A tricyclene synthase variant and uses thereof

CN122609550APending Publication Date: 2026-08-21RES INST OF CHEM DEFENSE PLA ACAD OF MILITARY SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610768917.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-05-31
Publication Date
2026-08-21

AI Technical Summary

Technical Problem

[0005]然而,上述技术仍存在以下不足:一方面,三环烯的绝对产量仍处于较低水平(47.671 mg/L),远未达到工业化生产的经济性要求,且现有研究尚未涉及到为了提升催化效率而对酶本身的理性改造;另一方面,野生型三环烯合酶的产物谱较为混杂,除三环烯外还产生α-蒎烯、β-蒎烯、桧烯、莰烯和柠檬烯等多种副产物,而现有技术尚未提供对产物特异性进行精准调控的有效手段

Benefits of technology

(1)本发明提供的三环烯合酶变体(氨基酸序列如SEQ ID NO.2~5所示)通过引入L178F、G427A和G567A中任意二者或三者的组合突变,在作为三环烯合酶时显著提高了三环烯的生物合成产量。其中,L178F/G427A/G567A变体(SEQ ID NO.5)作为三环烯合酶时,其三环烯的产量可达117.41 mg/L,为野生型三环烯合酶作为三环烯合酶时的三环烯的产量的305.76%,其催化效率可提升至野生型三环烯合酶的催化效率的3.5倍。上述各突变位点之间产生了显著的协同增效作用,其在催化效率方面的提升幅度远超各单点突变效果之和。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122609550A_ABST
    Figure CN122609550A_ABST
Patent Text Reader

Abstract

This invention belongs to the field of biotechnology, specifically relating to a tricyclic olefin synthase variant and its applications. Addressing the problems of low catalytic efficiency and difficulty in regulation of existing tricyclic olefin synthases, this invention provides multiple variants based on the wild-type tricyclic olefin synthase NsTS sequence, including mutations of any two or three of L178F, G427A, and G567A, or the Y433F / L / W or A354L / I mutations. The L178F / G427A / G567A variant achieves a tricyclic olefin yield of 117.41 mg / L, which is 305.76% of the wild type; the Y433F, Y433L, and Y433W variants change the main product from tricyclic olefin to limonene, α-pinene, and β-pinene, respectively; and the A354L and A354I variants change the main product to α-pinene and juniperene, respectively. This invention also provides the coding gene for the aforementioned variants, a recombinant expression vector, an engineered strain, and a method for producing tricyclic olefins. This invention provides high-performance enzyme elements for the green biomanufacturing of tricycloenes and provides precise targets for the rational design of monoterpene synthase products.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a tricyclic olefin synthase variant and its applications. Background Technology

[0002] Tricyclene is a naturally occurring tricyclic monoterpene with a rigid tricyclic skeleton consisting of a cyclopropane and a cyclopentane. It has high octane number, low freezing point and excellent oxidative stability, and can be used as a high-density fuel additive and polymer precursor, which has important application value in the fields of energy and advanced materials.

[0003] Currently, tricyclic ene production mainly relies on direct extraction from plants, which suffers from low efficiency, high energy consumption, and significant pollution. Microbial biosynthesis is a green alternative for obtaining tricyclic enes, offering sustainability and cost advantages. Tricyclene synthase is a key rate-limiting enzyme in the tricyclic ene biosynthesis pathway, catalyzing the multi-step cyclization and rearrangement of geranyyl pyrophosphate (GPP) to produce tricyclic enes. Its catalytic efficiency directly affects the yield of tricyclic enes.

[0004] In the prior art, the gene and amino acid sequence of the tricyclic ene synthase NsTS (UniProt ID A0A1U7XP70) derived from tobacco (Nicotiana sylvestris) have been publicly available in public databases. Zhao et al. (Fermentation, 2024, 10: 173) first reported the heterologous expression and functional characterization of this enzyme in Escherichia coli. This study successfully constructed a tricyclic ene biosynthetic pathway by introducing the heterologous mevalonic acid (MVA) pathway, geranyl pyrophosphate synthase (GPPS), and tricyclic ene synthase NsTS into Escherichia coli. Through transport peptide truncation and fermentation condition optimization, the tricyclic ene yield reached 47.671 mg / L, which is approximately 794.5 times higher than the tricyclic ene synthase yield, representing the highest yield reported to date.

[0005] However, the above-mentioned technologies still have the following shortcomings: On the one hand, the absolute yield of tricyclic enes is still at a low level (47.671 mg / L), far from meeting the economic requirements for industrial production, and existing research has not yet involved rational modification of the enzyme itself to improve catalytic efficiency; on the other hand, the product spectrum of wild-type tricyclic ene synthase is relatively mixed, producing a variety of byproducts in addition to tricyclic enes, such as α-pinene, β-pinene, sapinene, camphene, and limonene, and existing technologies have not yet provided effective means for precise control of product specificity. Summary of the Invention

[0006] The purpose of this invention is to develop tricyclic ene synthases with high activity and high selectivity to meet the needs of improving the biosynthetic efficiency of tricyclic enes or precisely regulating the specificity of products.

[0007] To achieve the above-mentioned technical objectives, the technical solution of the present invention is as follows: In a first aspect, the present invention provides a tricyclic olefin synthase variant, wherein the amino acid sequence of the tricyclic olefin synthase variant contains the following site mutations relative to SEQ ID NO: 1: ① Mutations selected from at least two of the following sites: leucine at position 178 is mutated to phenylalanine L178F, glycine at position 427 is mutated to alanine G427A, and glycine at position 567 is mutated to alanine G567A. or ② The tyrosine residue at position 433 is mutated to phenylalanine Y433F, leucine Y433L, or tryptophan Y433W; or ③ The alanine at position 354 is mutated to leucine A354L or isoleucine A354I; or It contains a combination of mutation sites ① and ② or ① and ③.

[0008] Preferably, the amino acid sequence of the tricyclic olefin synthase variant is as shown in SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO.5.

[0009] The above-mentioned tricyclic alkyl synthase variants can be obtained by the following method: based on the wild-type tricyclic alkyl synthase NsTS sequence shown in SEQ ID NO.1 (derived from tobacco Nicotiana sylvestris), one of the following mutation combinations is introduced: (1) leucine at position 178 is mutated to phenylalanine (L178F) and glycine at position 427 is mutated to alanine (G427A); (2) glycine at position 427 is mutated to alanine (G427A) and glycine at position 567 is mutated to alanine (G567A); (3) leucine at position 178 is mutated to phenylalanine (L178F) and glycine at position 567 is mutated to alanine (G567A); (4) leucine at position 178 is mutated to phenylalanine (L178F), glycine at position 427 is mutated to alanine (G427A) and glycine at position 567 is mutated to alanine (G567A).

[0010] Experiments showed that variants containing the above-mentioned mutant combinations significantly increased tricyclic ene yield when used as tricyclic ene synthases. Among them, the variant shown in SEQ ID NO. 5 (L178F / G427A / G567A) achieved a tricyclic ene yield of 117.41 mg / L, which is 305.76% of the yield of the wild-type tricyclic ene synthase, and its catalytic efficiency (kcat / Km) is 3.5 times that of the wild-type tricyclic ene synthase. Molecular dynamics studies revealed that the G427A and G567A mutations enhanced the helical tightness of the active pocket and reduced water molecule ingress, creating a hydrophobic catalytic microenvironment. The L178F mutation synergistically enhanced the above mutations, further improving catalytic performance.

[0011] Preferably, the amino acid sequence of the tricyclic olefin synthase variant is selected from the sequence shown in SEQ ID NO.6, SEQ ID NO.7 or SEQ ID NO.8.

[0012] The above-mentioned tricyclic olefin synthase variants can be obtained by the following method: based on the wild-type tricyclic olefin synthase NsTS sequence shown in SEQ ID NO.1, tyrosine at position 433 is mutated to phenylalanine, leucine or tryptophan (Y433F, Y433L or Y433W).

[0013] Preferably, the amino acid sequence of the tricyclic olefin synthase variant is selected from the sequence shown in SEQ ID NO.9 or SEQ ID NO.10.

[0014] The above-mentioned tricyclic olefin synthase variants can be obtained by the following method: based on the wild-type tricyclic olefin synthase NsTS sequence shown in SEQ ID NO.1, alanine at position 354 is mutated to leucine or isoleucine (A354L or A354I).

[0015] In a second aspect, the present invention provides a gene encoding the tricyclic olefin synthase variant described in the first aspect.

[0016] Thirdly, the present invention provides a recombinant expression vector comprising the coding gene described in the second aspect.

[0017] Fourthly, the present invention provides an engineered strain comprising the recombinant expression vector described in the third aspect.

[0018] Fifthly, the present invention provides a method for constructing a modified tricyclic olefin synthase, comprising the following mutations to the wild-type tricyclic olefin synthase NsTS sequence shown in SEQ ID NO.1: a combination of mutations of glycine at position 427 to alanine (G427A), glycine at position 567 to alanine (G567A), and leucine at position 178 to phenylalanine (L178F).

[0019] Compared to wild-type tricyclic alkyl synthase, the catalytic efficiency (kcat / Km) of the obtained tricyclic alkyl synthase was significantly increased by 3.5 times. This is likely because the G427A and G567A mutations enhance the tightness of the outer helices of the active pocket (helices 488-506, 531-554, and 560-577), effectively preventing water molecules from entering the active site and forming a hydrophobic catalytic microenvironment, which is beneficial to the stability of the carbocation intermediate and the precise execution of multi-step cyclization reactions. The L178F mutation further enhances the synergistic effect.

[0020] In a sixth aspect, the present invention provides a method for constructing a modified tricyclic olefin synthase, comprising mutating the tyrosine at position 433 of the wild-type tricyclic olefin synthase NsTS sequence shown in SEQ ID NO.1 to any one of phenylalanine, leucine, or tryptophan (Y433F / L / W); or mutating the alanine at position 354 to any one of leucine or isoleucine (A354L / I).

[0021] Compared to wild-type tricyclic olefin synthases, the tricyclic olefin synthases obtained in this way all exhibit altered product specificity: the Y433F variant changed the main product from tricyclic olefin to limonene, the Y433L variant to α-pinene, and the Y433W variant to β-pinene; the A354L variant changed the main product to α-pinene, and the A354I variant changed the main product to juniperene. This may be because Y433 is located at a key position in the active site and participates in the proton relay network; its mutations achieve a systematic reshaping of the product profile by altering the geometric characteristics of the proton transfer network or the selectivity of the cyclization pathway. The A354L / I variants achieve directional product switching by enhancing the hydrophobic interaction with the carbocation intermediate and altering the proton transfer pathway.

[0022] The tricyclic olefin synthase variant provided by this invention has high activity and / or high selectivity, and has the following beneficial effects compared to wild-type tricyclic olefin synthase: (1) The tricyclic olefin synthase variants (amino acid sequences shown in SEQ ID NO. 2-5) provided by this invention significantly improve the biosynthetic yield of tricyclic olefins when used as tricyclic olefin synthases by introducing a combination mutation of any two or three of L178F, G427A, and G567A. Among them, the L178F / G427A / G567A variant (SEQ ID NO. 5) as a tricyclic olefin synthase can achieve a tricyclic olefin yield of 117.41 mg / L, which is 305.76% of the tricyclic olefin yield of the wild-type tricyclic olefin synthase, and its catalytic efficiency can be increased to 3.5 times that of the wild-type tricyclic olefin synthase. A significant synergistic effect is generated among the above mutation sites, and the improvement in catalytic efficiency is far greater than the sum of the effects of each individual mutation.

[0023] (2) The Y433 series variants provided by this invention (amino acid sequences shown in SEQ ID NO. 9~11) achieve precise regulation of the product specificity of tricyclic olefin synthase by introducing a single-point mutation of phenylalanine, leucine, or tryptophan at position 433. The main product of the Y433F variant changes from tricyclic olefin to limonene, the Y433L variant changes to α-pinene, and the Y433W variant changes to β-pinene, revealing the key function of the Y433 site as a product specificity regulatory switch.

[0024] (3) The A354 series variants provided by this invention (amino acid sequences as shown in SEQ ID NO. 12~13) also achieve product-specific directional switching by introducing a single-point mutation of leucine or isoleucine at position 354. The main product of the A354L variant is converted to α-pinene, and the main product of the A354I variant is converted to juniperene, forming a complementary product regulation network with the Y433 series.

