKX2-R, ARF4-F / ARF4-R, OsARE1-F1 / OsARE1-R1, rBADH-F / rBADH-R, DEP1-F / DEP1-R), followed by Sanger sequencing. The sequencing results were analyzed for genotyping using the website http: / / dsdecode.scgene.com / . For samples with complex editing types, DNA was extracted from individual plants, and after PCR amplification, the PCR products were ligated into the B-zero vector (TransGen, Beijing, China). Single clones were then selected to determine the specific editing type.

[0071] 1.2.6 Off-target analysis Using the Offtarget website (http: / / skl.scau.edu.cn / offtarget / ), predict the growth rate of rice. OsHRC, OsSBEIIb , OsCKX2, OsARF4, OsARE1, OsBADH2 and OsDEP1 Potential off-target sites of the selected gene targets were identified, and specific primers were designed (OsHRC-OFF1-F / OsHRC-OFF1-R, OsSBEIIb-OFF1-F / OsSBEIIb-OFF1-R, OsSBEIIb-OFF2-F / OsSBEIIb-OFF2-R, OFF-CKX2-1-F / OFF-CKX2-1-R, OFF-CKX2-2-F / OFF-CKX2-2-R, ARF4-OFF1-F / ARF4-OFF1-R, ARF4-OFF2-F / ARF4-OFF2-R, ARF4-OFF3-F / ARF4-OFF3-R, RARE1-OFF1-F / RARE1-OFF1-R3, RARE1-OFF2-F / RARE1-OFF2-R, RARE1-OFF3-F / RARE1-OFF3-R, DEP-OFF1-F / DEP-OFF1-R, DEP-OFF2-F / DEP-OFF2-R) amplification and sequencing, and sequence alignment based on sequencing results to determine whether there is off-target effect at the selected target site.

[0072] 2. Experimental Results 2.1 Rice single-gene editing efficiency mediated by different exonuclease strategies To determine the editing efficiency of single genes in rice using strategies such as Cas12i3, Cas12i3-5M, T5E-Cas12i3-5M, UL12-Cas12i3-5M, PapE-Cas12i3-5M, and ME15-Cas12i3-5M, we targeted endogenous genes in rice. OsHRC, OsSBEIIb , OsCKX2, OsARE1, OsBADH2 and OsDEP1 target ( Figure 1 ), constructing a series of editing carriers ( Figure 2 Agrobacterium-mediated stable transformation of rice was performed, with each vector repeated three times.

[0073] exist OsHRCFor the Cas12i3 strategy, 84, 46, and 36 transgenic lines were obtained, and 4, 4, and 3 edited lines were identified, respectively, with editing efficiencies of 4.76%, 8.70%, and 8.33%, and an average editing efficiency of 7.26±2.18%. For the Cas12i3-5M strategy, 45, 27, and 34 transgenic lines were obtained, and 38, 22, and 27 edited lines were identified, respectively, with editing efficiencies of 84.44%, 81.48%, and 79.41%, and an average editing efficiency of 81.78±2.53%. For the T5E-Cas12i3-5M strategy, 32, 36, and 28 transgenic lines were obtained, and 29, 31, and 25 edited lines were identified, respectively, with editing efficiencies of 90.63%, 86.11%, and 89.29%, and an average editing efficiency of 88.68±2.32%. For UL1... The 2-Cas12i3-5M strategy yielded 12, 11, and 9 transgenic lines, respectively, with 11, 10, and 8 edited lines identified, respectively, with editing efficiencies of 91.67%, 90.91%, and 88.89%, and an average editing efficiency of 90.49±1.44%. For the PapE-Cas12i3-5M strategy, 19, 17, and 22 transgenic lines were obtained, with 16, 14, and 18 edited lines identified, respectively, with editing efficiencies of 84.21%, 82.35%, and 81.82%, and an average editing efficiency of 82.79±1.26%. For the ME15-Cas12i3-5M strategy, 8, 6, and 5 transgenic lines were obtained, with 7, 5, and 4 edited lines identified, respectively, with editing efficiencies of 87.50%, 83.33%, and 80.00%, and an average editing efficiency of 83.61±3.76%. Among the above strategies, the UL12-Cas12i3-5M strategy has the highest average editing efficiency. Figure 3 Compared to Cas12i3, the efficiency was improved by 12.46 times (90.49% / 7.26%), and compared to Cas12i3-5M, it was improved by 1.11 times (90.49% / 81.78%). The UL12-Cas12i3-5M strategy significantly improved editing efficiency compared to Cas12i3, Cas12i3-5M, PapE-Cas12i3-5M, and ME15-Cas12i3-5M strategies. Compared to the T5E-Cas12i3-5M strategy, the average editing efficiency improved, but not significantly. Figure 3 ).

[0074] exist OsSBEIIbFor the Cas12i3 strategy, 44, 43, and 40 transgenic lines were obtained, and 8, 9, and 5 edited lines were identified, respectively, with editing efficiencies of 18.18%, 20.93%, and 12.50%, and an average editing efficiency of 17.20±4.30%. For the Cas12i3-5M strategy, 25, 24, and 21 transgenic lines were obtained, and 21, 19, and 17 edited lines were identified, respectively, with editing efficiencies of 84.00%, 79.17%, and 80.95%, and an average editing efficiency of 81.37±2.44%. For the T5E-Cas12i3-5M strategy, 16, 25, and 15 transgenic lines were obtained, and 14, 21, and 13 edited lines were identified, respectively, with editing efficiencies of 87.50%, 84.00%, and 86.67%, and an average editing efficiency of 86.06±1.83%. For UL... The 12-Cas12i3-5M strategy yielded 23, 21, and 19 transgenic lines, respectively, with 21, 19, and 17 edited lines identified, respectively. The editing efficiencies were 91.30%, 90.48%, and 89.47%, respectively, with an average editing efficiency of 90.42 ± 0.92%. For the PapE-Cas12i3-5M strategy, 14, 20, and 13 transgenic lines were obtained, with 12, 17, and 11 edited lines identified, respectively. The editing efficiencies were 85.71%, 85.00%, and 84.62%, respectively, with an average editing efficiency of 85.11 ± 0.56%. For the ME15-Cas12i3-5M strategy, 10, 9, and 6 transgenic lines were obtained, with 8, 8, and 5 edited lines identified, respectively. The editing efficiencies were 80.00%, 88.89%, and 83.33%, respectively, with an average editing efficiency of 84.07 ± 4.49%. Among the above strategies, the UL12-Cas12i3-5M strategy has the highest average editing efficiency. Figure 3 Compared to Cas12i3, the efficiency was improved by 5.26 times (90.42% / 17.20%), and compared to Cas12i3-5M, it was improved by 1.11 times (90.42% / 81.37%). The UL12-Cas12i3-5M strategy significantly improved editing efficiency compared to strategies such as Cas12i3, Cas12i3-5M, PapE-Cas12i3-5M, and ME15-Cas12i3-5M. Compared to the T5E-Cas12i3-5M strategy, the average editing efficiency improved, but not significantly. Figure 3 ).

