Immobilized aspergillus niger mannanase, plant salt taste factor, and preparation method and application thereof

Abstract

The present application relates to the technical field of food enzyme engineering, and particularly relates to a kind of immobilized aspergillus niger mannanase, plant salty taste factor and its preparation method and application.The present application provides a kind of immobilized aspergillus niger mannanase, which includes epoxy resin carrier, specific sequence affinity peptide and aspergillus niger mannanase, one end of affinity peptide is covalently combined with epoxy resin, the other end is combined with enzyme, so that enzyme is indirectly fixed with the orientation of avoiding active center.The present application also provides the preparation method of the immobilized enzyme and its application in catalyzing plant raw material mannan hydrolysis, and the method for preparing plant salty taste factor using the immobilized enzyme and the prepared plant salty taste factor.The immobilized enzyme of the present application can reach more than 81% in immobilization efficiency, and the enzyme activity can be maintained more than 80% after being reused for 6 times;The sodium content of the prepared plant salty taste factor is 7%-15%, the peptide content is 3%-7%, has the characteristics of low sodium high peptide, pure flavor, and can be used for seasoning instead of salt.

Description

Technical Field

[0001] This invention relates to the field of food enzyme engineering technology, and in particular to an immobilized Aspergillus niger mannanase, a plant umamiin, and their preparation methods and applications. Background Technology

[0002] Biocatalysts, as a class of highly efficient and specific biocatalysts, are widely used in modern industrial fields such as food processing, pharmaceuticals, and fine chemicals due to their advantages such as high catalytic efficiency, strong specificity, and mild reaction conditions. However, free enzymes generally suffer from drawbacks in practical applications, such as high environmental sensitivity, poor stability, and difficulty in recycling and reusing, which limits the economic viability of their industrial applications. To solve these problems, enzyme immobilization technology has emerged, which enables enzyme recovery and reuse by immobilizing enzyme molecules on a solid carrier, thereby improving enzyme stability and utilization efficiency.

[0003] Epoxy resin is one of the most widely used carrier materials in the field of industrial enzyme immobilization. The epoxy groups on its surface can undergo mild ring-opening covalent binding with amino acid residues such as amino, carboxyl, and thiol groups on the enzyme protein surface at room temperature, thus firmly immobilizing the enzyme molecules on the carrier surface. However, epoxy resin immobilization technology has some technical problems in practical applications. For example, the binding site is difficult to control precisely; the covalent binding between epoxy groups and enzyme molecules occurs randomly, and when the binding site is located in the active site region of the enzyme, it directly hinders the approach of the substrate to the active site, leading to a significant decrease or even loss of enzyme activity. How to maintain enzyme activity to the greatest extent while ensuring strong binding has been a long-standing technical problem in epoxy resin immobilization technology. Furthermore, existing immobilization methods lack precise adaptation to specific enzyme structures; Aspergillus niger mannanase (… Aspergillus niger Mannanase has significant applications in plant extract preparation and food processing, but research on immobilization techniques for this specific enzyme is relatively limited. Existing methods often employ general immobilization techniques, which frequently suffer from significant enzyme activity loss and poor reusability after immobilization.

[0004] Therefore, developing an immobilization technology that can achieve directional immobilization of Aspergillus niger mannanase while maintaining high enzyme activity and good reusability is of great practical significance for expanding its application in the food processing field. Summary of the Invention

[0005] This invention aims to overcome the problems of random binding sites and easy blockage of enzyme active sites leading to a significant decrease in enzyme activity in existing epoxy resin immobilization technologies, as well as the large enzyme activity loss and poor reusability of existing immobilization methods. It specifically provides an immobilized Aspergillus niger mannanase, a plant savory enzyme, its preparation method, and its applications. This immobilized enzyme uses a specific sequence of affinity peptide GKIKVYTGGKWITVD as an intermediate linker molecule. One end of the affinity peptide covalently binds to the epoxy groups of the epoxy resin carrier, while the other end binds to the Aspergillus niger mannanase. This allows the enzyme molecule to be indirectly immobilized on the carrier surface with an orientation that avoids the active site, ensuring strong binding while maximizing enzyme activity and significantly improving the reusability stability of the immobilized enzyme.