[0025] (4) The tricyclic ene synthase provided by this invention improves catalytic efficiency, thereby meeting the need to improve the biosynthetic efficiency of tricyclic enes. The tricyclic ene synthase provided by this invention can precisely and effectively regulate the specificity of the product tricyclic ene. The tricyclic ene synthase variant obtained by this invention provides a high-performance enzyme element for the green biomanufacturing of tricyclic enes, expands the application of tricyclic enes, and thus has important scientific significance as well as important industrial application value and commercial value. Attached Figure Description

[0026] Figure 1 A comparison graph showing the yield of tricycloene produced using wild-type tricycloene synthase from Comparative Example 1 and tricycloene synthase variants from Comparative Examples 3, 5, 7, 1, 3, 5, and 7. Figure 2 A comparative diagram showing the catalytic products of the wild-type tricycloene synthase of Comparative Example 1 and the variants of Examples 7, 9, 11, 13, 15, and 17 in the production of tricycloene; Figure 3 Steady-state kinetic analysis curves for wild-type tricycloene synthase and L178F / G427A / G567A variants; where (a) wild-type and (b) L178F / G427A / G567A variants. Detailed Implementation

[0027] The technical solution of the present invention will be described in detail below with reference to specific embodiments. The following embodiments are only used to exemplify specific implementation schemes of the present invention and do not constitute a limitation on the scope of protection of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort, as well as reasonable adjustments to the specific operating conditions and experimental parameters in the embodiments without departing from the core inventive concept of the present invention, are all within the scope of protection of the present invention.

[0028] For example, the gene encoding the tricyclic olefin synthase variant of the present invention can be obtained artificially or amplified from a natural source containing the gene (such as plant tissues like cannabis) using molecular cloning techniques known in the art. The expression vector can be constructed using any conventional cloning method such as Gibson assembly, enzyme digestion and ligation, or homologous recombination. The host cell used to express the variant of the present invention includes, but is not limited to, *Escherichia coli*, and can also be a commonly used microbial expression platform in the art such as *Saccharomyces cerevisiae*, *Yersinia lipolytica*, or *Bacillus subtilis*. The expression mode includes plasmid-free expression and genome-integrated expression, as long as the functional expression of the variant of the present invention can be achieved. All the above equivalent alternatives are within the scope of protection of the present invention.

[0029] Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by those skilled in the art. The technical terms used herein are for the purpose of describing particular embodiments only and are not intended to limit the scope of the invention. Unless otherwise specified, all raw materials, reagents, instruments, and equipment used in this invention are commercially available or can be prepared by existing methods.

[0030] Experimental Materials Description Plasmid p3933 is the recombinant vector backbone for the expression of the tricyclic olefin synthase variant in this invention. This plasmid is derived from the commercially available vector pET-30a(+) (Novagen, catalog number 69909), retaining the pBR322 replicon (ColE1 type), ampicillin resistance gene, and T7 promoter region. The specific construction method is as follows: using pET-30a(+) as a template, a backbone fragment containing the T7 promoter, multiple cloning site, and T7 terminator was obtained by PCR amplification. Simultaneously, a Ptrc promoter (i.e., a Ptrc promoter without the lacI operator sequence) was introduced to replace the original T7 promoter region to suit IPTG-induced expression. The resulting vector was named p3933 after sequencing verification. The expression vector of this invention is not limited to p3933; other commercially available vectors suitable for E. coli expression, such as the pET series, pGEX series, and pBAD series, can also be used to express the tricyclic olefin synthase variant described in this invention.

[0031] The plasmid pAC-6409mva is an auxiliary plasmid for providing the heterologous mevalonic acid (MVA) pathway in *Escherichia coli*, containing a p15A replicon and a chloramphenicol resistance gene. Its construction method follows the description in the literature (Bao et al., 2021, *CellReports*, 36:109413): using pJBEI-6409 (Addgene plasmid #47048) as a backbone, MVA pathway genes (atoB, HMGS, HMGR, MK, PMK, PMD) and the isopentenyl diphosphate isomerase gene (idi) from *Enterococcus faecalis* were amplified by PCR and placed under the control of the PlacUV5 and Ptrc promoters, respectively, and then seamlessly cloned and assembled. The pAC-6409mva plasmid can be obtained through conventional molecular cloning methods or can be obtained from relevant depositary institutions.

[0032] Escherichia coli BS1101 is the host strain used for tricycloene production in this invention. This strain is derived from wild-type... E. coli MG1655 (ATCC 700926, commercially available) was obtained through genome editing; specific construction methods can be found in the literature (Bao et al., 2019, Plasmid, 105:102431; Bao et al., 2021, Cell Reports, 36:109413). In short, using CRISPR-Cas9-assisted scarless gene knockout technology (no-SCAR method), the following genes in the MG1655 genome were sequentially deleted: recA, recE, recF, recJ, and endA. The deletion of recA, recE, recF, and recJ blocked the plasmid homologous recombination pathway, reducing plasmid instability during fermentation; the deletion of endA eliminated intracellular endonuclease activity, improving plasmid DNA integrity. The resulting strain BS1101 exhibits both good growth characteristics and plasmid stability, making it particularly suitable for the heterologous production of terpenoids. The host strain of this invention is not limited to BS1101. Other Escherichia coli strains suitable for recombinant protein expression, such as BL21(DE3), Rosetta(DE3), and Origami(DE3), can also be used to express the tricyclic olefin synthase variant described in this invention. Furthermore, after changing the corresponding expression vector and regulatory elements, other microbial expression platforms such as Saccharomyces cerevisiae (e.g., CEN.PK series), Yersinia lipolyticis, and Bacillus subtilis can also be used, as long as the functional expression of the variant of this invention can be achieved.

[0033] Comparative Example 1: Construction of wild-type tricyclic ene synthase NsTS This comparative example provides a method for constructing wild-type tricyclic olefin synthase NsTS, with the following specific steps: The entire gene encoding wild-type tricyclic olefin synthase NsTS (amino acids 46-608 of SEQ ID NO.1) was synthesized, and codons were optimized for the *E. coli* expression system. Using the wild-type NsTS encoding gene as the initial template, PCR amplification was performed using primers with homologous arms from the p3933 vector. The PCR reaction conditions were: 98℃ pre-denaturation for 30 seconds; 98℃ denaturation for 10 seconds, 55℃ annealing for 30 seconds, 72℃ extension for 2 minutes, for a total of 30 cycles; and a final extension at 72℃ for 10 minutes. After digestion with DpnI to remove the template plasmid, the PCR product was recovered and purified to obtain the NsTS encoding gene fragment with homologous arms at both ends.

[0034] The plasmid p3933 was linearized using restriction endonucleases. The PCR product containing the p3933 homologous arm was then ligated to the linearized p3933 vector via homologous recombination using the Gibson Assembly method. The ligation product was transformed into commercially available *E. coli* DH5α competent cells and plated on LB agar plates containing 100 mg / L ampicillin, incubated overnight at 37°C.

[0035] Single clones were selected for colony PCR identification, and positive clones were sequenced for verification. The recombinant plasmid was named p3933- nsts .

[0036] Comparative Example 2: Production of Tricycloene by Fermentation Using Wild-Type Tricycloene Synthase Engineered Strain NsTS This comparative example provides a method and results for the fermentation production of tricycloenes using an engineered strain of wild-type tricycloene synthase NsTS.

[0037] The recombinant expression vector p3933- constructed in Comparative Example 1 was used. nsts The plasmid pAC-6409mva, containing the heterologous mevalonate pathway, was co-transformed into *E. coli* BS1101 competent cells via chemical transformation. After transformation, the cells were plated on LB agar plates containing 100 mg / L ampicillin and 34 mg / L chloramphenicol and incubated overnight at 37°C. Single colonies were picked to obtain the engineered strain expressing tricyclic alkylene synthase (NsTS).

[0038] Single clones of the engineered strain were picked from the plate and inoculated into 3 mL of LB liquid medium containing the corresponding antibiotics. The culture was incubated overnight at 37°C and 220 rpm to obtain the seed culture. The seed culture was then transferred at a 2% (v / v) inoculation rate to a 250 mL shake flask containing 20 mL of fermentation medium (containing 9.8 g / L K₂HPO₄, 5 g / L beef extract, 0.3 g / L ferric ammonium citrate, 2.1 g / L citric acid monohydrate, 61.1 mg / L MgSO₄, 10 g / L tryptone, 10 g / L glucose, 100 mg / L ampicillin, and 34 mg / L chloramphenicol). After culturing at 37°C and 220 rpm for 5 hours, IPTG was added to a final concentration of 0.5 mM to induce expression. Simultaneously, 20% (v / v) dodecane was added as an organic capping layer for in-situ extraction. Fermentation was then continued at 30°C and 220 rpm for 72 hours.

[0039] After fermentation, the upper dodecane organic phase was collected, appropriately diluted with ethyl acetate, and caryophyllene was added as an internal standard. Gas chromatography-mass spectrometry (GC-MS) was used for product detection and analysis. The chromatographic column was an HP-5MS, and the temperature program was: 50℃ for 1 min, increased at 20℃ / min to 130℃ for 2 min, then increased at 40℃ / min to 290℃. Qualitative and quantitative analysis were performed by comparing the retention time and mass spectrum with that of tricycloene standards. The results showed that the control strain expressing wild-type tricycloene synthase (SEQ ID NO.1) produced 38.40 mg / L of tricycloene. Figure 1 ).

[0040] Comparative Example 3: Construction of the tricyclic ene synthase variant L178F This comparative example provides a method for constructing the tricyclic olefin synthase variant L178F, with the following specific steps: The coding gene for wild-type tricyclic alkylene synthase NsTS (corresponding to amino acids 46-608 of SEQ ID NO.1) was synthesized in its entirety, and codon optimization was performed for the *E. coli* expression system. The optimized coding gene was cloned into the commercially available plasmid pUC57 to obtain the recombinant plasmid pUC57- nsts Using this recombinant plasmid as a template, site-directed mutagenesis PCR primers for introducing the L178F mutation were designed and synthesized.

[0041] The primer pairs used to introduce the L178F mutation are as follows: Upstream primer: 5'-catctctcaggacatcttcaacgacttcaaagac -3' Downstream primer: 5'-gtctttgaagtcgttgaagatgtcctgagagatg-3' Using the wild-type NsTS encoding gene as the initial template, site-directed mutagenesis PCR amplification was performed using L178F mutant primers. The PCR reaction conditions were: 98℃ pre-denaturation for 30 seconds; 98℃ denaturation for 10 seconds, 55℃ annealing for 30 seconds, 72℃ extension for 2 minutes, for a total of 30 cycles; and a final extension at 72℃ for 10 minutes. After digestion with DpnI enzyme to remove the template plasmid, the PCR product was recovered and purified to obtain the gene containing... nsts The linear DNA fragment of the -L178F gene was obtained. The purified linear DNA fragment was re-ligated using the Gibson Assembly method. The ligation product was transformed into commercially available E. coli DH5α competent cells, plated on LB agar plates containing ampicillin, and incubated overnight at 37°C.

[0042] Single colonies were picked and inoculated into LB broth containing ampicillin and cultured overnight at 37°C. Plasmids were extracted using a commercially available plasmid miniprep kit, and sequencing confirmed the presence of the recombinant plasmid pUC57- containing the L178F single-point mutation. nsts -L178F.

[0043] Using the correctly sequenced plasmid pUC57- nsts Using L178F as a template, PCR amplification was performed using primers with p3933 homologous arms to obtain the L178F variant encoding gene fragment with p3933 homologous arms at both ends. The PCR product was digested with DpnI, recovered, and purified for later use.

[0044] The plasmid p3933 was linearized using restriction endonucleases. The PCR product containing the p3933 homologous arm was then ligated to the linearized p3933 vector via homologous recombination using the Gibson Assembly method. The ligation product was transformed into commercially available *E. coli* DH5α competent cells and plated on LB agar plates containing 100 mg / L ampicillin, incubated overnight at 37°C.

[0045] Single clones were selected for colony PCR identification, and positive clones were sequenced for verification. Sequencing results confirmed that the obtained coding gene contained a mutation at position 178, where leucine was replaced by phenylalanine. This recombinant plasmid was named p3933- nsts -L178F.

[0046] Comparative Example 4: Production of Tricycloene by Fermentation Using L178F Variant Engineered Strains This comparative example provides a method and results for the fermentation production of tricycloene using an engineered strain of the tricycloene synthase L178F variant.

[0047] The recombinant expression vector p3933- constructed in Comparative Example 3 was used. nstsL178F and plasmid pAC-6409mva containing the heterologous mevalonate pathway were co-transformed into E. coli BS1101 competent cells via chemical transformation. After transformation, the cells were plated on LB agar plates containing 100 mg / L ampicillin and 34 mg / L chloramphenicol and incubated overnight at 37°C. Single colonies were picked to obtain the engineered strain expressing the L178F tricyclic alkyl synthase variant.