[0075] exist OsCKX2For the Cas12i3 strategy, 20, 19, and 24 transgenic lines were obtained, and 3, 1, and 2 edited lines were identified, respectively, with editing efficiencies of 15.00%, 5.26%, and 8.33%, and an average editing efficiency of 9.53±4.98%. For the Cas12i3-5M strategy, 35, 27, and 21 transgenic lines were obtained, and 32, 25, and 19 edited lines were identified, respectively, with editing efficiencies of 91.43%, 92.59%, and 90.48%, and an average editing efficiency of 91.50±1.06%. For the T5E-Cas12i3-5M strategy, 22, 19, and 21 transgenic lines were obtained, and 21, 17, and 20 edited lines were identified, respectively, with editing efficiencies of 95.45%, 89.47%, and 95.24%, and an average editing efficiency of 93.39±3.39%. For the UL12-Ca... The s12i3-5M strategy yielded 24, 15, and 21 transgenic lines, respectively, with 23, 15, and 21 edited lines identified, respectively. The editing efficiencies were 95.83%, 100.00%, and 100.00%, respectively, with an average editing efficiency of 98.61 ± 2.41%. For the PapE-Cas12i3-5M strategy, 22, 19, and 25 transgenic lines were obtained, with 19, 17, and 23 edited lines identified, respectively. The editing efficiencies for the three transgenic lines were 90.48%, 94.74%, and 91.67%, respectively, with an average editing efficiency of 92.31 ± 3.00%. For the ME15-Cas12i3-5M strategy, 30, 14, and 13 transgenic lines were obtained, and 29, 13, and 12 editing lines were identified, respectively, with editing efficiencies of 96.67%, 92.86%, and 92.31%, respectively, and an average editing efficiency of 93.95 ± 2.37%. Among the above strategies, the UL12-Cas12i3-5M strategy had the highest average editing efficiency. Figure 3 Compared to Cas12i3, the efficiency was improved by 10.35 times (98.61% / 9.53%), and compared to Cas12i3-5M, it was improved by 1.08 times (98.61% / 91.50%). The UL12-Cas12i3-5M strategy significantly improved editing efficiency compared to Cas12i3, Cas12i3-5M, and PapE-Cas12i3-5M strategies. Compared to T5E-Cas12i3-5M and ME15-Cas12i3-5M strategies, the average editing efficiency was improved, but not significantly. Figure 3 ).

[0076] exist OsARE1For the Cas12i3 strategy, 21, 28, and 12 transgenic lines were obtained, respectively, and none of them were identified as edited lines, with an editing efficiency of 0.00%. For the Cas12i3-5M strategy, 17, 21, and 14 transgenic lines were obtained, respectively, and 13, 15, and 11 edited lines were identified, respectively, with editing efficiencies of 76.47%, 71.43%, and 78.57%, respectively, and an average editing efficiency of 75.49±3.67%. For the T5E-Cas12i3-5M strategy, 13, 14, and 9 transgenic lines were obtained, respectively, and 10, 12, and 8 edited lines were identified, respectively, with editing efficiencies of 76.92%, 85.71%, and 88.89%, respectively, and an average editing efficiency of 83.84±6.20%. For the UL12-Cas12i3-5M strategy, 27, 16, and 16 transgenic lines were obtained, respectively, with an editing efficiency of 76.92%, 85.71%, and 88.89%, respectively, and an average editing efficiency of 83.84±6.20%. Of the 26 transgenic lines obtained, 25, 15, and 25 were identified as edited lines, with editing efficiencies of 92.59%, 93.75%, and 96.15%, respectively, and an average editing efficiency of 94.17±1.82%. For the PapE-Cas12i3-5M strategy, 15, 11, and 13 transgenic lines were obtained, with 13, 10, and 12 identified as edited lines, respectively, with editing efficiencies of 86.67%, 90.91%, and 92.31%, and an average editing efficiency of 89.96±2.94%. For the ME15-Cas12i3-5M strategy, 22, 29, and 15 transgenic lines were obtained, with 20, 26, and 12 identified as edited lines, with editing efficiencies of 90.91%, 89.66%, and 80.00%, respectively, and an average editing efficiency of 86.85±5.97%. Gene editing was not achieved at this site with Cas12i3. Furthermore, among the strategies mentioned above, the UL12-Cas12i3-5M strategy had the highest average editing efficiency. Figure 3 Compared to Cas12i3-5M, the efficiency was improved by 1.25 times (94.17% / 75.49%). The UL12-Cas12i3-5M strategy significantly improved editing efficiency compared to strategies such as Cas12i3, Cas12i3-5M, T5E-Cas12i3-5M, and ME15-Cas12i3-5M. Compared to the PapE-Cas12i3-5M strategy, the average editing efficiency was improved, but not significantly. Figure 3 ).

[0077] exist OsBADH2For the Cas12i3 strategy, 105, 47, and 54 transgenic lines were obtained, with 7, 4, and 6 edited lines, respectively, and editing efficiencies of 6.67%, 8.51%, and 11.11%, respectively, with an average editing efficiency of 8.76±2.23%. For the Cas12i3-5M strategy, 56, 29, and 50 transgenic lines were obtained, with 50, 22, and 41 edited lines identified, respectively, and editing efficiencies of 89.29%, 75.86%, and 82.00%, respectively, with an average editing efficiency of 82.38±6.72%. For the T5E-Cas12i3-5M strategy, 55, 33, and 32 transgenic lines were obtained, with 53, 28, and 29 edited lines identified, with editing efficiencies of 96.36%, 84.85%, and 90.63%, respectively, with an average editing efficiency of 90.61±5.76%. For UL12... The -Cas12i3-5M strategy yielded 24, 19, and 40 transgenic lines, respectively, with 23, 18, and 39 edited lines identified, respectively, with editing efficiencies of 95.83%, 94.74%, and 97.50%, and an average editing efficiency of 96.02±1.39%. For the PapE-Cas12i3-5M strategy, 14, 11, and 8 transgenic lines were obtained, with 12, 10, and 6 edited lines identified, respectively, with editing efficiencies of 85.71%, 90.91%, and 75.00%, and an average editing efficiency of 83.87±8.11%. For the ME15-Cas12i3-5M strategy, 12, 9, and 9 transgenic lines were obtained, with 10, 8, and 7 edited lines identified, respectively, with editing efficiencies of 83.33%, 88.89%, and 77.78%, and an average editing efficiency of 83.33±5.56%. Among the above strategies, the UL12-Cas12i3-5M strategy has the highest average editing efficiency. Figure 3 Compared to Cas12i3, the efficiency was improved by 10.96 times (96.02% / 8.76%), and compared to Cas12i3-5M, it was improved by 1.17 times (96.02% / 82.38%). The UL12-Cas12i3-5M strategy significantly improved editing efficiency compared to Cas12i3, Cas12i3-5M, PapE-Cas12i3-5M, and ME15-Cas12i3-5M strategies. Compared to the T5E-Cas12i3-5M strategy, the average editing efficiency improved, but not significantly. Figure 3 ).