[0006] A first aspect of the present invention provides an immobilized Aspergillus niger mannanase, the immobilized Aspergillus niger mannanase comprising: Epoxy resin carrier; An affinity peptide, wherein the amino acid sequence of the affinity peptide is GKIKVYTGGKWITVD, and one end of the affinity peptide is covalently bonded to the epoxy group of the epoxy resin carrier; Aspergillus niger mannanase, which specifically binds to the other end of the affinity peptide via a non-covalent interaction.

[0007] Furthermore, the Aspergillus niger mannanase has an amino acid sequence with Uniprot ID A2QKT4.

[0008] Furthermore, the epoxy resin carrier is selected from at least one of epoxy resins LX1000EP, ES-1, and ESR-1.

[0009] A second aspect of the present invention provides a method for preparing the immobilized Aspergillus niger mannanase as described above, comprising the following steps: Step 1: Mix the epoxy resin carrier with the affinity peptide solution and carry out the modification reaction to obtain the affinity peptide-modified epoxy resin. Step 2: Mix the affinity peptide-modified epoxy resin obtained in Step 1 with Aspergillus niger mannanase solution to fix the reaction. Step 3: Wash the material obtained in Step 2 to obtain immobilized Aspergillus niger mannanase.

[0010] Furthermore, in step 1, during the modification reaction, the stirring speed is 100-200 r / min; the stirring time is 4h-8h; and the reaction temperature is 20-25℃.

[0011] Furthermore, in step 1, the solvent for the affinity peptide solution is a potassium phosphate buffer solution with a pH of 5.0-6.0; and / or, the concentration of the affinity peptide solution is 0.2-0.6 g / L; and / or, the ratio of the epoxy resin carrier to the affinity peptide solution is 1 g: 0.5-2 mL.

[0012] Furthermore, in step 2, during the fixed reaction, the stirring speed is 100-200 r / min; the stirring time is 8h-16h; and the reaction temperature is 20-25℃.

[0013] Furthermore, in step 2, the solvent of the Aspergillus niger mannanase solution is a potassium phosphate buffer solution with a pH of 5.0-6.0; and / or, the concentration of the Aspergillus niger mannanase solution is 2-6 g / L; and / or, the ratio of the affinity peptide-modified epoxy resin to the Aspergillus niger mannanase solution is 1 g: 2-6 mL.

[0014] A third aspect of the present invention provides the application of the immobilized Aspergillus niger mannanase as described above, or the immobilized Aspergillus niger mannanase prepared by the above preparation method, in catalyzing the hydrolysis of mannan in plant materials.

[0015] A fourth aspect of the present invention provides a method for preparing plant-based savory compounds, comprising the following steps: S1. Mix the crushed plant material with water, and then crush it to obtain plant pulp; S2. Add the above-mentioned immobilized Aspergillus niger mannanase to the plant slurry obtained in S1, carry out enzymatic hydrolysis, separate, and obtain the enzymatic hydrolysate. S3. Concentrate the enzymatic hydrolysate obtained in S2 by vacuum distillation to obtain a concentrated solution; S4. Spray dry the concentrated solution obtained in S3 to obtain plant saponins.

[0016] Furthermore, the plant raw materials include the following components by weight: 48-52 parts celery, 8-12 parts shepherd's purse, 6-10 parts lotus root, 6-10 parts bok choy, 4-8 parts purslane, 3-7 parts cabbage, 3-7 parts rapeseed, 3-7 parts lettuce, and 1-5 parts fennel.

[0017] Furthermore, in S1, the ratio of plant material to water is 1:6-8.

[0018] Furthermore, in S1, the conditions for ultrasonic fragmentation are: temperature 40-50°C, power 500-700 W, frequency 60-100kHz, and time 80-120 min.

[0019] Furthermore, in S2, the amount of immobilized Aspergillus niger mannanase added is 0.5-2 g / L of plant pulp.

[0020] Furthermore, in S2, the temperature of the enzymatic hydrolysis reaction is 40-50℃, and the hydrolysis time is 0.5-2h.