[0048] Single clones of the engineered strain were picked from the plate and inoculated into 3 mL of LB liquid medium containing the corresponding antibiotics. The culture was incubated overnight at 37°C and 220 rpm to obtain the seed culture. The seed culture was then transferred at a 2% (v / v) inoculation rate to a 250 mL shake flask containing 20 mL of fermentation medium (containing 9.8 g / L K₂HPO₄, 5 g / L beef extract, 0.3 g / L ferric ammonium citrate, 2.1 g / L citric acid monohydrate, 61.1 mg / L MgSO₄, 10 g / L tryptone, 10 g / L glucose, 100 mg / L ampicillin, and 34 mg / L chloramphenicol). After culturing at 37°C and 220 rpm for 5 hours, IPTG was added to a final concentration of 0.5 mM to induce expression. Simultaneously, 20% (v / v) dodecane was added as an organic capping layer for in-situ extraction. Fermentation was then continued at 30°C and 220 rpm for 72 hours.

[0049] After fermentation, the upper dodecane organic phase was collected, appropriately diluted with ethyl acetate, and caryophyllene was added as an internal standard. Gas chromatography-mass spectrometry (GC-MS) was used for product detection and analysis. The chromatographic column was an HP-5MS, and the temperature program was: 50℃ for 1 min, increased at 20℃ / min to 130℃ for 2 min, then increased at 40℃ / min to 290℃. Qualitative and quantitative analysis were performed by comparing the retention time and mass spectrum with that of tricycloene standards. The results showed that the tricycloene yield of the strain expressing the L178F single-point variant was 52.46 mg / L (…). Figure 1 The percentage of the wild type was 36.61% higher than that of the wild type (Table 1).

[0050] Comparative Example 5: Construction of tricyclic ene synthase variant G427A This comparative example provides a method for constructing the tricyclic olefin synthase variant G427A, with the following specific steps: The coding gene for wild-type tricyclic alkylene synthase NsTS (corresponding to amino acids 46-608 of SEQ ID NO.1) was synthesized in its entirety, and codon optimization was performed for the *E. coli* expression system. The optimized coding gene was cloned into the commercially available plasmid pUC57 to obtain the recombinant plasmid pUC57- nsts Using this recombinant plasmid as a template, site-directed mutagenesis PCR primers for introducing the G427A mutation were designed and synthesized.

[0051] The primer pairs used to introduce the G427A mutation are as follows: Upstream primer: 5'-ctgcagaaatcttgggcggacctgtgcaaagct -3' Downstream primer: 5'- agctttgcacaggtccgcccaagatttctgcag -3' Using the wild-type NsTS encoding gene as the initial template, site-directed mutagenesis PCR amplification was performed using L178F mutant primers. The PCR reaction conditions were: 98℃ pre-denaturation for 30 seconds; 98℃ denaturation for 10 seconds, 55℃ annealing for 30 seconds, 72℃ extension for 2 minutes, for a total of 30 cycles; and a final extension at 72℃ for 10 minutes. After digestion with DpnI enzyme to remove the template plasmid, the PCR product was recovered and purified to obtain the gene containing... nsts - A linear DNA fragment of the G427A gene. The purified linear DNA fragment was re-ligated using the Gibson Assembly method. The ligation product was transformed into commercially available E. coli DH5α competent cells, plated on LB agar plates containing ampicillin, and incubated overnight at 37°C.

[0052] Single colonies were picked and inoculated into LB broth containing ampicillin and cultured overnight at 37°C. Plasmids were extracted using a commercially available plasmid miniprep kit, and sequencing confirmed the presence of the recombinant plasmid pUC57- containing the G427A single-point mutation. nsts -G427A.

[0053] Using the correctly sequenced plasmid pUC57- nsts Using G427A as a template, PCR amplification was performed using primers with p3933 homologous arms to obtain the G427A variant encoding gene fragment with p3933 homologous arms at both ends. The PCR product was digested with DpnI, recovered, and purified for later use.

[0054] The plasmid p3933 was linearized using restriction endonucleases. The PCR product containing the p3933 homologous arm was then ligated to the linearized p3933 vector via homologous recombination using the Gibson Assembly method. The ligation product was transformed into commercially available *E. coli* DH5α competent cells and plated on LB agar plates containing 100 mg / L ampicillin, incubated overnight at 37°C.

[0055] Single clones were selected for colony PCR identification, and positive clones were sequenced for verification. Sequencing results confirmed that the obtained coding gene contained a mutation at position 427, where glycine was changed to alanine. This recombinant plasmid was named p3933- nsts -G427A.

[0056] Comparative Example 6: Production of Tricycloene by Fermentation Using the G427A Variant Engineered Strain This comparative example provides a method and results for the fermentation production of tricycloene using an engineered strain of the tricycloene synthase G427A variant.

[0057] The recombinant expression vector p3933- constructed in Comparative Example 5 was used. nsts G427A and plasmid pAC-6409mva containing the heterologous mevalonate pathway were co-transformed into *E. coli* BS1101 competent cells via chemical transformation. After transformation, the cells were plated on LB agar plates containing 100 mg / L ampicillin and 34 mg / L chloramphenicol and incubated overnight at 37°C. Single colonies were picked to obtain the engineered strain expressing the G427A tricyclic alkyl synthase variant.

[0058] Single clones of the engineered strain were picked from the plate and inoculated into 3 mL of LB liquid medium containing the corresponding antibiotics. The culture was incubated overnight at 37°C and 220 rpm to obtain the seed culture. The seed culture was then transferred at a 2% (v / v) inoculation rate to a 250 mL shake flask containing 20 mL of fermentation medium (containing 9.8 g / L K₂HPO₄, 5 g / L beef extract, 0.3 g / L ferric ammonium citrate, 2.1 g / L citric acid monohydrate, 61.1 mg / L MgSO₄, 10 g / L tryptone, 10 g / L glucose, 100 mg / L ampicillin, and 34 mg / L chloramphenicol). After culturing at 37°C and 220 rpm for 5 hours, IPTG was added to a final concentration of 0.5 mM to induce expression. Simultaneously, 20% (v / v) dodecane was added as an organic capping layer for in-situ extraction. Fermentation was then continued at 30°C and 220 rpm for 72 hours.

[0059] After fermentation, the upper dodecane organic phase was collected, appropriately diluted with ethyl acetate, and caryophyllene was added as an internal standard. Gas chromatography-mass spectrometry (GC-MS) was used for product detection and analysis. The chromatographic column was an HP-5MS, and the temperature program was: 50℃ for 1 min, increased to 130℃ at 20℃ / min and held for 2 min, then increased to 290℃ at 40℃ / min. Qualitative and quantitative analysis were performed by comparing the retention time and mass spectrum with that of tricycloene standards. The results showed that the tricycloene yield of the strain expressing the G427A single-point variant was 54.07 mg / L (…). Figure 1 The percentage of the wild type was 40.81% higher than that of the wild type (Table 1).

[0060] Comparative Example 7: Construction of tricyclic ene synthase variant G567A This comparative example provides a method for constructing the tricyclic olefin synthase variant G567A, with the following specific steps: The coding gene for wild-type tricyclic alkylene synthase NsTS (corresponding to amino acids 46-608 of SEQ ID NO.1) was synthesized in its entirety, and codon optimization was performed for the *E. coli* expression system. The optimized coding gene was cloned into the commercially available plasmid pUC57 to obtain the recombinant plasmid pUC57- nsts Using this recombinant plasmid as a template, site-directed mutagenesis PCR primers for introducing the G567A mutation were designed and synthesized.

[0061] The primer pairs used to introduce the G567A mutation are as follows: Upstream primer: 5'- gcgttcatccgttgcgcagttaacatcgctcgt -3' Downstream primer: 5'-acgagcgatgttaactgcgcaacggatgaacgc-3' Using the wild-type NsTS encoding gene as the initial template, site-directed mutagenesis PCR amplification was performed using G567A mutant primers. The PCR reaction conditions were: 98℃ pre-denaturation for 30 seconds; 98℃ denaturation for 10 seconds, 55℃ annealing for 30 seconds, 72℃ extension for 2 minutes, for a total of 30 cycles; and a final extension at 72℃ for 10 minutes. After digestion with DpnI enzyme to remove the template plasmid, the PCR product was recovered and purified to obtain the gene containing... nsts - A linear DNA fragment of the G567A gene. The purified linear DNA fragment was re-ligated using the Gibson Assembly method. The ligation product was transformed into commercially available E. coli DH5α competent cells, plated on LB agar plates containing ampicillin, and incubated overnight at 37°C.

[0062] Single colonies were picked and inoculated into LB broth containing ampicillin and cultured overnight at 37°C. Plasmids were extracted using a commercially available plasmid miniprep kit, and sequencing confirmed the presence of the recombinant plasmid pUC57- containing the G567A single-point mutation. nsts -G567A.

[0063] Using the correctly sequenced plasmid pUC57- nsts Using G567A as a template, PCR amplification was performed using primers with p3933 homologous arms to obtain the G567A variant encoding gene fragment with p3933 homologous arms at both ends. The PCR product was digested with DpnI, recovered, and purified for later use.

[0064] The plasmid p3933 was linearized using restriction endonucleases. The PCR product containing the p3933 homologous arm was then ligated to the linearized p3933 vector via homologous recombination using the Gibson Assembly method. The ligation product was transformed into commercially available *E. coli* DH5α competent cells and plated on LB agar plates containing 100 mg / L ampicillin, incubated overnight at 37°C.

[0065] Single clones were selected for colony PCR identification, and positive clones were sequenced for verification. Sequencing results confirmed that the obtained coding gene contained a mutation at position 567, where glycine was changed to alanine. This recombinant plasmid was named p3933- nsts -G567A.

[0066] Comparative Example 8: Production of Tricycloene by Fermentation Using the G567A Variant Engineered Strain This comparative example provides a method and results for the fermentation production of tricycloene using an engineered strain of the tricycloene synthase G567A variant.

[0067] The recombinant expression vector p3933- constructed in Comparative Example 7 was used. nsts G567A and plasmid pAC-6409mva containing the heterologous mevalonate pathway were co-transformed into *E. coli* BS1101 competent cells via chemical transformation. After transformation, the cells were plated on LB agar plates containing 100 mg / L ampicillin and 34 mg / L chloramphenicol and incubated overnight at 37°C. Single colonies were picked to obtain the engineered strain expressing the G567A tricyclic alkylate synthase variant.

[0068] Single clones of the engineered strain were picked from the plate and inoculated into 3 mL of LB liquid medium containing the corresponding antibiotics. The culture was incubated overnight at 37°C and 220 rpm to obtain the seed culture. The seed culture was then transferred at a 2% (v / v) inoculation rate to a 250 mL shake flask containing 20 mL of fermentation medium (containing 9.8 g / L K₂HPO₄, 5 g / L beef extract, 0.3 g / L ferric ammonium citrate, 2.1 g / L citric acid monohydrate, 61.1 mg / L MgSO₄, 10 g / L tryptone, 10 g / L glucose, 100 mg / L ampicillin, and 34 mg / L chloramphenicol). After culturing at 37°C and 220 rpm for 5 hours, IPTG was added to a final concentration of 0.5 mM to induce expression. Simultaneously, 20% (v / v) dodecane was added as an organic capping layer for in-situ extraction. Fermentation was then continued at 30°C and 220 rpm for 72 hours.

[0069] After fermentation, the upper dodecane organic phase was collected, appropriately diluted with ethyl acetate, and caryophyllene was added as an internal standard. Gas chromatography-mass spectrometry (GC-MS) was used for product detection and analysis. The chromatographic column was an HP-5MS, and the temperature program was: 50℃ for 1 min, increased at 20℃ / min to 130℃ for 2 min, then increased at 40℃ / min to 290℃. Qualitative and quantitative analysis were performed by comparing the retention time and mass spectrum with that of tricycloene standards. The results showed that the tricycloene yield of the strain expressing the G567A single-point variant was 53.63 mg / L (…). Figure 1 The percentage of the wild type was 39.67% higher than that of the wild type (Table 1).