[0078] exist OsDEP1For the Cas12i3 strategy, 43, 31, and 48 transgenic lines were obtained, with 5, 3, and 6 edited lines, respectively, and editing efficiencies of 11.63%, 9.68%, and 12.50%, respectively, with an average editing efficiency of 11.27±1.45%. For the Cas12i3-5M strategy, 19, 21, and 11 transgenic lines were obtained, with 16, 18, and 9 edited lines identified, respectively, and editing efficiencies of 88.89%, 85.71%, and 81.82%, respectively, with an average editing efficiency of 85.47±3.54%. For the T5E-Cas12i3-5M strategy, 10, 9, and 7 transgenic lines were obtained, with 9, 8, and 6 edited lines identified, respectively, and editing efficiencies of 90.00%, 88.89%, and 85.71%, respectively, with an average editing efficiency of 88.20±2.22%. For the UL12-Cas12 strategy... The i3-5M strategy yielded 31, 19, and 32 transgenic lines, respectively, with 29, 18, and 30 edited lines identified, respectively. The editing efficiencies were 93.55%, 94.74%, and 93.75%, respectively, with an average editing efficiency of 94.01 ± 0.64%. For the PapE-Cas12i3-5M strategy, 27, 36, and 21 transgenic lines were obtained, with 24, 32, and 18 edited lines identified, respectively. The editing efficiencies were 88.89%, 88.89%, and 85.71%, respectively, with an average editing efficiency of 87.83 ± 1.83%. For the ME15-Cas12i3-5M strategy, 20, 30, and 13 transgenic lines were obtained, with 17, 27, and 11 edited lines identified, respectively. The editing efficiencies were 85.00%, 90.00%, and 84.62%, respectively, with an average editing efficiency of 86.54 ± 3.00%. Among the above strategies, the UL12-Cas12i3-5M strategy has the highest average editing efficiency. Figure 3 Compared to Cas12i3, the efficiency improvement is 8.34 times (94.01% / 11.27%), and compared to Cas12i3-5M, it is 1.10 times (94.01% / 85.47%). The UL12-Cas12i3-5M strategy significantly improves editing efficiency compared to strategies such as Cas12i3, Cas12i3-5M, T5E-Cas12i3-5M, PapE-Cas12i3-5M, and ME15-Cas12i3-5M. Figure 3 ).

[0079] In summary, the fusion of different exonucleases at the six rice-based endogenous gene targets can improve editing efficiency, and the strategy of fusing Cas12i3-5M with UL12 exonuclease achieved the highest average editing efficiency. Figure 3 ).

[0080] 2.2 Statistical analysis of the length of deletion fragments generated at the target site by different exonucleases To investigate the effects of different exonucleases on the size of deleted fragments generated in the rice genome, the deletion fragments generated by single-gene editing plants using strategies such as Cas12i3, Cas12i3-5M, T5E-Cas12i3-5M, UL12-Cas12i3-5M, PapE-Cas12i3-5M, and ME15-Cas12i3-5M were statistically analyzed. The results are shown below. Figure 4 .

[0081] exist OsHRCAmong the target editing strains, the Cas12i3 strategy involved deletions within 1-40 bp, with 1-20 bp deletions accounting for 83.33% and 21-40 bp deletions accounting for 16.67%. The Cas12i3-5M strategy primarily involved 1-20 bp deletions (74.09%), 21-40 bp deletions (17.74%), 41-60 bp deletions (2.92%), 61-80 bp deletions (0.00%), 81-100 bp deletions (4.14%), and deletions greater than 100 bp (1.11%). The T5E-Cas12i3-5M strategy involved longer deletions, with 1-20 bp deletions accounting for 20.59%, 21-40 bp deletions for 36.61%, 41-60 bp deletions for 25.69%, 61-80 bp deletions for 4.95%, and 81-100 bp deletions for 4.95%. The deletion rate for segments with lengths of 1-20 bp was 5.57%, and the deletion rate for segments longer than 100 bp was 6.48%, with the longest reaching 199 bp. The UL12-Cas12i3-5M strategy had similar deletion rates to Cas12i3-5M, with 72.64% of segments being 1-20 bp, 19.71% 21-40 bp, 4.32% 41-60 bp, 1.67% 61-80 bp, 0.00% 81-100 bp, and 1.67% longer than 100 bp. The PapE-Cas12i3-5M strategy had longer deletion rates, with 13.41% 1-20 bp, 36.22% 21-40 bp, 31.87% 41-60 bp, 7.35% 61-80 bp, and the longest reaching 199 bp. The deletion rate was 1.15% for lengths less than 100 bp, 10.01% for lengths greater than 100 bp, and the longest deletion reached 134 bp. The ME15-Cas12i3-5M strategy resulted in longer deletions, with 11.62% of deletions in the 1-20 bp range, 28.43% in the 21-40 bp range, 30.23% in the 41-60 bp range, 0.00% in the 61-80 bp range, 7.79% in the 81-100 bp range, and 21.93% for lengths greater than 100 bp, with the longest deletion reaching 104 bp. At this site, the exonuclease UL12 did not increase the length of the deleted fragment, while other exonucleases did. Figure 4 ).