[0021] Furthermore, in S3, the conditions for vacuum distillation are: pressure of -0.09 to -0.10 MPa, temperature of 40-50°C, and time of 90-150 min.

[0022] Furthermore, in S4, the spray drying conditions are: inlet temperature 120-160°C, outlet temperature 60-80°C, and spray pressure 8-20 kg / cm². 2 .

[0023] The fifth aspect of the present invention provides a plant saponin, which is prepared by the above-described preparation method, wherein the plant saponin has a sodium content of 7%-15% and a peptide content of 3%-7%.

[0024] A sixth aspect of the present invention provides a seasoning comprising the above-described plant-based umamiin.

[0025] Compared with the prior art, the beneficial effects of the present invention are as follows: 1. This invention provides an immobilized Aspergillus niger mannanase, which uses epoxy resin as a carrier and an affinity peptide with the specific sequence GKIKVYTGGKWITVD as an intermediate linker. One end of the affinity peptide is covalently bound to the epoxy groups of the epoxy resin carrier, and the other end is bound to the Aspergillus niger mannanase, forming a ternary structure of epoxy resin-affinity peptide-enzyme. The affinity peptide acts as a molecular linker, indirectly immobilizing the Aspergillus niger mannanase on the carrier surface. The specific sequence of the affinity peptide is obtained by immobilizing the Aspergillus niger mannanase on the carrier surface. The tertiary structure of the polysaccharide enzyme was designed and screened, and its binding site precisely avoids the active center region of the enzyme, allowing the enzyme molecule to be immobilized on the carrier surface in the optimal orientation. This invention ensures the strong binding between the enzyme and the carrier while maximizing the preservation of the enzyme's catalytic activity. The immobilization efficiency of the immobilized enzyme can reach over 81%, and the enzyme activity can be maintained at over 80% after six reuses, significantly improving the reusability stability of the immobilized enzyme. This provides an efficient and stable immobilized enzyme product for the industrial application of Aspergillus niger mannanase in food processing and other fields.

[0026] 2. The method for preparing immobilized Aspergillus niger mannanase provided by this invention employs a two-step reaction. First, an affinity peptide is modified onto the surface of an epoxy resin carrier. Then, the enzyme is indirectly immobilized through the specific binding of the affinity peptide to Aspergillus niger mannanase. This preparation method is simple to operate and operates under mild reaction conditions, avoiding enzyme activity loss caused by harsh reaction conditions or random binding sites when the enzyme is directly covalently bound to the carrier. Furthermore, the stepwise modification and immobilization process ensures a more uniform distribution and stronger binding of the affinity peptide on the carrier surface, thereby efficiently obtaining an immobilized enzyme product with good catalytic activity and reusability, suitable for large-scale industrial production.

[0027] 3. This invention applies the above-mentioned immobilized Aspergillus niger mannanase to catalyze the hydrolysis reaction of mannan in plant raw materials. Through the mild enzymatic hydrolysis of plant raw materials by the immobilized enzyme, the efficient degradation of mannan in plant cell walls is achieved, promoting the release of active ingredients such as proteins, peptides and minerals in plant cells. This application makes full use of the reusable characteristics of immobilized enzymes, significantly reducing the production cost of enzymatic hydrolysis process, while avoiding the impact of free enzyme residues on product purity and safety. It is especially suitable for the industrial preparation of plant savory ingredients and has outstanding advantages such as simple operation, economy and environmental protection, and stable product quality.

[0028] 4. The method for preparing plant-based savory flavor compounds provided by this invention uses a combination of ultrasonic disruption and enzymatic hydrolysis with immobilized Aspergillus niger mannanase to process plant raw materials. Ultrasonic disruption breaks down the plant cell walls to promote the release of contents, and then the immobilized enzyme specifically hydrolyzes mannan and other cell wall polysaccharide components to further release flavor substances such as proteins, peptides, and minerals encapsulated within the cell walls. This method combines enzymatic hydrolysis with physical disruption, significantly improving extraction efficiency. The obtained enzymatic hydrolysate can be directly obtained as solid plant-based savory flavor compounds after vacuum distillation concentration and spray drying. The entire process does not require the introduction of organic solvents, is simple to operate, and is environmentally friendly. Furthermore, the immobilized enzyme can be separated, recycled, and reused, effectively reducing production costs. The resulting plant-based savory flavor compounds are natural, highly pure, and have a pure flavor.