[0070] Example 1: Construction of tricyclic ene synthase variant L178F / G427A This embodiment provides a method for constructing a tricyclic olefin synthase variant with the amino acid sequence shown in SEQ ID NO.2. The specific steps are as follows: The coding gene for wild-type tricyclic alkylene synthase NsTS (corresponding to amino acids 46-608 of SEQ ID NO.1) was synthesized in its entirety, and codon optimization was performed for the *E. coli* expression system. The optimized coding gene was cloned into the commercially available plasmid pUC57 to obtain the recombinant plasmid pUC57- nsts Using this recombinant plasmid as a template, site-directed mutagenesis PCR primers for introducing the L178F and G427A double mutations were designed and synthesized.

[0071] The primer pairs used to introduce the L178F mutation are as follows: Upstream primer: 5'-catctctcaggacatcttcaacgacttcaaagac -3' Downstream primer: 5'-gtctttgaagtcgttgaagatgtcctgagagatg-3' The primer pairs used to introduce the G427A mutation are as follows: Upstream primer: 5'-ctgcagaaatcttgggcggacctgtgcaaagct -3' Downstream primer: 5'- agctttgcacaggtccgcccaagatttctgcag -3' Using the wild-type NsTS encoding gene as the initial template, site-directed mutagenesis PCR amplification was performed using L178F mutant primers. The PCR reaction conditions were: 98℃ pre-denaturation for 30 seconds; 98℃ denaturation for 10 seconds, 55℃ annealing for 30 seconds, 72℃ extension for 2 minutes, for a total of 30 cycles; and a final extension at 72℃ for 10 minutes. After digestion with DpnI enzyme to remove the template plasmid, the PCR product was recovered and purified to obtain the gene containing... nstsThe linear DNA fragment of the -L178F gene was obtained. The purified linear DNA fragment was re-ligated using the Gibson Assembly method. The ligation product was transformed into commercially available E. coli DH5α competent cells, plated on LB agar plates containing ampicillin, and incubated overnight at 37°C.

[0072] Single colonies were picked and inoculated into LB broth containing ampicillin and cultured overnight at 37°C. Plasmids were extracted using a commercially available plasmid miniprep kit, and sequencing confirmed the presence of the recombinant plasmid pUC57- containing the L178F single-point mutation. nsts -L178F.

[0073] Using the above plasmid pUC57- nsts Using L178F as a template, a second round of site-directed mutagenesis PCR was performed using G427A mutant primers. The PCR product was digested and purified with DpnI, then ligated into the linearized pUC57 vector using the Gibson Assembly method and transformed into *E. coli* DH5α competent cells. Single colonies were picked, cultured, and plasmids were extracted. Sequencing confirmed the presence of the recombinant plasmid pUC57- containing the L178F / G427A double mutation. nsts -L178F / G427A.

[0074] Using the correctly sequenced plasmid pUC57- nsts Using L178F / G427A as a template, PCR amplification was performed using primers with p3933 homologous arms to obtain the L178F / G427A variant encoding gene fragment with p3933 homologous arms at both ends. The PCR product was digested with DpnI, recovered, and purified for later use.

[0075] The plasmid p3933 was linearized using restriction endonucleases. The PCR product containing the p3933 homologous arm was then ligated to the linearized p3933 vector via homologous recombination using the Gibson Assembly method. The ligation product was transformed into commercially available *E. coli* DH5α competent cells and plated on LB agar plates containing 100 mg / L ampicillin, incubated overnight at 37°C.

[0076] Single clones were selected for colony PCR identification, and positive clones were sequenced for verification. Sequencing results confirmed that the obtained coding gene contained a double mutation: leucine at position 178 was changed to phenylalanine, and glycine at position 427 was changed to alanine. The encoded amino acid sequence was completely identical to SEQ ID NO.2. This recombinant plasmid was named p3933- nsts -L178F / G427A.

[0077] Example 2: Production of tricycloene by fermentation using L178F / G427A mutant engineered strain This embodiment provides a method and results for the fermentation production of tricycloene using an engineered strain expressing the tricycloene synthase variant shown in SEQ ID NO.2.

[0078] The recombinant expression vector p3933- constructed in Example 1 was used. nsts L178F / G427A and plasmid pAC-6409mva containing the heterologous mevalonate pathway were co-transformed into *E. coli* BS1101 competent cells via chemical transformation. After transformation, the cells were plated on LB agar plates containing 100 mg / L ampicillin and 34 mg / L chloramphenicol and incubated overnight at 37°C. Single colonies were picked to obtain the engineered strain expressing the L178F / G427A tricyclic alkyl synthase variant.

[0079] Single clones of the engineered strain were picked from the plate and inoculated into 3 mL of LB liquid medium containing the corresponding antibiotics. The culture was incubated overnight at 37°C and 220 rpm to obtain the seed culture. The seed culture was then transferred at a 2% (v / v) inoculation rate to a 250 mL shake flask containing 20 mL of fermentation medium (containing 9.8 g / L K₂HPO₄, 5 g / L beef extract, 0.3 g / L ferric ammonium citrate, 2.1 g / L citric acid monohydrate, 61.1 mg / L MgSO₄, 10 g / L tryptone, 10 g / L glucose, 100 mg / L ampicillin, and 34 mg / L chloramphenicol). After culturing at 37°C and 220 rpm for 5 hours, IPTG was added to a final concentration of 0.5 mM to induce expression. Simultaneously, 20% (v / v) dodecane was added as an organic capping layer for in-situ extraction. Fermentation was then continued at 30°C and 220 rpm for 72 hours.

[0080] After fermentation, the upper dodecane organic phase was collected, appropriately diluted with ethyl acetate, and caryophyllene was added as an internal standard. Gas chromatography-mass spectrometry (GC-MS) was used for product detection and analysis. An HP-5MS column was used, and the temperature program was: 50℃ for 1 min, increased at 20℃ / min to 130℃ for 2 min, then increased at 40℃ / min to 290℃. Qualitative and quantitative analysis were performed by comparing the retention times and mass spectra with those of tricycloene standards.

[0081] The test results showed that the engineered strain expressing the tricycloene synthase variant L178F / G427A shown in SEQ ID NO.2 produced 103.09 mg / L of tricycloene. Figure 1Compared to the control strain expressing wild-type tricyclic olefin synthase (yield 38.40 mg / L), the yield was increased by 168.50% (Table 1). Compared to the wild type, the tricyclic olefin yields of the L178F single-site variant and the G427A single-site variant were increased by 36.61% and 40.81%, respectively (see Comparative Examples 4 and 6), with the sum of their individual increases being approximately 77.42%. The increase of the L178F / G427A dual variant described in this invention (168.50%) far exceeded the sum of the two. This result indicates that the simultaneous mutations at leucine position 178 and glycine position 427 are not simply additive, but rather produce a significant synergistic effect, which can greatly improve the catalytic performance of tricyclic olefin synthase.

[0082] Example 3: Construction of tricyclic ene synthase variants G427A / G567A This embodiment provides a method for constructing a tricyclic olefin synthase variant with the amino acid sequence shown in SEQ ID NO.3. The specific steps are as follows: The coding gene for wild-type tricyclic alkylene synthase NsTS (corresponding to amino acids 46-608 of SEQ ID NO.1) was synthesized in its entirety, and codon optimization was performed for the *E. coli* expression system. The optimized coding gene was cloned into the commercially available plasmid pUC57 to obtain the recombinant plasmid pUC57- nsts Using this recombinant plasmid as a template, site-directed mutagenesis PCR primers for introducing the G427A and G567A double mutations were designed and synthesized.

[0083] The primer pairs used to introduce the G427A mutation are as follows: Upstream primer: 5'-ctgcagaaatcttgggcggacctgtgcaaagct -3' Downstream primer: 5'- agctttgcacaggtccgcccaagatttctgcag -3' The primer pairs used to introduce the G567A mutation are as follows: Upstream primer: 5'- gcgttcatccgttgcgcagttaacatcgctcgt -3' Downstream primer: 5'-acgagcgatgttaactgcgcaacggatgaacgc-3' Using the wild-type NsTS encoding gene as the initial template, site-directed mutagenesis PCR amplification was performed using G427A mutant primers. The PCR reaction conditions were: 98℃ pre-denaturation for 30 seconds; 98℃ denaturation for 10 seconds, 55℃ annealing for 30 seconds, 72℃ extension for 2 minutes, for a total of 30 cycles; and a final extension at 72℃ for 10 minutes. After digestion with DpnI enzyme to remove the template plasmid, the PCR product was recovered and purified to obtain the gene containing...nsts - A linear DNA fragment of the G427A gene. The purified linear DNA fragment was re-ligated using the Gibson Assembly method. The ligation product was transformed into commercially available E. coli DH5α competent cells, plated on LB agar plates containing ampicillin, and incubated overnight at 37°C.

[0084] Single colonies were picked and inoculated into LB broth containing ampicillin and cultured overnight at 37°C. Plasmids were extracted using a commercially available plasmid miniprep kit, and sequencing confirmed the presence of the recombinant plasmid pUC57- containing the G427A single-point mutation. nsts -G427A.

[0085] Using the above plasmid pUC57- nsts Using G427A as a template, a second round of site-directed mutagenesis PCR was performed using G567A mutant primers. The PCR product was digested and purified with DpnI, then ligated into a linearized pUC57 vector using the Gibson Assembly method and transformed into *E. coli* DH5α competent cells. Single colonies were picked, cultured, and plasmids were extracted. Sequencing confirmed the presence of the recombinant plasmid pUC57- containing the G427A / G567A double mutation. nsts -G427A / G567A.

[0086] Using the correctly sequenced plasmid pUC57- nsts Using G427A / G567A as a template, PCR amplification was performed using primers with p3933 homologous arms to obtain the G427A / G567A variant encoding gene fragment with p3933 homologous arms at both ends. The PCR product was digested with DpnI, recovered, and purified for later use.

[0087] The plasmid p3933 was linearized using restriction endonucleases. The PCR product containing the p3933 homologous arm was then ligated to the linearized p3933 vector via homologous recombination using the Gibson Assembly method. The ligation product was transformed into commercially available *E. coli* DH5α competent cells and plated on LB agar plates containing 100 mg / L ampicillin, incubated overnight at 37°C.

[0088] Single clones were selected for colony PCR identification, and positive clones were sequenced for verification. Sequencing results confirmed that the obtained coding gene contained a double mutation at positions 427 (glycine to alanine) and 567 (glycine to alanine), and the encoded amino acid sequence was completely identical to SEQ ID NO.3. This recombinant plasmid was named p3933- nsts -G427A / G567A.

[0089] Example 4: Production of tricycloene by fermentation using G427A / G567A mutant engineered strains This embodiment provides a method and results for the fermentation production of tricycloene using an engineered strain expressing the tricycloene synthase variant shown in SEQ ID NO.3.

[0090] The recombinant expression vector p3933- constructed in Example 3 was used. nsts -G427A / G567A and plasmid pAC-6409mva containing the heterologous mevalonate pathway were co-transformed into *E. coli* BS1101 competent cells via chemical transformation. After transformation, the cells were plated on LB agar plates containing 100 mg / L ampicillin and 34 mg / L chloramphenicol and incubated overnight at 37°C. Single colonies were picked to obtain the engineered strain expressing the G427A / G567A tricyclic alkyl ester synthase variant.

[0091] Single clones of the engineered strain were picked from the plate and inoculated into 3 mL of LB liquid medium containing the corresponding antibiotics. The culture was incubated overnight at 37°C and 220 rpm to obtain the seed culture. The seed culture was then transferred at a 2% (v / v) inoculation rate to a 250 mL shake flask containing 20 mL of fermentation medium (containing 9.8 g / L K₂HPO₄, 5 g / L beef extract, 0.3 g / L ferric ammonium citrate, 2.1 g / L citric acid monohydrate, 61.1 mg / L MgSO₄, 10 g / L tryptone, 10 g / L glucose, 100 mg / L ampicillin, and 34 mg / L chloramphenicol). After culturing at 37°C and 220 rpm for 5 hours, IPTG was added to a final concentration of 0.5 mM to induce expression. Simultaneously, 20% (v / v) dodecane was added as an organic capping layer for in-situ extraction. Fermentation was then continued at 30°C and 220 rpm for 72 hours.

[0092] After fermentation, the upper dodecane organic phase was collected, appropriately diluted with ethyl acetate, and caryophyllene was added as an internal standard. Gas chromatography-mass spectrometry (GC-MS) was used for product detection and analysis. An HP-5MS column was used, and the temperature program was: 50℃ for 1 min, increased at 20℃ / min to 130℃ for 2 min, then increased at 40℃ / min to 290℃. Qualitative and quantitative analysis were performed by comparing the retention times and mass spectra with those of tricycloene standards.