[0082] exist OsSBEIIbAmong the target editing strains, the Cas12i3 strategy primarily involved deletions within 1-20 bp (87.22%), followed by deletions of 21-40 bp (6.11%) and 41-60 bp (6.67%). The Cas12i3-5M strategy primarily involved deletions of 1-20 bp (81.31%), with 21-40 bp deletions accounting for 16.25% and 41-60 bp deletions for 2.44%, without producing any larger deletions. The T5E-Cas12i3-5M strategy resulted in longer deletions, with 1-20 bp deletions accounting for 26.04%, 21-40 bp deletions for 19.54%, 41-60 bp deletions for 31.40%, 61-80 bp deletions for 12.32%, 81-100 bp deletions for 6.35%, and deletions greater than 100 bp accounting for 4.35%, with the longest deletion reaching 131 bp. The UL12-Cas12i3-5M strategy deletes fragments similar to Cas12i3-5M, with 80.47% of the deletions being in the 1-20 bp range, 13.35% in the 21-40 bp range, 3.38% in the 41-60 bp range, 0.81% in the 61-80 bp range, 0.88% in the 81-100 bp range, and 1.11% in the greater than 100 bp range. Compared to Cas12i3-5M, it produces a small number of larger fragment deletions. The PapE-Cas12i3-5M strategy deletes longer fragments, with 16.99% of the deletions being in the 1-20 bp range, 30.64% in the 21-40 bp range, 11.14% in the 41-60 bp range, 7.22% in the 61-80 bp range, 2.78% in the 81-100 bp range, and a smaller percentage in the greater than 100 bp range. The deletion rate was 31.23% for lengths of 1 bp, with the longest reaching 177 bp. The ME15-Cas12i3-5M strategy resulted in longer deletions, with 35.28% of deletions being 1-20 bp, 32.49% for 21-40 bp, 7.79% for 41-60 bp, 16.29% for 61-80 bp, 0.00% for 81-100 bp, and 8.14% for lengths greater than 100 bp, with the longest reaching 151 bp. At this site, the exonuclease UL12 produced a small number of larger deletion fragments, with the main deletion type consistent with Cas12i3-5M. Other exonucleases all increased the length of the deleted fragments. Figure 4 ).

[0083] exist OsCKX2Among the target editing strains, the Cas12i3 strategy primarily involved deletions within 1-20 bp (93.33%), with deletions of 21-40 bp accounting for 6.67%, and no larger fragment deletions were observed. The Cas12i3-5M strategy primarily involved deletions within 1-20 bp (87.56%), with deletions of 21-40 bp accounting for 7.42%, 41-60 bp for 2.42%, and 61-80 bp for 2.60%. The T5E-Cas12i3-5M strategy resulted in longer deletions, with 1-20 bp deletions accounting for 39.70%, 21-40 bp for 39.16%, 41-60 bp for 16.95%, 61-80 bp for 0.88%, 81-100 bp for 0.81%, and deletions greater than 100 bp accounting for 2.50%, with the longest deletion reaching 116 bp. The UL12-Cas12i3-5M strategy has similar deletion rates to Cas12i3-5M, with 91.36% of deletions occurring in the 1-20 bp range, 3.36% in the 21-40 bp range, 1.92% in the 41-60 bp range, 1.45% in the 61-80 bp range, 1.19% in the 81-100 bp range, and 0.72% in the range greater than 100 bp. The PapE-Cas12i3-5M strategy has longer deletion rates, with 13.40% of deletions occurring in the 1-20 bp range, 43.21% in the 21-40 bp range, 20.08% in the 41-60 bp range, 7.39% in the 61-80 bp range, 8.25% in the 81-100 bp range, and 7.67% in the range greater than 100 bp, reaching a maximum length of 190 bp. The ME15-Cas12i3-5M strategy resulted in relatively long deletions, with 35.60% of deletions being 1-20 bp, 37.50% being 21-40 bp, 11.18% being 41-60 bp, 4.53% being 61-80 bp, 5.70% being 81-100 bp, and 5.48% being longer than 100 bp, with the longest deletion reaching 170 bp. At this site, the exonuclease UL12 did not extend the length of the deleted fragment, while other exonucleases did. Figure 4 ).

[0084] exist OsARE1Among the target editing lines, the Cas12i3 strategy did not yield any edited plants; the Cas12i3-5M strategy mainly produced deletions of 1-20 bp (78.69%), deletions of 21-40 bp (19.16%), no deletions of 41-100 bp, and deletions greater than 100 bp (2.15%); the T5E-Cas12i3-5M strategy produced longer deletion fragments, with 1-20 bp deletions accounting for 31.31%, 21-40 bp deletions for 44.36%, 41-60 bp deletions for 9.13%, 61-80 bp deletions for 6.20%, 81-100 bp deletions for 0.00%, and deletions greater than 100 bp for 8.99%, with the longest deletion reaching 238 bp; the UL12-Cas12i3-5M strategy produced deletion fragments similar to Cas12i3-5M, with 1-20 bp deletions accounting for 31.31%, 21-40 bp deletions for 44.36%, 41-60 bp deletions for 9.13%, 61-80 bp deletions for 6.20%, 81-100 bp deletions for 0.00%, and deletions greater than 100 bp for 8.99%, the longest being 238 bp; the UL12-Cas12i3-5M strategy produced deletion fragments similar to Cas12i3-5M, with 1-20 bp deletions accounting for 31.31%, 21-40 bp deletions for 44.36%, 41-60 bp deletions for 9.13%, 61-80 bp deletions for 6.20%, 81-100 bp deletions for 0.00%, The deletion rate for 1-20 bp segments was 77.61%, for 21-40 bp segments it was 21.03%, for 41-60 bp segments it was 0.00%, and for 61-80 bp segments it was 1.36%, with no larger segments deleted. The PapE-Cas12i3-5M strategy had longer deletions, with 24.29% of segments being 1-20 bp, 47.44% of segments being 21-40 bp, 8.64% of segments being 41-60 bp, 8.30% of segments being 61-80 bp, 4.32% of segments being 81-100 bp, and 7.02% of segments larger than 100 bp, with the longest segment reaching 177 bp. The ME15-Cas12i3-5M strategy also had longer deletions, with 31.21% of segments being 1-20 bp, 46.13% of segments being 21-40 bp, and for 41-60 bp segments it was 0.00%, and for 61-60 bp segments it was 1.36%, with no larger segments deleted. The deletion rate was 6.48% for 61-80 bp, 7.24% for 61-80 bp, 0.00% for 81-100 bp, and 8.94% for 100 bp and longer, with the longest deletion reaching 163 bp. At this site, exonuclease UL12 did not amplify the length of the deleted fragment, while all other exonucleases amplified the length of the deleted fragment. Figure 4 ).