[0029] 5. The plant-based salty flavoring agent provided by this invention is prepared by the specific preparation method described above. Its sodium content is controlled at 7%-15% and its peptide content reaches 3%-7%, achieving a synergistic effect of low sodium and high peptide. This product utilizes the flavor characteristics of plant-derived salty peptides to effectively compensate for the lack of saltiness caused by low sodium while significantly reducing sodium content. It has a mellow and natural taste and can replace traditional table salt for food seasoning. It helps to reduce daily sodium intake, meets the needs of a healthy diet, and the product is derived from natural plant raw materials, without chemical additives, and has both nutritional value and safety.

[0030] 6. The seasoning provided by the present invention contains the above-mentioned plant-based savory ingredients, which replace traditional table salt with low-sodium, high-peptide savory ingredients from natural plant sources. While maintaining a salty and savory taste, it significantly reduces sodium intake, which is in line with the trend of reducing salt intake and healthy eating. Moreover, the product ingredients are natural and free of chemical additives, and it is both nutritious and safe. It can be widely used in the seasoning and processing of various foods. Attached Figure Description

[0031] Figure 1 This is a schematic diagram of the immobilization of Aspergillus niger mannanase according to the present invention.

[0032] Figure 2 This is a tertiary structure diagram of the immobilized Aspergillus niger mannanase and affinity peptide in Example 1 of the present invention.

[0033] Figure 3 This is the optimal temperature analysis curve for the immobilized Aspergillus niger mannanase in Example 1 of this invention. Relative baseline: the highest enzyme activity value measured under the same experimental conditions (at 50℃) is defined as 100%. (Data are the average of three independent experiments ± SD, n=3).

[0034] Figure 4 This is the optimal pH analysis curve for the immobilized Aspergillus niger mannanase in Example 1 of this invention. Relative benchmark: The highest enzyme activity value measured under the same experimental conditions (at pH 4.0) is defined as 100%.

[0035] Figure 5 This is the pH stability analysis curve of the immobilized Aspergillus niger mannanase in Example 1 of the present invention. Relative baseline: enzyme activity without incubation treatment (0 h) is defined as 100%.

[0036] Figure 6 This is the temperature stability analysis curve of the immobilized Aspergillus niger mannanase in Example 1 of the present invention. Relative baseline: enzyme activity without incubation treatment (0 h) is defined as 100%.

[0037] Figure 7 This is a curve showing the relationship between the number of times the immobilized Aspergillus niger mannanase was reused and its relative enzyme activity in Example 1 of this invention. Relative baseline: the enzyme activity at the first use was defined as 100%. Reaction conditions for each use: 50℃, pH 4.0, reaction time 1 h. Detailed Implementation

[0038] The present invention will now be described in further detail with reference to specific embodiments. However, this should not be construed as limiting the scope of the present invention to the following embodiments; all technologies implemented based on the content of the present invention fall within the scope of the present invention.

[0039] Epoxy resin is one of the most widely used carrier materials in the field of industrial enzyme immobilization. The epoxy groups on its surface can undergo mild ring-opening covalent binding with amino acid residues such as amino, carboxyl, and thiol groups on the enzyme protein surface at room temperature, thus firmly immobilizing the enzyme molecules on the carrier surface. However, epoxy resin immobilization technology has some technical problems in practical applications. For example, the binding site is difficult to control precisely; the covalent binding between epoxy groups and enzyme molecules occurs randomly, and when the binding site is located in the active site region of the enzyme, it directly hinders the approach of the substrate to the active site, leading to a significant decrease or even loss of enzyme activity. How to maintain enzyme activity to the greatest extent while ensuring strong binding has been a long-standing technical problem in epoxy resin immobilization technology. Furthermore, existing immobilization methods lack precise adaptation to specific enzyme structures; Aspergillus niger mannanase (… Aspergillus niger Mannanase has significant applications in plant extract preparation and food processing, but research on immobilization techniques for this specific enzyme is relatively limited. Existing methods often employ general immobilization techniques, which frequently suffer from significant enzyme activity loss and poor reusability after immobilization.