[0093] The test results showed that the engineered strain expressing the tricycloene synthase variant G427A / G567A shown in SEQ ID NO.3 produced 86.87 mg / L of tricycloene. Figure 1Compared to the control strain expressing wild-type tricyclic olefin synthase (yield 38.40 mg / L), the yield was increased by 126.26% (Table 1). Compared to the wild type, the tricyclic olefin yields of the G427A single-site variant and the G567A single-site variant were increased by 40.81% and 39.67%, respectively (see Comparative Examples 6 and 8), with the sum of their individual increases being approximately 80.48%. The increase of the G427A / G567A dual variant described in this invention (126.26%) far exceeded the sum of the two. This result indicates that the simultaneous mutations of glycine at positions 427 and 567 are not simply additive, but rather produce a significant synergistic effect, greatly enhancing the catalytic performance of tricyclic olefin synthase.

[0094] Example 5: Construction of tricyclic ene synthase variant L178F / G567A This embodiment provides a method for constructing a tricyclic olefin synthase variant with the amino acid sequence shown in SEQ ID NO.4. The specific steps are as follows: The coding gene for wild-type tricyclic alkylene synthase NsTS (corresponding to amino acids 46-608 of SEQ ID NO.1) was synthesized in its entirety, and codon optimization was performed for the *E. coli* expression system. The optimized coding gene was cloned into the commercially available plasmid pUC57 to obtain the recombinant plasmid pUC57- nsts Using this recombinant plasmid as a template, site-directed mutagenesis PCR primers for introducing the L178F and G567A double mutations were designed and synthesized.

[0095] The primer pairs used to introduce the L178F mutation are as follows: Upstream primer: 5'-catctctcaggacatcttcaacgacttcaaagac -3' Downstream primer: 5'-gtctttgaagtcgttgaagatgtcctgagagatg-3' The primer pairs used to introduce the G567A mutation are as follows: Upstream primer: 5'- gcgttcatccgttgcgcagttaacatcgctcgt -3' Downstream primer: 5'-acgagcgatgttaactgcgcaacggatgaacgc-3' Using the wild-type NsTS encoding gene as the initial template, site-directed mutagenesis PCR amplification was performed using L178F mutant primers. The PCR reaction conditions were: 98℃ pre-denaturation for 30 seconds; 98℃ denaturation for 10 seconds, 55℃ annealing for 30 seconds, 72℃ extension for 2 minutes, for a total of 30 cycles; and a final extension at 72℃ for 10 minutes. After digestion with DpnI enzyme to remove the template plasmid, the PCR product was recovered and purified to obtain the gene containing...nsts The linear DNA fragment of the -L178F gene was obtained. The purified linear DNA fragment was re-ligated using the Gibson Assembly method. The ligation product was transformed into commercially available E. coli DH5α competent cells, plated on LB agar plates containing ampicillin, and incubated overnight at 37°C.

[0096] Single colonies were picked and inoculated into LB broth containing ampicillin and cultured overnight at 37°C. Plasmids were extracted using a commercially available plasmid miniprep kit, and sequencing confirmed the presence of the recombinant plasmid pUC57- containing the L178F single-point mutation. nsts -L178F.

[0097] Using the above plasmid pUC57- nsts Using L178F as a template, a second round of site-directed mutagenesis PCR was performed using G567A mutant primers. The PCR product was digested and purified with DpnI, then ligated into the linearized pUC57 vector using the Gibson Assembly method and transformed into *E. coli* DH5α competent cells. Single colonies were picked, cultured, and plasmids were extracted. Sequencing confirmed the presence of the recombinant plasmid pUC57- containing the L178F / G567A double mutation. nsts -L178F / G567A.

[0098] Using the correctly sequenced plasmid pUC57- nsts Using L178F / G567A as a template, PCR amplification was performed using primers with p3933 homologous arms to obtain the L178F / G567A variant encoding gene fragment with p3933 homologous arms at both ends. The PCR product was digested with DpnI, recovered, and purified for later use.

[0099] The plasmid p3933 was linearized using restriction endonucleases. The PCR product containing the p3933 homologous arm was then ligated to the linearized p3933 vector via homologous recombination using the Gibson Assembly method. The ligation product was transformed into commercially available *E. coli* DH5α competent cells and plated on LB agar plates containing 100 mg / L ampicillin, incubated overnight at 37°C.

[0100] Single clones were selected for colony PCR identification, and positive clones were sequenced for verification. Sequencing results confirmed that the obtained coding gene contained a double mutation: leucine at position 178 was changed to phenylalanine, and glycine at position 567 was changed to alanine. The encoded amino acid sequence was completely identical to SEQ ID NO.4. This recombinant plasmid was named p3933- nsts -L178F / G567A.

[0101] Example 6: Production of tricycloene by fermentation using L178F / G567A mutant engineered strain This embodiment provides a method and results for the fermentation production of tricycloene using an engineered strain expressing the tricycloene synthase variant shown in SEQ ID NO.4.

[0102] The recombinant expression vector p3933- constructed in Example 5 was used. nsts L178F / G567A and plasmid pAC-6409mva containing the heterologous mevalonate pathway were co-transformed into *E. coli* BS1101 competent cells via chemical transformation. After transformation, the cells were plated on LB agar plates containing 100 mg / L ampicillin and 34 mg / L chloramphenicol and incubated overnight at 37°C. Single colonies were picked to obtain the engineered strain expressing the L178F / G567A tricyclic alkyl synthase variant.

[0103] Single clones of the engineered strain were picked from the plate and inoculated into 3 mL of LB liquid medium containing the corresponding antibiotics. The culture was incubated overnight at 37°C and 220 rpm to obtain the seed culture. The seed culture was then transferred at a 2% (v / v) inoculation rate to a 250 mL shake flask containing 20 mL of fermentation medium (containing 9.8 g / L K₂HPO₄, 5 g / L beef extract, 0.3 g / L ferric ammonium citrate, 2.1 g / L citric acid monohydrate, 61.1 mg / L MgSO₄, 10 g / L tryptone, 10 g / L glucose, 100 mg / L ampicillin, and 34 mg / L chloramphenicol). After culturing at 37°C and 220 rpm for 5 hours, IPTG was added to a final concentration of 0.5 mM to induce expression. Simultaneously, 20% (v / v) dodecane was added as an organic capping layer for in-situ extraction. Fermentation was then continued at 30°C and 220 rpm for 72 hours.

[0104] After fermentation, the upper dodecane organic phase was collected, appropriately diluted with ethyl acetate, and caryophyllene was added as an internal standard. Gas chromatography-mass spectrometry (GC-MS) was used for product detection and analysis. An HP-5MS column was used, and the temperature program was: 50℃ for 1 min, increased at 20℃ / min to 130℃ for 2 min, then increased at 40℃ / min to 290℃. Qualitative and quantitative analysis were performed by comparing the retention times and mass spectra with those of tricycloene standards.

[0105] The test results showed that the engineered strain expressing the tricycloene synthase variant L178F / G567A shown in SEQ ID NO.4 produced 89.84 mg / L of tricycloene. Figure 1Compared to the control strain expressing wild-type tricyclic olefin synthase (yield 38.40 mg / L), the yield was increased by 133.98% (Table 1). Compared to the wild type, the tricyclic olefin yields of the L178F single-site variant and the G567A single-site variant were increased by 36.61% and 39.67%, respectively (see Comparative Examples 4 and 8), with the sum of their individual increases being approximately 76.28%. The increase of the L178F / G567A variant described in this invention (133.98%) far exceeds the sum of the two. This result indicates that the simultaneous mutations at leucine position 178 and glycine position 567 are not simply additive, but rather produce a significant synergistic effect, greatly improving the catalytic performance of tricyclic olefin synthase.

[0106] Example 7: Construction of tricyclic olefin synthase variants L178F / G427A / G567A This embodiment provides a method for constructing a tricyclic olefin synthase variant with the amino acid sequence shown in SEQ ID NO.5. The specific steps are as follows: The coding gene for wild-type tricyclic alkylene synthase NsTS (corresponding to amino acids 46-608 of SEQ ID NO.1) was synthesized in its entirety, and codon optimization was performed for the *E. coli* expression system. The optimized coding gene was cloned into the commercially available plasmid pUC57 to obtain the recombinant plasmid pUC57- nsts Using this recombinant plasmid as a template, site-directed mutagenesis PCR primers for introducing double mutations of L178F, G427A, and G567A were designed and synthesized.

[0107] The primer pairs used to introduce the L178F mutation are as follows: Upstream primer: 5'-catctctcaggacatcttcaacgacttcaaagac -3' Downstream primer: 5'-gtctttgaagtcgttgaagatgtcctgagagatg-3' The primer pairs used to introduce the G427A mutation are as follows: Upstream primer: 5'-ctgcagaaatcttgggcggacctgtgcaaagct -3' Downstream primer: 5'- agctttgcacaggtccgcccaagatttctgcag -3' The primer pairs used to introduce the G567A mutation are as follows: Upstream primer: 5'- gcgttcatccgttgcgcagttaacatcgctcgt -3' Downstream primer: 5'-acgagcgatgttaactgcgcaacggatgaacgc-3' Using the wild-type NsTS encoding gene as the initial template, site-directed mutagenesis PCR amplification was performed using L178F mutant primers. The PCR reaction conditions were: 98℃ pre-denaturation for 30 seconds; 98℃ denaturation for 10 seconds, 55℃ annealing for 30 seconds, 72℃ extension for 2 minutes, for a total of 30 cycles; and a final extension at 72℃ for 10 minutes. After digestion with DpnI enzyme to remove the template plasmid, the PCR product was recovered and purified to obtain the gene containing... nsts The linear DNA fragment of the -L178F gene was obtained. The purified linear DNA fragment was re-ligated using the Gibson Assembly method. The ligation product was transformed into commercially available E. coli DH5α competent cells, plated on LB agar plates containing ampicillin, and incubated overnight at 37°C.

[0108] Single colonies were picked and inoculated into LB broth containing ampicillin and cultured overnight at 37°C. Plasmids were extracted using a commercially available plasmid miniprep kit, and sequencing confirmed the presence of the recombinant plasmid pUC57- containing the L178F single-point mutation. nsts -L178F.

[0109] Using the above plasmid pUC57- nsts Using L178F as a template, a second round of site-directed mutagenesis PCR was performed using G427A mutant primers. The PCR product was digested and purified with DpnI, then ligated into the linearized pUC57 vector using the Gibson Assembly method and transformed into *E. coli* DH5α competent cells. Single colonies were picked, cultured, and plasmids were extracted. Sequencing confirmed the presence of the recombinant plasmid pUC57- containing the L178F / G427A double mutation. nsts -L178F / G427A.

[0110] Using the above plasmid pUC57- nsts Using L178F / G427A as a template, a third round of site-directed mutagenesis PCR was performed using G567A mutant primers. The PCR product was digested and purified with DpnI, then ligated into a linearized pUC57 vector using the Gibson Assembly method and transformed into *E. coli* DH5α competent cells. Single colonies were picked, cultured, and plasmids were extracted. Sequencing confirmed the presence of the recombinant plasmid pUC57- containing the L178F / G427A / G567A triple mutation. nsts -L178F / G427A / G567A.

[0111] Using the correctly sequenced plasmid pUC57- nstsUsing L178F / G427A / G567A as a template, PCR amplification was performed using primers with p3933 homologous arms to obtain the L178F / G427A / G567A variant encoding gene fragments with p3933 homologous arms at both ends. The PCR product was digested with DpnI, recovered, and purified for later use.

[0112] The plasmid p3933 was linearized using restriction endonucleases. The PCR product containing the p3933 homologous arm was then ligated to the linearized p3933 vector via homologous recombination using the Gibson Assembly method. The ligation product was transformed into commercially available *E. coli* DH5α competent cells and plated on LB agar plates containing 100 mg / L ampicillin, incubated overnight at 37°C.

[0113] Single clones were selected for colony PCR identification, and positive clones were sequenced for verification. Sequencing results confirmed that the obtained coding gene contained a triple mutation: leucine at position 178 was changed to phenylalanine, glycine at position 427 was changed to alanine, and glycine at position 567 was changed to alanine. The encoded amino acid sequence was completely identical to SEQ ID NO. 5. This recombinant plasmid was named p3933- nsts -L178F / G427A / G567A.

[0114] Example 8: Production of tricycloene by fermentation using L178F / G427A / G567A mutant engineered strain This embodiment provides a method and results for the fermentation production of tricycloene using an engineered strain expressing the tricycloene synthase variant shown in SEQ ID NO.5.