[0085] exist OsBADH2Among the target editing strains, the Cas12i3 strategy primarily involved deletions within 1-20 bp (83.33%), with deletions of 21-40 bp accounting for 16.67%, and no larger fragment deletions were produced. The Cas12i3-5M strategy primarily involved deletions within 1-20 bp (90.05%), with deletions of 21-40 bp accounting for 9.62%, and deletions of 41-60 bp accounting for 0.33%, and no larger fragment deletions were produced. The T5E-Cas12i3-5M strategy resulted in longer deletions, with 1-20 bp deletions accounting for 39.82%, 21-40 bp deletions for 42.71%, 41-60 bp deletions for 14.00%, 61-80 bp deletions for 1.89%, 81-100 bp deletions for 1.26%, and deletions greater than 100 bp accounting for 0.32%, with the longest deletion reaching 121 bp. The UL12-Cas12i3-5M strategy's deletion fragments are similar to Cas12i3-5M, with 86.50% of the 1-20 bp deletions, 13.06% of the 21-40 bp deletions, and 0.44% of the 41-60 bp deletions. No larger fragments were deleted. The PapE-Cas12i3-5M strategy's deletion fragments are relatively long, with 29.49% of the 1-20 bp deletions, 41.14% of the 21-40 bp deletions, 16.04% of the 41-60 bp deletions, 6.96% of the 61-80 bp deletions, 4.70% of the 81-100 bp deletions, and 1.67% of the deletions greater than 100 bp, with the longest deletion reaching 134 bp. The ME15-Cas12i3-5M strategy's deletion fragments are also relatively long, with 28.85% of the 1-20 bp deletions, 21-40 bp deletions, and 0.44% of the 21-40 bp deletions. The deletion rate was 31.62% for lengths of 41-60 bp, 2.78% for lengths of 61-80 bp, 2.56% for lengths of 81-100 bp, and 2.56% for lengths greater than 100 bp, with the longest deletion reaching 154 bp. At this site, the exonuclease UL12 did not amplify the length of the deleted fragment, while all other exonucleases did. Figure 4 ).

[0086] exist OsDEP1Among the target editing strains, the Cas12i3 strategy primarily involved deletions within 1-20 bp (84.13%), with 21-40 bp deletions accounting for 15.87%, and no larger fragment deletions were produced. The Cas12i3-5M strategy primarily involved deletions within 1-20 bp (72.41%), with 21-40 bp deletions accounting for 14.78%, 41-60 bp deletions for 5.32%, 61-80 bp deletions for 6.51%, and 81-100 bp deletions for 0.98%. The T5E-Cas12i3-5M strategy resulted in longer deletions, with 1-20 bp deletions accounting for 46.24%, 21-40 bp deletions for 32.70%, 41-60 bp deletions for 5.11%, 61-80 bp deletions for 10.83%, and 81-100 bp deletions for 2.08%, with deletions greater than 100 bp occurring. The deletion rate for 1-20 bp was 3.03%, with the longest deletion reaching 163 bp. The UL12-Cas12i3-5M strategy had similar deletion rates to Cas12i3-5M, with 83.63% of 1-20 bp deleted, 6.97% of 21-40 bp deleted, 0.93% of 41-60 bp deleted, 0.58% of 61-80 bp deleted, 1.17% of 81-100 bp deleted, and 6.73% of deletions greater than 100 bp. The PapE-Cas12i3-5M strategy had longer deletion rates, with 9.71% of 1-20 bp deleted, 43.30% of 21-40 bp deleted, 16.46% of 41-60 bp deleted, 10.79% of 61-80 bp deleted, 10.24% of 81-100 bp deleted, and the longest deletion greater than 100 bp deleted. The deletion rate was 9.50% for lengths of 1 bp and the longest was 205 bp. The ME15-Cas12i3-5M strategy resulted in longer deletions, with 42.44% of deletions being 1-20 bp, 21.99% for 21-40 bp, 11.06% for 41-60 bp, 11.90% for 61-80 bp, 2.24% for 81-100 bp, and 10.36% for lengths greater than 100 bp, the longest being 189 bp. At this site, the exonuclease UL12 did not increase the length of the deleted fragment, while all other exonucleases did. Figure 4 ).

[0087] In summary, statistical analysis of the deletion types in edited plants obtained using six strategies—Cas12i3, Cas12i3-5M, T5E-Cas12i3-5M, UL12-Cas12i3-5M, PapE-Cas12i3-5M, and ME15-Cas12i3-5M—showed that the UL12 exonuclease could not amplify the rice genome deletion fragments generated by Cas12i3-5M, while T5E, PapE, and ME15 could all amplify the length of the genome deletion fragments generated by Cas12i3-5M.

[0088] 2.3 Efficiency of Rice Multigene Editing mediated by Different Exonuclease Strategies To determine the efficiency of strategies such as Cas12i3-5M, T5E-Cas12i3-5M, UL12-Cas12i3-5M, PapE-Cas12i3-5M, and ME15-Cas12i3-5M in simultaneously editing multiple targets in rice, three gene sequences were constructed respectively. OsHRC - OsSBEIIb - OsCKX2 ), four genes ( OsHRC - OsSBEIIb - OsCKX2-OsARF4 ), five genes ( OsHRC - OsSBEIIb - OsCKX2-OsARF4-OsARE1 ) and six genes ( OsHRC - OsSBEIIb - OsCKX2-OsARF4-OsARE1- OsBADH2 Simultaneous editing of the carrier ( Figure 2 Agrobacterium-mediated genetic transformation of rice was performed, with each vector repeated three times.

[0089] for OsHRC - OsSBEIIb - OsCKX2 The three gene target vectors were used in tandem. The Cas12i3-5M strategy yielded 38 transgenic lines, with 26 lines showing simultaneous editing at all three sites (68.42% editing efficiency); the T5E-Cas12i3-5M strategy yielded 31 transgenic lines, with 22 lines showing simultaneous editing at all three sites (70.97% editing efficiency); the UL12-Cas12i3-5M strategy yielded 29 transgenic lines, with 24 lines showing simultaneous editing at all three sites (82.76% editing efficiency); the PapE-Cas12i3-5M strategy yielded 54 transgenic lines, with 38 lines showing simultaneous editing at all three sites (70.37% editing efficiency); and the ME15-Cas12i3-5M strategy yielded 29 transgenic lines, with 21 lines showing simultaneous editing at all three sites (72.41% editing efficiency). Figure 5 Compared to Cas12i3-5M, the fusion exonuclease strategy improved editing efficiency in all cases. Among them, the UL12-Cas12i3-5M strategy had the highest efficiency in editing three genes simultaneously, which was 1.21 times higher than Cas12i3-5M (82.76% / 68.42%).