[0040] The first aspect of this embodiment provides an immobilized Aspergillus niger mannanase, the immobilized Aspergillus niger mannanase comprising: Epoxy resin carrier; An affinity peptide, wherein the amino acid sequence of the affinity peptide is GKIKVYTGGKWITVD, and one end of the affinity peptide is covalently bonded to the epoxy group of the epoxy resin carrier; Aspergillus niger mannanase, wherein the Aspergillus niger mannanase binds to the other end of the affinity peptide.

[0041] The immobilized Aspergillus niger mannanase provided by this invention constructs a ternary structure of epoxy resin carrier-affinity peptide-Aspergillus niger mannanase using an affinity peptide with a specific sequence GKIKVYTGGKWITVD as an intermediate linker. One end of the affinity peptide is covalently bound to the active groups such as epoxy groups of the epoxy resin carrier, while the other end specifically binds to the inactive center region of the Aspergillus niger mannanase. This design ensures strong binding between the enzyme and the carrier while maximizing the preservation of the enzyme's catalytic activity, solving the technical problem of random binding sites and easy blockage of the enzyme's active center, which leads to a significant decrease in enzyme activity in traditional epoxy resin immobilization technology. Furthermore, this immobilized enzyme exhibits good reusability stability, retaining more than 80% of its activity after six reuses, significantly improving the economic efficiency of immobilized enzymes in industrial applications.

[0042] In some embodiments, the Aspergillus niger mannanase has an amino acid sequence with Uniprot ID A2QKT4. This specific sequence of enzyme exhibits excellent specific binding to the affinity peptide GKIKVYTGGKWITVD, ensuring that the affinity peptide accurately recognizes and binds to the enzyme's inactive site region. This effectively avoids the enzyme's active site during immobilization, maximizing the preservation of the enzyme's catalytic activity, while also ensuring the reproducibility of the immobilization process and the consistency of product quality.

[0043] In some embodiments, the epoxy resin carrier is an epoxy resin selected from at least one of LX1000EP, ES-1, and ESR-1. The selected epoxy resin carriers, such as LX1000EP, ES-1, and ESR-1, have a suitable epoxy group density and good mechanical strength on their surface, enabling efficient covalent bonding with the amino and other groups of the affinity peptide under mild conditions. This better ensures uniform modification and firm attachment of the affinity peptide on the carrier surface, while the carrier material itself has good chemical stability and physical durability, capable of withstanding multiple enzymatic hydrolysis reactions and recovery operations, providing a reliable carrier basis for the repeated use of immobilized enzymes.

[0044] The second aspect of this embodiment provides a method for preparing the immobilized Aspergillus niger mannanase as described above, comprising the following steps: Step 1: Mix the epoxy resin carrier with the affinity peptide solution and carry out the modification reaction to obtain the affinity peptide-modified epoxy resin. Step 2: Mix the affinity peptide-modified epoxy resin obtained in Step 1 with Aspergillus niger mannanase solution to fix the reaction. Step 3: Wash the material obtained in Step 2 to obtain immobilized Aspergillus niger mannanase.

[0045] The preparation method provided by this invention employs a two-step reaction strategy of modification followed by immobilization: first, affinity peptides are modified onto the surface of an epoxy resin support; then, the enzyme is indirectly immobilized through the specific binding of the affinity peptides to Aspergillus niger mannanase. This method is simple to operate and operates under mild reaction conditions, avoiding enzyme activity loss caused by harsh reaction conditions or random binding sites when the enzyme is directly covalently bound to the support. Through stepwise modification and immobilization, the affinity peptides are more evenly distributed and more firmly bound on the support surface, thereby efficiently obtaining immobilized enzyme products with good catalytic activity and reusability, suitable for large-scale industrial production.

[0046] In some embodiments, during step 1, the stirring speed is 100-200 r / min, the stirring time is 4-8 h, and the reaction temperature is 20-25 °C.

[0047] In some embodiments, in step 1, the solvent for the affinity peptide solution is a potassium phosphate buffer solution with a pH of 5.0-6.0. Specifically, the pH of the potassium phosphate buffer solution can be 5.0, 5.5, or 6.0.