[0115] The recombinant expression vector p3933- constructed in Example 7 was used. nsts The L178F / G427A / G567A plasmid and the pAC-6409mva plasmid containing the heterologous mevalonate pathway were co-transformed into *E. coli* BS1101 competent cells via chemical transformation. After transformation, the cells were plated on LB agar plates containing 100 mg / L ampicillin and 34 mg / L chloramphenicol and incubated overnight at 37°C. Single colonies were picked to obtain the engineered strain expressing the L178F / G427A / G567A tricyclic alkyl ester synthase variant.

[0116] Single clones of the engineered strain were picked from the plate and inoculated into 3 mL of LB liquid medium containing the corresponding antibiotics. The culture was incubated overnight at 37°C and 220 rpm to obtain the seed culture. The seed culture was then transferred at a 2% (v / v) inoculation rate to a 250 mL shake flask containing 20 mL of fermentation medium (containing 9.8 g / L K₂HPO₄, 5 g / L beef extract, 0.3 g / L ferric ammonium citrate, 2.1 g / L citric acid monohydrate, 61.1 mg / L MgSO₄, 10 g / L tryptone, 10 g / L glucose, 100 mg / L ampicillin, and 34 mg / L chloramphenicol). After culturing at 37°C and 220 rpm for 5 hours, IPTG was added to a final concentration of 0.5 mM to induce expression. Simultaneously, 20% (v / v) dodecane was added as an organic capping layer for in-situ extraction. Fermentation was then continued at 30°C and 220 rpm for 72 hours.

[0117] After fermentation, the upper dodecane organic phase was collected, appropriately diluted with ethyl acetate, and caryophyllene was added as an internal standard. Gas chromatography-mass spectrometry (GC-MS) was used for product detection and analysis. An HP-5MS column was used, and the temperature program was: 50℃ for 1 min, increased at 20℃ / min to 130℃ for 2 min, then increased at 40℃ / min to 290℃. Qualitative and quantitative analysis were performed by comparing the retention times and mass spectra with those of tricycloene standards.

[0118] The test results showed that the engineered strain expressing the tricycloene synthase variant L178F / G427A / G567A shown in SEQ ID NO.5 produced 117.41 mg / L of tricycloene. Figure 1 Compared to the control strain expressing wild-type tricyclic olefin synthase (yield 38.40 mg / L), the yield was increased by 205.79% (Table 1). Compared to the wild type, the tricyclic olefin yields of the single-site variants L178F, G427A, and G567A were increased by 36.61%, 40.81%, and 39.67%, respectively (see Comparative Examples 4, 6, and 8). The sum of the individual increases for each variant was approximately 117.09%, while the increase from the L178F / G427A / G567A variant described in this invention (205.79%) far exceeded the sum of the three. This result indicates that the simultaneous mutations at leucine position 178, glycine position 427, and glycine position 567 are not simply additive, but rather produce a significant synergistic effect, which can greatly improve the catalytic performance of tricyclic olefin synthase.

[0119] Table 1 Yields of tricyclic alkylene synthase and its variants Wild type 0 L178F 36.61 G427A 40.81 G567A 39.67 L178F / G427A 168.50 G427A / G567A 126.26 L178F / G567A 133.98 L178F / G427A / G567A 205.79 Example 9: Construction of the tricyclic ene synthase variant Y433F This comparative example provides a method for constructing the tricyclic olefin synthase variant Y433F with the amino acid sequence shown in SEQ ID NO.6, and the specific steps are as follows: The coding gene for wild-type tricyclic alkylene synthase NsTS (corresponding to amino acids 46-608 of SEQ ID NO.1) was synthesized in its entirety, and codon optimization was performed for the *E. coli* expression system. The optimized coding gene was cloned into the commercially available plasmid pUC57 to obtain the recombinant plasmid pUC57- nsts Using this recombinant plasmid as a template, site-directed mutagenesis PCR primers for introducing the Y433F mutation were designed and synthesized.

[0120] The primer pair used to introduce the Y433F mutation is as follows: Upstream primer: 5'- gacctgtgcaaagctttcctgcaggaagctcgt -3' Downstream primer: 5'-acgagcttcctgcaggaaagctttgcacaggtc-3' Using the wild-type NsTS encoding gene as the initial template, site-directed mutagenesis PCR amplification was performed using Y433F mutant primers. The PCR reaction conditions were: 98℃ pre-denaturation for 30 seconds; 98℃ denaturation for 10 seconds, 55℃ annealing for 30 seconds, 72℃ extension for 2 minutes, for a total of 30 cycles; and a final extension at 72℃ for 10 minutes. After digestion with DpnI enzyme to remove the template plasmid, the PCR product was recovered and purified to obtain the gene containing... nsts The linear DNA fragment of the Y433F gene was obtained. The purified linear DNA fragment was re-ligated using the Gibson Assembly method. The ligation product was transformed into commercially available E. coli DH5α competent cells, plated on LB agar plates containing ampicillin, and incubated overnight at 37°C.

[0121] Single colonies were picked and inoculated into LB broth containing ampicillin and cultured overnight at 37°C. Plasmids were extracted using a commercially available plasmid miniprep kit, and sequencing confirmed the presence of the recombinant plasmid pUC57- containing the Y433F single-point mutation. nsts -Y433F.

[0122] Using the correctly sequenced plasmid pUC57- nsts Using Y433F as a template, PCR amplification was performed using primers with p3933 homologous arms to obtain the Y433F variant encoding gene fragment with p3933 homologous arms at both ends. The PCR product was digested with DpnI, recovered, and purified for later use.

[0123] The plasmid p3933 was linearized using restriction endonucleases. The PCR product containing the p3933 homologous arm was then ligated to the linearized p3933 vector via homologous recombination using the Gibson Assembly method. The ligation product was transformed into commercially available *E. coli* DH5α competent cells and plated on LB agar plates containing 100 mg / L ampicillin, incubated overnight at 37°C.

[0124] Single clones were selected for colony PCR identification, and positive clones were sequenced for verification. Sequencing results confirmed that the obtained coding gene contained a single-point mutation at position 433, where tyrosine was changed to phenylalanine, and the encoded amino acid sequence was completely identical to SEQ ID NO. 6. This recombinant plasmid was named p3933- nsts -Y433F.

[0125] Example 10: Production of tricycloene by fermentation using Y433F mutant engineered strain This embodiment provides a method and results for the fermentation production of tricycloene using an engineered strain expressing the tricycloene synthase variant shown in SEQ ID NO.6.

[0126] The recombinant expression vector p3933- constructed in Example 9 was used. nsts Y433F and plasmid pAC-6409mva containing the heterologous mevalonate pathway were co-transformed into *E. coli* BS1101 competent cells via chemical transformation. After transformation, the cells were plated on LB agar plates containing 100 mg / L ampicillin and 34 mg / L chloramphenicol and incubated overnight at 37°C. Single colonies were picked to obtain the engineered strain expressing the Y433F tricyclic alkylate synthase variant.

[0127] Single clones of the engineered strain were picked from the plate and inoculated into 3 mL of LB liquid medium containing the corresponding antibiotics. The culture was incubated overnight at 37°C and 220 rpm to obtain the seed culture. The seed culture was then transferred at a 2% (v / v) inoculation rate to a 250 mL shake flask containing 20 mL of fermentation medium (containing 9.8 g / L K₂HPO₄, 5 g / L beef extract, 0.3 g / L ferric ammonium citrate, 2.1 g / L citric acid monohydrate, 61.1 mg / L MgSO₄, 10 g / L tryptone, 10 g / L glucose, 100 mg / L ampicillin, and 34 mg / L chloramphenicol). After culturing at 37°C and 220 rpm for 5 hours, IPTG was added to a final concentration of 0.5 mM to induce expression. Simultaneously, 20% (v / v) dodecane was added as an organic capping layer for in-situ extraction. Fermentation was then continued at 30°C and 220 rpm for 72 hours.

[0128] After fermentation, the upper dodecane organic phase was collected, appropriately diluted with ethyl acetate, and caryophyllene was added as an internal standard. The product was analyzed using gas chromatography-mass spectrometry (GC-MS). An HP-5MS column was used, and the temperature program was: 50℃ for 1 min, increased to 130℃ at 20℃ / min and held for 2 min, then increased to 290℃ at 40℃ / min. Qualitative and quantitative analysis were performed by comparing the retention times and mass spectra with those of tricycloene standards.

[0129] The test results showed that the engineered strain expressing the tricycloene synthase variant Y433F shown in SEQ ID NO.6 changed the main product from tricycloene to limonene. Figure 2 Unlike wild-type tricyclic olefin synthase, which primarily catalyzes the formation of tricyclic olefins, the Y433F variant significantly altered the product profile, exhibiting a targeted product switching capability. This result indicates that the mutation of tyrosine at position 433 to phenylalanine can change the product specificity of tricyclic olefin synthase, shifting its catalytic pathway from tricyclic olefins to limonene. This site, acting as a product-specific regulatory switch, provides a precise target for the rational design of monoterpene synthase product profiles.

[0130] Example 11: Construction of tricyclic ene synthase variant Y433L This comparative example provides a method for constructing the tricyclic olefin synthase variant Y433L with the amino acid sequence shown in SEQ ID NO.7, and the specific steps are as follows: The coding gene for wild-type tricyclic alkylene synthase NsTS (corresponding to amino acids 46-608 of SEQ ID NO.1) was synthesized in its entirety, and codon optimization was performed for the *E. coli* expression system. The optimized coding gene was cloned into the commercially available plasmid pUC57 to obtain the recombinant plasmid pUC57- nsts Using this recombinant plasmid as a template, site-directed mutagenesis PCR primers for introducing the Y433L mutation were designed and synthesized.

[0131] The primer pair used to introduce the Y433L mutation is as follows: Upstream primer: 5'- gacctgtgcaaagctctgctgcaggaagctcgt -3' Downstream primer: 5'-acgagcttcctgcagcagagctttgcacaggtc-3' Using the wild-type NsTS encoding gene as the initial template, site-directed mutagenesis PCR amplification was performed using Y433L mutant primers. The PCR reaction conditions were: 98℃ pre-denaturation for 30 seconds; 98℃ denaturation for 10 seconds, 55℃ annealing for 30 seconds, 72℃ extension for 2 minutes, for a total of 30 cycles; and a final extension at 72℃ for 10 minutes. After digestion with DpnI enzyme to remove the template plasmid, the PCR product was recovered and purified to obtain the gene containing... nstsThe linear DNA fragment of the Y433L gene was obtained. The purified linear DNA fragment was re-ligated using the Gibson Assembly method. The ligation product was transformed into commercially available E. coli DH5α competent cells, plated on LB agar plates containing ampicillin, and incubated overnight at 37°C.

[0132] Single colonies were picked and inoculated into LB broth containing ampicillin and cultured overnight at 37°C. Plasmids were extracted using a commercially available plasmid miniprep kit, and sequencing confirmed the presence of the recombinant plasmid pUC57- containing the Y433L single-point mutation. nsts -Y433L.

[0133] Using the correctly sequenced plasmid pUC57- nsts Using Y433L as a template, PCR amplification was performed using primers with p3933 homologous arms to obtain the Y433L variant encoding gene fragment with p3933 homologous arms at both ends. The PCR product was digested with DpnI, recovered, and purified for later use.

[0134] The plasmid p3933 was linearized using restriction endonucleases. The PCR product containing the p3933 homologous arm was then ligated to the linearized p3933 vector via homologous recombination using the Gibson Assembly method. The ligation product was transformed into commercially available *E. coli* DH5α competent cells and plated on LB agar plates containing 100 mg / L ampicillin, incubated overnight at 37°C.

[0135] Single clones were selected for colony PCR identification, and positive clones were sequenced for verification. Sequencing results confirmed that the obtained coding gene contained a single-point mutation at position 433, where tyrosine was changed to leucine, and the encoded amino acid sequence was completely identical to SEQ ID NO. 7. This recombinant plasmid was named p3933- nsts -Y433L.

[0136] Example 12: Production of tricycloene by fermentation using Y433L mutant engineered strain This embodiment provides a method and results for the fermentation production of tricycloene using an engineered strain expressing the tricycloene synthase variant shown in SEQ ID NO.7.

[0137] The recombinant expression vector p3933- constructed in Example 11 was used. nsts Y433L and plasmid pAC-6409mva containing the heterologous mevalonate pathway were co-transformed into *E. coli* BS1101 competent cells via chemical transformation. After transformation, the cells were plated on LB agar plates containing 100 mg / L ampicillin and 34 mg / L chloramphenicol and incubated overnight at 37°C. Single colonies were picked to obtain the engineered strain expressing the Y433L tricyclic alkylate synthase variant.