[0090] for OsHRC - OsSBEIIb - OsCKX2-OsARF4 The four gene target vectors were used in tandem. The Cas12i3-5M strategy yielded 19 transgenic lines, with 10 lines showing simultaneous editing at all four sites (editing efficiency 52.63%). The T5E-Cas12i3-5M strategy yielded 14 transgenic lines, with 8 lines showing simultaneous editing at all four sites (editing efficiency 57.14%). The UL12-Cas12i3-5M strategy yielded 44 transgenic lines, with 27 lines showing simultaneous editing at all four sites (editing efficiency 61.36%). The PapE-Cas12i3-5M strategy yielded 28 transgenic lines, with 16 lines showing simultaneous editing at all four sites (editing efficiency 57.14%). The ME15-Cas12i3-5M strategy yielded 33 transgenic lines, with 19 lines showing simultaneous editing at all four sites (editing efficiency 57.58%). Figure 5 Compared to Cas12i3-5M, the fusion exonuclease strategy improved editing efficiency in all cases. Among them, the UL12-Cas12i3-5M strategy had the highest efficiency in editing four genes simultaneously, which was 1.17 times higher than Cas12i3-5M (61.36% / 52.63%).

[0091] for OsHRC - OsSBEIIb - OsCKX2-OsARF4-OsARE1Five gene target vectors were used in tandem. The Cas12i3-5M strategy yielded 30 transgenic lines, with 13 lines showing simultaneous editing at all five sites (editing efficiency 43.33%). The T5E-Cas12i3-5M strategy yielded 20 transgenic lines, with 10 lines showing simultaneous editing at all five sites (editing efficiency 50.00%). The UL12-Cas12i3-5M strategy yielded 34 transgenic lines, with 18 lines showing simultaneous editing at all five sites (editing efficiency 52.94%). The PapE-Cas12i3-5M strategy yielded 30 transgenic lines, with 14 lines showing simultaneous editing at all five sites (editing efficiency 46.67%). The ME15-Cas12i3-5M strategy yielded 11 transgenic lines, with 5 lines showing simultaneous editing at all five sites (editing efficiency 45.45%). Figure 5 Compared to Cas12i3-5M, the fusion exonuclease strategy improved editing efficiency in all cases. Among them, the UL12-Cas12i3-5M strategy had the highest efficiency in editing five genes simultaneously, which was 1.22 times higher than Cas12i3-5M (52.94% / 43.33%).

[0092] for OsHRC - OsSBEIIb - OsCKX2-OsARF4-OsARE1-OsBADH2 The vectors targeting six gene sites in tandem yielded the following results: Cas12i3-5M strategy: 48 transgenic lines were obtained, with 20 lines showing simultaneous editing at all six sites (editing efficiency 41.67%); T5E-Cas12i3-5M strategy: 34 transgenic lines were obtained, with 16 lines showing simultaneous editing at all six sites (editing efficiency 47.06%); UL12-Cas12i3-5M strategy: 47 transgenic lines were obtained, with 24 lines showing simultaneous editing at all six sites (editing efficiency 51.07%); PapE-Cas12i3-5M strategy: 43 transgenic lines were obtained, with 20 lines showing simultaneous editing at all six sites (editing efficiency 46.51%); ME15-Cas12i3-5M strategy: 14 transgenic lines were obtained, with 6 lines showing simultaneous editing at all six sites (editing efficiency 42.86%). Figure 5 Compared to Cas12i3-5M, the fusion exonuclease strategy improved editing efficiency in all cases. Among them, the UL12-Cas12i3-5M strategy had the highest efficiency in editing four genes simultaneously, which was 1.23 times higher than Cas12i3-5M (51.07% / 41.67%).

[0093] This invention utilizes the highly efficient Cas12i3-5M, T5E-Cas12i3-5M, UL12-Cas12i3-5M, PapE-Cas12i3-5M, and ME15-Cas12i3-5M strategies to construct a multi-gene editing system for rice. Combinations of three, four, five, and six genes were designed for tandem knockout, and Agrobacterium-mediated stable genetic transformation of rice was performed. Results showed that the fusion of exonucleases T5E, UL12, PapE, and ME15 all improved the multi-gene editing efficiency of Cas12i3-5M. Among these, the UL12-Cas12i3-5M strategy maintained the highest editing efficiency across all gene tandem combinations, with efficiencies of 82.76%, 61.36%, 52.94%, and 51.07% for simultaneous editing of three, four, five, and six genes, respectively. Therefore, this invention utilizes the strategy of fusing the Cas12i3-5M variant with different exonucleases to establish an efficient multi-gene editing system in rice, among which UL12-Cas12i3-5M has the highest efficiency, and the multi-gene editing efficiency of different combinations is not less than 50%.

[0094] 2.4 Off-target analysis of T0 generation edited plants Using the Offtarget website (http: / / skl.scau.edu.cn / offtarget / ), predict the growth rate of rice. OsHRC, OsSBEIIb , OsCKX2, OsARE1, OsBADH2, OsDEP1 and OsARF4 Potential off-target sites for the selected target genes were identified, and specific primers were designed for PCR amplification and sequencing. Sequence alignment was used to determine whether off-target effects existed for the selected target genes. The predicted potential off-target sites are shown in Table 3, with a total of 96 strains identified for each site.

[0095] for OsARF4 A total of 96 strains were identified as targets. Among them, 6 strains were found to have off-target effects at the predicted potential off-target sites OsARF4-OFF1 and OsARF4-OFF2, with an off-target rate of 6.25% at both sites. No off-target effects were found at the remaining potential off-target sites (Table 3).

[0096] Table 3. Off-target analysis of T0 generation edited plants

[0097] Note: The first three underlined letters of "potential off-target sequence" indicate PAM sequence, and the bolded letters indicate mismatch sequence.