[0048] In some embodiments, the concentration of the affinity peptide solution is 0.2-0.6 g / L. By controlling the concentration of the affinity peptide solution within a reasonable range, it is possible to ensure sufficient modification of the epoxy resin carrier surface while avoiding intermolecular competition or aggregation caused by excessive affinity peptides. This concentration range allows the affinity peptide molecules to form an appropriate coverage density on the carrier surface, ensuring both efficient and specific binding to Aspergillus niger mannanase and preventing the affinity peptide layer from hindering the approach of enzyme molecules or affecting the conformational freedom of the enzyme due to excessive density, thus balancing immobilization efficiency and enzyme activity retention. Specifically, the concentration of the affinity peptide solution can be 0.2 g / L, 0.3 g / L, 0.4 g / L, or 0.6 g / L.

[0049] In some embodiments, the ratio of the epoxy resin carrier to the affinity peptide solution is 1g:0.5-2mL. By controlling the ratio of the epoxy resin carrier to the affinity peptide solution within a reasonable range, the affinity peptide solution can fully wet the surface of the carrier particles, ensuring effective contact and full reaction between the affinity peptide molecules and the epoxy groups of the carrier. This ratio avoids insufficient carrier wetting and uneven reaction due to insufficient liquid volume, and also avoids dilution of the affinity peptide and reduced coupling efficiency due to excessive liquid volume. Thus, it saves reagent consumption while ensuring modification efficiency, balancing the economy of the process and the reliability of the effect. The specific ratio of epoxy resin carrier to affinity peptide solution can be 1g:0.5mL, 1g:1mL, 1g:1.5mL, or 1g:2mL.

[0050] In some embodiments, during step 2, the stirring speed is 100-200 r / min, the stirring time is 8h-16h, and the reaction temperature is 20-25℃.

[0051] In some embodiments, in step 2, the solvent for the Aspergillus niger mannanase solution is a potassium phosphate buffer solution with a pH of 5.0-6.0.

[0052] In some embodiments, the concentration of the Aspergillus niger mannanase solution is 2-6 g / L. By controlling the concentration of the Aspergillus niger mannanase solution within an appropriate range, sufficient enzyme molecules can be provided to specifically bind to the affinity peptides on the carrier surface, ensuring full utilization of the binding sites on the carrier surface and achieving high immobilization efficiency. Simultaneously, this concentration range avoids insufficient immobilization and low enzyme activity due to excessively low enzyme concentration, and also avoids enzyme molecule crowding or non-specific adsorption due to excessively high enzyme concentration, thus maintaining suitable spatial distribution and active expression of enzyme molecules while ensuring efficient immobilization. Specifically, the concentration of the Aspergillus niger mannanase solution can be 2 g / L, 4 g / L, 5 g / L, or 6 g / L.

[0053] In some embodiments, the ratio of the affinity peptide-modified epoxy resin to the Aspergillus niger mannanase solution is 1g:2-6mL. By controlling the ratio of the affinity peptide-modified epoxy resin to the enzyme solution within a suitable range, sufficient contact between the enzyme solution and the carrier particles can be ensured, allowing the affinity peptide sufficient opportunity to capture enzyme molecules in the solution. This ratio balances the economy of enzyme solution usage with maximizing fixation efficiency, avoiding insufficient liquid volume leading to insufficient contact between enzyme molecules and carrier surface binding sites, and avoiding excessive liquid volume leading to enzyme waste. Thus, while ensuring high fixation efficiency, it saves enzyme solution usage and reduces production costs. Specifically, the ratio of the affinity peptide-modified epoxy resin to the Aspergillus niger mannanase solution can be 1g:2mL, 1g:3mL, 1g:4mL, or 1g:6mL.

[0054] The third aspect of this embodiment provides the application of the immobilized Aspergillus niger mannanase as described above, or the immobilized Aspergillus niger mannanase prepared by the preparation method described above, in catalyzing the hydrolysis reaction of mannan in plant raw materials.