[0138] Single clones of the engineered strain were picked from the plate and inoculated into 3 mL of LB liquid medium containing the corresponding antibiotics. The culture was incubated overnight at 37°C and 220 rpm to obtain the seed culture. The seed culture was then transferred at a 2% (v / v) inoculation rate to a 250 mL shake flask containing 20 mL of fermentation medium (containing 9.8 g / L K₂HPO₄, 5 g / L beef extract, 0.3 g / L ferric ammonium citrate, 2.1 g / L citric acid monohydrate, 61.1 mg / L MgSO₄, 10 g / L tryptone, 10 g / L glucose, 100 mg / L ampicillin, and 34 mg / L chloramphenicol). After culturing at 37°C and 220 rpm for 5 hours, IPTG was added to a final concentration of 0.5 mM to induce expression. Simultaneously, 20% (v / v) dodecane was added as an organic capping layer for in-situ extraction. Fermentation was then continued at 30°C and 220 rpm for 72 hours.

[0139] After fermentation, the upper dodecane organic phase was collected, appropriately diluted with ethyl acetate, and caryophyllene was added as an internal standard. The product was analyzed using gas chromatography-mass spectrometry (GC-MS). An HP-5MS column was used, and the temperature program was: 50℃ for 1 min, increased to 130℃ at 20℃ / min and held for 2 min, then increased to 290℃ at 40℃ / min. Qualitative and quantitative analysis were performed by comparing the retention times and mass spectra with those of tricycloene standards.

[0140] The test results showed that the engineered strain expressing the tricyclic olefin synthase variant Y433L shown in SEQ ID NO.7 changed the main product from tricyclic olefin to α-pinene ( Figure 2 Unlike wild-type tricyclic olefin synthase, which primarily catalyzes the formation of tricyclic olefins, the Y433L variant significantly alters the product profile, exhibiting a targeted product switching capability. This result indicates that the mutation of tyrosine at position 433 to leucine can change the product specificity of tricyclic olefin synthase, shifting its catalytic pathway from tricyclic olefins to α-pinene. This site, acting as a product-specific regulatory switch, provides a precise target for the rational design of monoterpene synthase product profiles.

[0141] Example 13: Construction of the tricyclic ene synthase variant Y433W This comparative example provides a method for constructing the tricyclic olefin synthase variant Y433W with the amino acid sequence shown in SEQ ID NO.8, and the specific steps are as follows: The coding gene for wild-type tricyclic alkylene synthase NsTS (corresponding to amino acids 46-608 of SEQ ID NO.1) was synthesized in its entirety, and codon optimization was performed for the *E. coli* expression system. The optimized coding gene was cloned into the commercially available plasmid pUC57 to obtain the recombinant plasmid pUC57- nstsUsing this recombinant plasmid as a template, site-directed mutagenesis PCR primers for introducing the Y433W mutation were designed and synthesized.

[0142] The primer pair used to introduce the Y433W mutation is as follows: Upstream primer: 5'- gacctgtgcaaagcttggctgcaggaagctcgt -3' Downstream primer: 5'-acgagcttcctgcagccaagctttgcacaggtc-3' Using the wild-type NsTS encoding gene as the initial template, site-directed mutagenesis PCR amplification was performed using Y433L mutant primers. The PCR reaction conditions were: 98℃ pre-denaturation for 30 seconds; 98℃ denaturation for 10 seconds, 55℃ annealing for 30 seconds, 72℃ extension for 2 minutes, for a total of 30 cycles; and a final extension at 72℃ for 10 minutes. After digestion with DpnI enzyme to remove the template plasmid, the PCR product was recovered and purified to obtain the gene containing... nsts The linear DNA fragment of the Y433W gene was obtained. The purified linear DNA fragment was re-ligated using the Gibson Assembly method. The ligation product was transformed into commercially available E. coli DH5α competent cells, plated on LB agar plates containing ampicillin, and incubated overnight at 37°C.

[0143] Single colonies were picked and inoculated into LB broth containing ampicillin and cultured overnight at 37°C. Plasmids were extracted using a commercially available plasmid miniprep kit, and sequencing confirmed the presence of the recombinant plasmid pUC57- containing the Y433W single-point mutation. nsts -Y433W.

[0144] Using the correctly sequenced plasmid pUC57- nsts Using Y433W as a template, PCR amplification was performed using primers with p3933 homologous arms to obtain the gene fragment encoding the Y433W variant with p3933 homologous arms at both ends. The PCR product was digested with DpnI, recovered, and purified for later use.

[0145] The plasmid p3933 was linearized using restriction endonucleases. The PCR product containing the p3933 homologous arm was then ligated to the linearized p3933 vector via homologous recombination using the Gibson Assembly method. The ligation product was transformed into commercially available *E. coli* DH5α competent cells and plated on LB agar plates containing 100 mg / L ampicillin, incubated overnight at 37°C.

[0146] Single clones were selected for colony PCR identification, and positive clones were sequenced for verification. Sequencing results confirmed that the obtained coding gene contained a single-point mutation at position 433, where tyrosine was changed to tryptophan, and the encoded amino acid sequence was completely identical to SEQ ID NO. 8. This recombinant plasmid was named p3933-nsts-Y433W.

[0147] Example 14: Production of tricycloene by fermentation using Y433W mutant engineered strain This embodiment provides a method and results for the fermentation production of tricycloene using an engineered strain expressing the tricycloene synthase variant shown in SEQ ID NO.8.

[0148] The recombinant expression vector p3933- constructed in Example 13 was used. nsts Y433W and plasmid pAC-6409mva containing the heterologous mevalonate pathway were co-transformed into *E. coli* BS1101 competent cells via chemical transformation. After transformation, the cells were plated on LB agar plates containing 100 mg / L ampicillin and 34 mg / L chloramphenicol and incubated overnight at 37°C. Single colonies were picked to obtain the engineered strain expressing the Y433W tricyclic alkylate synthase variant.

[0149] Single clones of the engineered strain were picked from the plate and inoculated into 3 mL of LB liquid medium containing the corresponding antibiotics. The culture was incubated overnight at 37°C and 220 rpm to obtain the seed culture. The seed culture was then transferred at a 2% (v / v) inoculation rate to a 250 mL shake flask containing 20 mL of fermentation medium (containing 9.8 g / L K₂HPO₄, 5 g / L beef extract, 0.3 g / L ferric ammonium citrate, 2.1 g / L citric acid monohydrate, 61.1 mg / L MgSO₄, 10 g / L tryptone, 10 g / L glucose, 100 mg / L ampicillin, and 34 mg / L chloramphenicol). After culturing at 37°C and 220 rpm for 5 hours, IPTG was added to a final concentration of 0.5 mM to induce expression. Simultaneously, 20% (v / v) dodecane was added as an organic capping layer for in-situ extraction. Fermentation was then continued at 30°C and 220 rpm for 72 hours.

[0150] After fermentation, the upper dodecane organic phase was collected, appropriately diluted with ethyl acetate, and caryophyllene was added as an internal standard. The product was analyzed using gas chromatography-mass spectrometry (GC-MS). An HP-5MS column was used, and the temperature program was: 50℃ for 1 min, increased to 130℃ at 20℃ / min and held for 2 min, then increased to 290℃ at 40℃ / min. Qualitative and quantitative analysis were performed by comparing the retention times and mass spectra with those of tricycloene standards.

[0151] The test results showed that the engineered strain expressing the tricycloene synthase variant Y433W shown in SEQ ID NO.8 changed the main product from tricycloene to β-pinene. Figure 2 Unlike wild-type tricyclic olefin synthase, which primarily catalyzes the formation of tricyclic olefins, the Y433W variant significantly alters the product profile, exhibiting a targeted product switching capability. This result indicates that the mutation of tyrosine at position 433 to tryptophan can change the product specificity of tricyclic olefin synthase, shifting its catalytic pathway from tricyclic olefins to β-pinene. This site, acting as a product-specific regulatory switch, provides a precise target for the rational design of monoterpene synthase product profiles.

[0152] Example 15: Construction of tricyclic olefin synthase variant A354L This comparative example provides a method for constructing the tricyclic olefin synthase variant A354L with the amino acid sequence shown in SEQ ID NO.9, and the specific steps are as follows: The coding gene for wild-type tricyclic alkylene synthase NsTS (corresponding to amino acids 46-608 of SEQ ID NO.1) was synthesized in its entirety, and codon optimization was performed for the *E. coli* expression system. The optimized coding gene was cloned into the commercially available plasmid pUC57 to obtain the recombinant plasmid pUC57- nsts Using this recombinant plasmid as a template, site-directed mutagenesis PCR primers for introducing the A354L mutation were designed and synthesized.

[0153] The primer pairs used to introduce the A354L mutation are as follows: Upstream primer: 5'- cgtgttaccgctatgctgaccgttatcgacgac -3' Downstream primer: 5'-gtcgtcgataacggtcagcatagcggtaacacg-3' Using the wild-type NsTS encoding gene as the initial template, site-directed mutagenesis PCR amplification was performed using A354L mutant primers. The PCR reaction conditions were: 98℃ pre-denaturation for 30 seconds; 98℃ denaturation for 10 seconds, 55℃ annealing for 30 seconds, 72℃ extension for 2 minutes, for a total of 30 cycles; and a final extension at 72℃ for 10 minutes. After digestion with DpnI enzyme to remove the template plasmid, the PCR product was recovered and purified to obtain the gene containing... nsts The linear DNA fragment of the -A354L gene was obtained. The purified linear DNA fragment was re-ligated using the Gibson Assembly method. The ligation product was transformed into commercially available E. coli DH5α competent cells, plated on LB agar plates containing ampicillin, and incubated overnight at 37°C.

[0154] Single colonies were picked and inoculated into LB broth containing ampicillin and cultured overnight at 37°C. Plasmids were extracted using a commercially available plasmid miniprep kit, and sequencing confirmed the presence of the recombinant plasmid pUC57- containing the A354L single-point mutation. nsts -A354L.

[0155] Using the correctly sequenced plasmid pUC57- nsts Using A354L as a template, PCR amplification was performed using primers with p3933 homologous arms to obtain the A354L variant encoding gene fragment with p3933 homologous arms at both ends. The PCR product was digested with DpnI, recovered, and purified for later use.

[0156] The plasmid p3933 was linearized using restriction endonucleases. The PCR product containing the p3933 homologous arm was then ligated to the linearized p3933 vector via homologous recombination using the Gibson Assembly method. The ligation product was transformed into commercially available *E. coli* DH5α competent cells and plated on LB agar plates containing 100 mg / L ampicillin, incubated overnight at 37°C.

[0157] Single clones were selected for colony PCR identification, and positive clones were sequenced for verification. Sequencing results confirmed that the obtained coding gene contained a single-point mutation at position 354, where alanine was changed to leucine, and the encoded amino acid sequence was completely identical to SEQ ID NO. 9. This recombinant plasmid was named p3933-nsts-A354L.

[0158] Example 16: Production of tricycloene by fermentation using A354L mutant engineered strain This embodiment provides a method and results for the fermentation production of tricycloene using an engineered strain expressing the tricycloene synthase variant shown in SEQ ID NO.9.

[0159] The recombinant expression vector p3933- constructed in Example 15 was used. nsts A354L and the plasmid pAC-6409mva containing the heterologous mevalonate pathway were co-transformed into *E. coli* BS1101 competent cells via chemical transformation. After transformation, the cells were plated on LB agar plates containing 100 mg / L ampicillin and 34 mg / L chloramphenicol and incubated overnight at 37°C. Single colonies were picked to obtain the engineered strain expressing the A354L tricyclic alkylate synthase variant.

[0160] Single clones of the engineered strain were picked from the plate and inoculated into 3 mL of LB liquid medium containing the corresponding antibiotics. The culture was incubated overnight at 37°C and 220 rpm to obtain the seed culture. The seed culture was then transferred at a 2% (v / v) inoculation rate to a 250 mL shake flask containing 20 mL of fermentation medium (containing 9.8 g / L K₂HPO₄, 5 g / L beef extract, 0.3 g / L ferric ammonium citrate, 2.1 g / L citric acid monohydrate, 61.1 mg / L MgSO₄, 10 g / L tryptone, 10 g / L glucose, 100 mg / L ampicillin, and 34 mg / L chloramphenicol). After culturing at 37°C and 220 rpm for 5 hours, IPTG was added to a final concentration of 0.5 mM to induce expression. Simultaneously, 20% (v / v) dodecane was added as an organic capping layer for in-situ extraction. Fermentation was then continued at 30°C and 220 rpm for 72 hours.