[0098] 3. Conclusion This invention establishes a highly efficient single-gene knockout system for rice by conducting single-gene editing tests on Cas12i3, Cas12i3-5M variants, and fusions of Cas12i3-5M with exonucleases such as T5E, UL12, PapE, and ME15. Furthermore, it utilizes efficient strategies such as Cas12i3-5M, T5E-Cas12i3-5M, UL12-Cas12i3-5M, PapE-Cas12i3-5M, and ME15-Cas12i3-5M to conduct multi-gene editing research in rice. The UL12-Cas12i3-5M strategy maintains the highest simultaneous editing efficiency in combinations of three, four, five, and six genes. The establishment of this highly efficient multi-gene editing system for rice provides important tools and technical support for using CRISPR / Cas12i3 to conduct crop gene function research and for creating new crop germplasm by aggregating multiple superior alleles in a first generation. The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

[0099] References Bortesi, L., C. Zhu, J. Zischewski, L. Perez, L. Bassie, R. Nadi, G.Forni, SB Lade, E. Soto, X. Jin, V. Medina, G. Villorbina, P. Munoz, G.Farre, R. Fischer, RM Twyman, T. Capell, P. Christou&S. Schillberg (2016)Patterns of CRISPR / Cas9 activity in plants, animals and microbes. PlantBiotechnol J, 14, 2203-2216. Ding, Y., F. Zhang, F. Sun, J. Liu, Z. Zhu, X. He, G. Bai, Z. Ni, Q.Sun&Z. Su (2023) Loss of OsHRC function confers blast resistance withoutyield penalty in rice. Plant Biotechnol J, 21, 1516-1518. Guo, D., X. Ling, X. Zhou, X. Li, J. Wang, S. Qiu, Y. Yang&B. Zhang(2020) Evaluation of the Quality of a High-Resistant Starch and Low-GlutelinRice (Oryza sativa L.) Generated through CRISPR / Cas9-Mediated TargetedMutagenesis. J Agric Food Chem, 68, 9733-9742. He, Y., Y. Han, Y. Ma, S. Liu, T. Fan, Y. Liang, X. Tang, X. Zheng,Y. Wu, T. Zhang, Y. Qi&Y. Zhang (2024) Expanding plant genome editing scopeand profiles with CRISPR-FrCas9 systems targeting palindromic TA sites. PlantBiotechnol J, 22, 2488-2503. Hu, Z., S. J. Lu, M. J. Wang, H. He, L. Sun, H. Wang, X. H. Liu, L.Jiang, J. L. Sun, X. Xin, W. Kong, C. Chu, H. W. Xue, J. Yang, X. Luo&J. X.Liu (2018) A Novel QTL qTGW3 Encodes the GSK3 / SHAGGY-Like Kinase OsGSK5 / OsSK41 that Interacts with OsARF4 to Negatively Regulate Grain Size andWeight in Rice. Mol Plant, 11, 736-749. Hui, S., H. Li, A. M. Mawia, L. Zhou, J. Cai, S. Ahmad, C. Lai, J.Wang, G. Jiao, L. Xie, G. Shao, Z. Sheng, S. Tang, J. Wang, X. Wei, S. Hu&P.Hu (2022) Production of aromatic three-line hybrid rice using novel allelesof BADH2. Plant Biotechnol J, 20, 59-74. Li, C., Z. Zhou, X. Xiong, C. Li, C. Li, E. Shen, J. Wang, W. Zha, B.Wu, H. Chen, L. Zhou, Y. Lin&A. You (2024) Development of a multi-resistanceand high-yield rice variety using multigene transformation and gene editing.Plant Biotechnol J, 22, 3118-3120. Li, J., S. Zhang, R. Zhang, J. Gao, Y. Qi, G. Song, W. Li, Y. Li&G.Li (2021) Efficient multiplex genome editing by CRISPR / Cas9 in common wheat.Plant Biotechnol J, 19, 427-429. Li, S., L. Shen, P. Hu, Q. Liu, X. Zhu, Q. Qian, K. Wang&Y. Wang(2019) Developing disease-resistant thermosensitive male sterile rice bymultiplex gene editing. J Integr Plant Biol, 61, 1201-1205. Liang, Z., Y. Wu, Y. Guo&S. Wei (2023) Addition of the T5 exonucleaseincreases the prime editing efficiency in plants. J Genet Genomics, 50, 582-588. Liu, K., Y. Sakuraba, N. Ohtsuki, M. Yang, Y. Ueda&S. Yanagisawa(2023) CRISPR / Cas9-mediated elimination of OsHHO3, a transcriptionalrepressor of three AMMONIUM TRANSPORTER1 genes, improves nitrogen useefficiency in rice. Plant Biotechnol J, 21, 2169-2172. Lorenzo, C. D., K. Debray, D. Herwegh, W. Develtere, L. Impens, D.Schaumont, W. Vandeputte, S. Aesaert, G. Coussens, Y. De Boe, K. Demuynck, T.Van Hautegem, L. Pauwels, T. B. Jacobs, T. Ruttink, H. Nelissen&D. Inze(2023) BREEDIT: a multiplex genome editing strategy to improve complexquantitative traits in maize. Plant Cell, 35, 218-238. Luo, J., S. Li, J. Xu, L. Yan, Y. Ma&L. Xia (2021) Pyramidingfavorable alleles in an elite wheat variety in one generation by CRISPR-Cas9-mediated multiplex gene editing. Mol Plant, 14, 847-850. Lv, P., F. Su, F. Chen, C. Yan, D. Xia, H. Sun, S. Li, Z. Duan, C.Ma, H. Zhang, M. Wang, X. Niu, J. K. Zhu&J. Zhang (2024) Genome editing inrice using CRISPR / Cas12i3. Plant Biotechnol J, 22, 379-385. Miao Liu, J., Q. Mei, C. Yun Xue, Z. Yuan Wang, D. Pin Li, Y. XinZhang&Y. Hu Xuan (2021) Mutation of G-protein gamma subunit DEP1 increasesplanting density and resistance to sheath blight disease in rice. PlantBiotechnol J, 19, 418-420. Ming, M., Q. Ren, C. Pan, Y. He, Y. Zhang, S. Liu, Z. Zhong, J. Wang,AA Malzahn, J. Wu, X. Zheng, Y. Zhang&Y. Qi (2020) CRISPR-Cas12b enableefficient plant genome engineering. Nat Plants, 6, 202-208. Pan, W., C. Gao, D. Niu, J. Cheng, J. Zhang, X. Yan, Q. Long, Y. Zhu,W. Sun, Q. Xie, Y. He, XW Deng, H. Zhang&J. Li (2024) Efficient genedisruption in polyploid genome by Cas9-Trex2 fusion protein. J Integr PlantBiol. Rong, C., Y. Liu, Z. Chang, Z. Liu, Y. Ding&C. Ding (2022) Cytokininoxidase / dehydrogenase family genes exhibit functional divergence and overlapin rice growth and development, especially in control of tillering. J ExpBot, 73, 3552-3568. Schreiber, T., A. Prange, P. Schafer, T. Iwen, R. Grutzner, S.Marillonnet, A. Lepage, M. Javelle, W. Paul&A. Tissier (2024) Efficient scar-free knock-ins of several kilobases in plants by engineered CRISPR-Casendonucleases. Mol Plant, 17, 824-837. Shan, Q., Y. Wang, J. Li, Y. Zhang, K. Chen, Z. Liang, K. Zhang, J.Liu, J. J. Xi, J. L. Qiu&C. Gao (2013) Targeted genome modification of cropplants using a CRISPR-Cas system. Nat Biotechnol, 31, 686-8. Sun, S., L. Wang, H. Mao, L. Shao, X. Li, J. Xiao, Y. Ouyang&Q. Zhang(2018) A G-protein pathway determines grain size in rice. Nat Commun, 9, 851. Tang, X., L. G. Lowder, T. Zhang, A. A. Malzahn, X. Zheng, D. F.Voytas, Z. Zhong, Y. Chen, Q. Ren, Q. Li, E. R. Kirkland, Y. Zhang&Y. Qi(2017) A CRISPR-Cpf1 system for efficient genome editing and transcriptionalrepression in plants. Nat Plants, 3, 17103. Wang, M., Y. Mao, Y. Lu, X. Tao&J. K. Zhu (2017) Multiplex GeneEditing in Rice Using the CRISPR-Cpf1 System. Mol Plant, 10, 1011-1013. Wang, Q., J. Nian, X. Xie, H. Yu, J. Zhang, J. Bai, G. Dong, J. Hu,B. Bai, L. Chen, Q. Xie, J. Feng, X. Yang, J. Peng, F. Chen, Q. Qian, J. Li&J. Zuo (2018) Genetic variations in ARE1 mediate grain yield by modulatingnitrogen utilization in rice. Nat Commun, 9, 735. Wu, Y., Q. Yuan, Y. Zhu, X. Gao, J. Song&Z. Yin (2020) ImprovingFnCas12a Genome Editing by Exonuclease Fusion. CRISPR J, 3, 503-511. Xu, R., R. Qin, H. Li, D. Li, L. Li, P. Wei&J. Yang (2017) Generationof targeted mutant rice using a CRISPR-Cpf1 system. Plant Biotechnol J, 15,713-717. Zhang, D., B. Tian, Y. Ling, L. Ye, M. Xiao, K. Yuan, X. Zhang, G.Zheng, X. Li, J. Zheng, Y. Liao, B. Shu&B. Gu (2024) CRISPR / Cas12a-PoweredAmplification-Free RNA Diagnostics by Integrating T7 Exonuclease-AssistedTarget Recycling and Split G-Quadruplex Catalytic Signal Output. Anal Chem,96, 10451-10458. Zhang, H., X. Kong, M. Xue, J. Hu, Z. Wang, Y. Wei, H. Wang, J. Zhou,W. Zhang, M. Xu, X. Shen, F. Yin, Z. Ai, G. Huang, J. Xia, X. Song, H. Li, Y.Yuan, J. Li, N. Zhong, M. Zhang, Y. Zhou&H. Yang (2023) An engineered xCas12iwith high activity, high specificity, and broad PAM range. Protein Cell, 14,538-543. Zheng, X., S. Zhang, Y. Liang, R. Zhang, L. Liu, P. Qin, Z. Zhang, Y.Wang, J. Zhou, X. Tang&Y. Zhang (2023) Loss-function mutants of OsCKX genefamily based on CRISPR-Cas systems revealed their diversified roles in rice.Plant Genome, 16, e20283。