[0055] This invention applies the immobilized Aspergillus niger mannanase to catalyze the hydrolysis of mannan in plant materials. Through the mild enzymatic hydrolysis of the immobilized enzyme and plant materials, efficient degradation of mannan in plant cell walls is achieved, promoting the release of active components such as proteins, peptides, and minerals from plant cells. This application fully utilizes the recyclable and reusable nature of the immobilized enzyme, significantly reducing the production cost of the enzymatic hydrolysis process. It also avoids the impact of free enzyme residues on product purity and safety, making it particularly suitable for the industrial preparation of plant-based umamiin. It boasts significant advantages such as simple operation, economic efficiency, environmental friendliness, and stable product quality.

[0056] To better understand the above embodiments, the following more detailed implementation examples are provided for further explanation.

[0057] In the following examples and comparative examples, the enzyme activity assay method was as follows: 0.5% (w / v) locust bean gum was dissolved in 50 mmol / L phosphate buffer at pH 4.0. 0.9 mL of the substrate solution was taken, and 0.1 mL of enzyme solution was added. The mixture was reacted at 50°C for 10 min, followed by the addition of 1 mL of DNS reagent. The mixture was then incubated in a boiling water bath for 5 min for color development. After cooling, the absorbance at 540 nm was measured. The enzyme activity unit (U) was defined as the amount of enzyme required to release 1 μmol of mannose per minute under the above conditions.

[0058] Example 1 Design and screening of Aspergillus niger mannanase affinity peptides This embodiment is based on the rational design of affinity peptides using the three-dimensional structure of Aspergillus niger mannanase (PDB ID: 3WH9, resolution 1.57 Å).

[0059] (1) Definition of receptor and active site: The crystal structure of this enzyme is used as the receptor model. According to the annotation of the UniProt database (ID: A2QKT4) and literature reports, the substrate binding site and catalytic site of this enzyme are composed of multiple sites Y25, Y115, Y111, W112, E168, Y216, S246, E276, and W306, which are responsible for catalyzing the hydrolysis of mannan glycosidic bonds. In this study, the above sites are used as the reference coordinates of the active pocket.

[0060] (2) Molecular docking screening: Affinity peptides were screened using the molecular docking software AutoDock Vina 1.1.2. A random peptide library containing 5000 peptides of 12-16 amino acids in length was used as the ligand database. The docking calculation region was set to exclude active pocket regions. A semi-flexible docking mode (fixed receptor residues, flexible ligand peptide chains) was adopted, combined with a free energy scoring function for sorting.

[0061] (3) Screening criteria and results: The screening criteria were set as follows: ① Binding free energy (ΔG) <= -5.0 kcal / mol; ② The distance between the peptide binding site and any active site residue is ≥ 5 Å (to ensure that the active site is not blocked); ③ The binding pattern is consistent in multiple conformational clusters. After screening according to the above criteria, 50 candidate affinity peptides were obtained. Further visual verification based on the binding pattern (analysis of hydrogen bond network, hydrophobic interaction and binding direction) finally selected one affinity peptide, whose amino acid sequence is: GKIKVYTGGKWITVD (SEQ ID NO:1).

[0062] (4) Binding Mode Verification: Molecular docking results showed that the affinity peptide binds to a groove region on the enzyme molecule surface, without spatial conflict with the active pocket. Seven pairs of hydrogen bonds are formed between the affinity peptide and the enzyme (involving GLU98, ASP101, ASN156, GLN88, VAL94, SER158, and ASP91 residues). Its three-dimensional binding mode is as follows: Figure 2 As shown.

[0063] (5) Synthesis of affinity peptides The affinity peptide obtained above (amino acid sequence: GKIKVYTGGKWITVD, SEQ ID NO:1) was chemically synthesized using the standard Fmoc solid-phase synthesis method. The specific steps are as follows: Using Rink Amide resin as a carrier, Fmoc-protected amino acids were sequentially coupled. Each coupling cycle used an HBTU / HOBt / DIEA activation system for 60 min, followed by removal of the Fmoc protecting groups using 20% ​​piperidine / DMF. After synthesis, the peptide was cleaved from the resin using a TFA / TIS / H2O (95:2.5:2.5, v / v / v) cleavage buffer for 2 h. The crude peptide was precipitated with diethyl ether and then purified by reversed-phase high-performance liquid chromatography (RP-HPLC). A C18 column (10 × 250 mm, 5 μm) was used. Mobile phase A was 0.1% TFA / H₂O, and mobile phase B was 0.1% TFA / acetonitrile, with a gradient of 5%–65% B eluting linearly over 30 min at a flow rate of 3 mL / min and a detection wavelength of 220 nm. The target peak was collected, and the purified affinity peptide was obtained after lyophilization. Mass spectrometry analysis showed that its molecular weight was consistent with the theoretical value (1664.9 Da), and the HPLC purity was ≥95%.