[0161] After fermentation, the upper dodecane organic phase was collected, appropriately diluted with ethyl acetate, and caryophyllene was added as an internal standard. The product was analyzed using gas chromatography-mass spectrometry (GC-MS). An HP-5MS column was used, and the temperature program was: 50℃ for 1 min, increased to 130℃ at 20℃ / min and held for 2 min, then increased to 290℃ at 40℃ / min. Qualitative and quantitative analysis were performed by comparing the retention times and mass spectra with those of tricycloene standards.

[0162] The test results showed that the engineered strain expressing the tricyclic olefin synthase variant A354L shown in SEQ ID NO.9 changed the main product from tricyclic olefin to α-pinene ( Figure 2 Unlike wild-type tricyclic olefin synthase, which primarily catalyzes the formation of tricyclic olefins, the A354L variant significantly alters the product profile, exhibiting a targeted product switching capability. This result indicates that the mutation of alanine at position 354 to leucine can change the product specificity of tricyclic olefin synthase, shifting its catalytic pathway from tricyclic olefins to α-pinene. This site, acting as a product-specific regulatory switch, provides a precise target for the rational design of monoterpene synthase product profiles.

[0163] Example 17: Construction of tricyclic ene synthase variant A354I This comparative example provides a method for constructing the tricyclic olefin synthase variant A354I with the amino acid sequence shown in SEQ ID NO.10, and the specific steps are as follows: The coding gene for wild-type tricyclic alkylene synthase NsTS (corresponding to amino acids 46-608 of SEQ ID NO.1) was synthesized in its entirety, and codon optimization was performed for the *E. coli* expression system. The optimized coding gene was cloned into the commercially available plasmid pUC57 to obtain the recombinant plasmid pUC57- nstsUsing this recombinant plasmid as a template, site-directed mutagenesis PCR primers for introducing the A354I mutation were designed and synthesized.

[0164] The primer pairs used to introduce the A354I mutation are as follows: Upstream primer: 5'- cgtgttaccgctatgatcaccgttatcgacgac -3' Downstream primer: 5'-gtcgtcgataacggtgatcatagcggtaacacg-3' Using the wild-type NsTS encoding gene as the initial template, site-directed mutagenesis PCR amplification was performed using A354I mutant primers. The PCR reaction conditions were: 98℃ pre-denaturation for 30 seconds; 98℃ denaturation for 10 seconds, 55℃ annealing for 30 seconds, 72℃ extension for 2 minutes, for a total of 30 cycles; and a final extension at 72℃ for 10 minutes. After digestion with DpnI enzyme to remove the template plasmid, the PCR product was recovered and purified to obtain the product containing... nsts The linear DNA fragment of the -A354I gene was obtained. The purified linear DNA fragment was re-ligated using the Gibson Assembly method. The ligation product was transformed into commercially available E. coli DH5α competent cells, plated on LB agar plates containing ampicillin, and incubated overnight at 37°C.

[0165] Single colonies were picked and inoculated into LB broth containing ampicillin and cultured overnight at 37°C. Plasmids were extracted using a commercially available plasmid miniprep kit, and sequencing confirmed the presence of the recombinant plasmid pUC57- containing the A354I single-point mutation. nsts -A354I.

[0166] Using the correctly sequenced plasmid pUC57- nsts Using A354I as a template, PCR amplification was performed using primers with p3933 homologous arms to obtain the gene fragment encoding the A354I variant with p3933 homologous arms at both ends. The PCR product was digested with DpnI, recovered, and purified for later use.

[0167] The plasmid p3933 was linearized using restriction endonucleases. The PCR product containing the p3933 homologous arm was then ligated to the linearized p3933 vector via homologous recombination using the Gibson Assembly method. The ligation product was transformed into commercially available *E. coli* DH5α competent cells and plated on LB agar plates containing 100 mg / L ampicillin, incubated overnight at 37°C.

[0168] Single clones were selected for colony PCR identification, and positive clones were sequenced for verification. Sequencing results confirmed that the obtained coding gene contained a single-point mutation at position 354, where alanine was changed to isoleucine, and the encoded amino acid sequence was completely identical to SEQ ID NO. 10. This recombinant plasmid was named p3933- nsts -A354I.

[0169] Example 18: Production of tricycloene by fermentation using A354I variant engineered strain This embodiment provides a method and results for the fermentation production of tricycloene using an engineered strain expressing the tricycloene synthase variant shown in SEQ ID NO.10.

[0170] The recombinant expression vector p3933- constructed in Example 17 was used. nsts -A354I and plasmid pAC-6409mva containing the heterologous mevalonate pathway were co-transformed into Escherichia coli BS1101 competent cells via chemical transformation. After transformation, the cells were plated on LB agar plates containing 100 mg / L ampicillin and 34 mg / L chloramphenicol and incubated overnight at 37°C. Single colonies were picked to obtain the engineered strain expressing the A354I tricyclic alkylate synthase variant.

[0171] Single clones of the engineered strain were picked from the plate and inoculated into 3 mL of LB liquid medium containing the corresponding antibiotics. The culture was incubated overnight at 37°C and 220 rpm to obtain the seed culture. The seed culture was then transferred at a 2% (v / v) inoculation rate to a 250 mL shake flask containing 20 mL of fermentation medium (containing 9.8 g / L K₂HPO₄, 5 g / L beef extract, 0.3 g / L ferric ammonium citrate, 2.1 g / L citric acid monohydrate, 61.1 mg / L MgSO₄, 10 g / L tryptone, 10 g / L glucose, 100 mg / L ampicillin, and 34 mg / L chloramphenicol). After culturing at 37°C and 220 rpm for 5 hours, IPTG was added to a final concentration of 0.5 mM to induce expression. Simultaneously, 20% (v / v) dodecane was added as an organic capping layer for in-situ extraction. Fermentation was then continued at 30°C and 220 rpm for 72 hours.

[0172] After fermentation, the upper dodecane organic phase was collected, appropriately diluted with ethyl acetate, and caryophyllene was added as an internal standard. The product was analyzed using gas chromatography-mass spectrometry (GC-MS). An HP-5MS column was used, and the temperature program was: 50℃ for 1 min, increased to 130℃ at 20℃ / min and held for 2 min, then increased to 290℃ at 40℃ / min. Qualitative and quantitative analysis were performed by comparing the retention times and mass spectra with those of tricycloene standards.

[0173] The test results showed that the engineered strain expressing the tricycloene synthase variant A354I shown in SEQ ID NO.10 changed the main product from tricycloene to safflowerene ( Figure 2 Unlike wild-type tricyclic olefin synthase, which primarily catalyzes the formation of tricyclic olefins, the A354I variant significantly alters the product profile, exhibiting a targeted product switching capability. This result indicates that the mutation of alanine at position 354 to isoleucine can change the product specificity of tricyclic olefin synthase, shifting its catalytic pathway from tricyclic olefins to sine. This site, acting as a product-specific regulatory switch, provides a precise target for the rational design of monoterpene synthase product profiles.

[0174] Example 19: Determination of Steady-State Dynamic Parameters The purified wild-type and the variant enzymes from Example 7 were reacted with a series of concentrations of GPP substrate at 30°C for 10 min, and the products were quantified by GC-MS. Kinetic parameters were obtained by nonlinear fitting of the Michaelis-Menten equation. The results showed that the Ki of the L178F / G427A / G567A variants... m The value was basically the same as that of the wild type (approximately 75 μM), while k cat From 0.011 s -1 Improved to 0.037 s -1 It is 3.4 times more potent than the wild type, with a catalytic efficiency of [missing information]. k cat / K m The corresponding increase is 3.5 times ( Figure 3 ).

[0175] Example 20 Molecular Dynamics Simulation Molecular dynamics simulations were performed on the complex models of wild-type and variant enzymes from Example 7 with GPP substrates for 200 ns. The results showed that the G427A / G567A mutation reduced the spacing of the outer helices (488-506, 531-554, and 560-577) of the active pocket, significantly decreasing the number of water molecules within the active site and creating a more hydrophobic catalytic microenvironment, which is beneficial for the synthesis of tricycloenes. Molecular dynamics simulations were also performed on the complex models of wild-type and variant enzymes from Examples 9, 11, 13, 15, and 17 with catalytic intermediates for 200 ns. The results showed that after the Y433F mutation, the hydrophobic interaction between Y433F and the intermediate was enhanced, leading to a significant reduction in the distances between the C8 atom and the Tyr578 hydroxyl group, the Tyr578 hydroxyl group and the bridging water, and the bridging water and PPi-O1, thus directing the reaction flux towards limonene. Following the Y433L mutation, the space between Y433L and the intermediate expands, leading to a shorter distance between the C4 atom and PPi-O1. Simultaneously, the interaction between the C9 atom and PPi-O7 changes from water-mediated indirect contact to direct contact, simultaneously directing the reaction towards α-pinene and β-pinene. Following the Y433W mutation, the space between Y433W and the intermediate further contracts, and the interaction between the C9 atom and PPi-O7 also becomes direct contact. Due to the more compact space, bridging water molecules are displaced from the active site, directing the reaction towards β-pinene. Following the A354I mutation, the hydrophobic interaction between A354I and the intermediate is enhanced, resulting in a significant increase in the distance between the C2 and C7 atoms, while the C2-C6 distance remains largely unchanged, directing the reaction towards halogen. Following the A354L mutation, the hydrophobic interaction between A354L and the intermediate is enhanced, leading to a shorter distance between the C4 atom and PPi-O1, directing the reaction towards α-pinene.

[0176] The above description is merely an embodiment of the present invention and is not intended to limit the invention. Those skilled in the art can make various modifications to the technical solutions in the embodiments based on the above description. It is neither necessary nor possible to exhaustively describe all possible implementations. Any modifications, variations, substitutions, etc., made based on the technical content disclosed in this invention are equivalent to equivalent implementations and should be included within the protection scope of this invention.

Claims

1. A tricyclic ene synthase variant, characterized in that, The amino acid sequence of the variant contains the following site mutations relative to SEQ ID NO: 1: ① Mutations selected from at least two of the following sites: leucine at position 178 is mutated to phenylalanine L178F, glycine at position 427 is mutated to alanine G427A, and glycine at position 567 is mutated to alanine G567A. or ② The tyrosine residue at position 433 is mutated to phenylalanine Y433F, leucine Y433L, or tryptophan Y433W; or ③ The alanine at position 354 is mutated to leucine A354L or isoleucine A354I; or It contains a combination of mutation sites ① and ② or ① and ③.

2. The tricyclic olefin synthase variant according to claim 1, characterized in that, The amino acid sequences of the tricyclic olefin synthase variants are shown in SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO.

5.

3. The tricyclic olefin synthase variant according to claim 1, characterized in that, The amino acid sequence of the tricyclic olefin synthase variant is shown in SEQ ID NO.6, SEQ ID NO.7 or SEQ ID NO.

8.

4. The tricyclic olefin synthase variant according to claim 1, characterized in that, The amino acid sequence of the tricyclic olefin synthase variant is shown in SEQ ID NO.9 or SEQ ID NO.

10.

5. A gene encoding a tricyclic olefin synthase variant as described in claims 1 to 4.

6. A recombinant expression vector, characterized in that, It includes the encoding gene as described in claim 5.

7. An engineered bacterial strain, characterized in that, It includes the recombinant expression vector of claim 6.

8. A method for producing tricycloene, characterized in that, The method includes the step of using the tricycloene synthase variants of claims 1 to 4, the recombinant expression vector of claim 6, or the engineered strain of claim 7 to catalyze the production of tricycloene from a substrate.

9. The method for producing tricycloene according to claim 8, characterized in that, The method includes the following steps: (1) Construct a recombinant expression vector containing the encoding gene of the tricyclic olefin synthase variant as described in claims 1 to 4; (2) The recombinant expression vector is introduced into the host strain to construct the engineered strain; (3) Ferment the engineered strain and collect the tricycloene product.

10. A method for constructing a modified tricyclic olefin synthase, characterized in that, This includes a combination of mutations in the wild-type tricyclic olefin synthase NsTS sequence shown in SEQ ID NO.1: leucine at position 178 is mutated to phenylalanine (L178F), glycine at position 427 is mutated to alanine (G427A), and glycine at position 567 is mutated to alanine (G567A). Or the tyrosine at position 433 may be mutated to phenylalanine, leucine, or tryptophan (Y433F / L / W). Or the alanine at position 354 may be mutated to leucine or isoleucine (A354L / I).