Claims

1. A fusion protein, characterized by: The fusion protein is a PapE-Cas12i3-5M fusion protein, which contains the exonucleases PapE and Cas12i3-5M.

2. The fusion protein according to claim 1, characterized in that: The PapE is as follows: (C1), (C2), or (C3) C1) Amino acid is the protein located at positions 20-625 of SEQ ID No. 10; C2) A protein having the same function by substituting and / or deleting and / or adding one or more amino acid residues from position 20 to 625 of SEQ ID No. 10; C3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of C1) or C2).

3. The fusion protein according to claim 1 or 2, characterized in that: The fusion protein also contains nuclear localization signals and / or linker peptides.

4. The fusion protein according to any one of claims 1-3, characterized in that: The PapE-Cas12i3-5M fusion protein is a protein whose amino acid composition is SEQ ID No.

10.

5. The biomaterial relating to any of the fusion proteins described in claims 1-4 is at least one of the following (H1)-H4): H1) is a nucleic acid molecule encoding any of the fusion proteins described in claims 1-4; H2) contains an expression cassette containing the nucleic acid molecule described in H1); H3) A recombinant vector containing the nucleic acid molecule described in H1) or a recombinant vector containing the expression cassette described in H2); H4) Recombinant microorganisms containing the nucleic acid molecules described in H1), recombinant microorganisms containing the expression cassette described in H2), or recombinant microorganisms containing the recombinant vector described in H3).

6. The biomaterial according to claim 5, characterized in that: In the nucleic acid molecule described in H1), the nucleic acid molecule encoding the PapE is a DNA molecule whose coding sequence is the 58th to 1875th positions of SEQ ID No. 9 in the sequence listing; The nucleic acid molecule encoding the Cas12i3-5M is a DNA molecule whose coding sequence is positions 124-3267 of SEQ ID No. 3 in the sequence listing.

7. The biomaterial according to claim 5 or 6, characterized in that: The recombinant vector (H3) further contains a crRNA expression cassette, which contains a DNA fragment of tRNA shown at positions 1327-1403 of SEQ ID No. 13, a DR sequence of Cas12i3 crRNA shown at positions 1404-1439 or 1417-1439, and a DNA fragment of HDV shown at positions 1448-1515.

8. The application of the fusion protein according to any one of claims 1-4 in rice gene editing.

9. The application of the biomaterials described in any one of claims 5-7 in rice gene editing.

10. The application according to claim 8 or 9, characterized in that: The gene may be a single gene or multiple genes.

Citation Information

Patent Citations

  • Seed specificity highly effective promoter and its application

    CN101063139A

  • Seed specific highly effective promoter and its application

    CN101063139B

  • Recombinant DNA: transformed microorganisms, plant cells and plants: a process for introducing an inducible property in plants, and a process for producing a polypeptide or protein by means of plants or plant cells

    US5057422A

  • Plant proteins, promoters, coding sequences and use

    US5187267A