[0064] Preparation of immobilized Aspergillus niger mannanase Add 1g of epoxy resin LX1000EP to 1mL of affinity peptide solution (the affinity peptide was dissolved in 1mol / L potassium phosphate buffer at pH 5.5 to a final mass concentration of 0.4g / L), and fix for 6h at 150 r / min in a shaker at 22°C.

[0065] Under these conditions, the α-amino group at the N-terminus of the affinity peptide or the ε-amino group of the lysine residue undergoes a nucleophilic ring-opening addition reaction with the epoxy group on the carrier surface to form a stable CN covalent bond, thereby achieving the modification of the carrier surface by the affinity peptide.

[0066] Add 4 mL of Aspergillus niger mannanase (Aspergillus niger mannanase Uniport ID: A2QKT4, amplified and purified by PCR (Man-pHT43-F: CTTAGCTCTAGAATGAAGCTTTCCAACGCC, Man-pHT-R: GCTAAGCCCGGGTTAAGCACTACCAATAGCA) and clone it into vector pHT43 (after double digestion and T4) using restriction endonucleases XbaⅠ and SmaⅠ. DNA ligase ligation was used to ligate the DNA. The ligation product was then transferred into E. coli DH5α cells via a heat shock method (10 min thawing of E. coli DH5α competent cells, 5 μL of ligation product added, 30 min on ice, 60 s heat shock at 42°C, followed by 2 min on ice) for amplification. The pHT43 plasmid containing Aspergillus niger mannanase was extracted. The extracted target plasmid was then transformed into Bacillus subtilis via electroporation (50 ng plasmid, electroporation conditions: 2 kV, 1 mm, 4.5 ms). B. subtilis WB600 competent cells were revived and plated. Positive clones were picked and induced to express for 24 h by adding 0.5 mM IPTG to LB medium. The bacterial culture was centrifuged at 10000 g to obtain crude enzyme solution. The crude enzyme solution was concentrated by ultrafiltration, replaced with sodium dihydrogen phosphate buffer, purified by DEAE anion exchange column, and the pure enzyme solution was collected and adjusted to a final mass concentration of 4 g / L. The cells were fixed at 150 r / min for 12 h in a shaker at 22°C. The carrier surface residue was washed away with 2 mL of potassium phosphate buffer to obtain immobilized Aspergillus niger mannanase.

[0067] Specifically: Acquisition and purification of Aspergillus niger mannanase (Uniprot ID: A2QKT4) Primers and amplification: Using the synthesized A2QKT4 mRNA sequence (NCBI Reference Sequence: XM_001390670.1) as a template, the following primers were used for PCR amplification: Upstream primer: 5'-CTTAGCTCTAGAATGAAGCTTTCCAACGCC-3' (containing the XbaⅠ site) Downstream primer: 5'-GCTAAGCCCGGGTTAAGCACTACCAATAGCA-3' (containing SmaⅠ site) PCR conditions: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 1 min, 30 cycles; 72℃ final extension for 5 min.

[0068] Vector construction and transformation: The PCR product was double-digested with XbaⅠ and SmaⅠ, then ligated into the pHT43 vector digested with the same enzymes, transformed into E. coli DH5α, and sequenced for verification. The verified recombinant plasmid was then transformed into Bacillus subtilis (…). Bacillus subtilis WB600 competent cells were screened for positive transformants on LB plates containing 5 μg / mL chloramphenicol.

[0069] Induction of expression: Positive single clones were selected and cultured in LB medium containing 5 μg / mL chloramphenicol at 37℃ with shaking until the logarithmic growth phase (OD600≈0.6). IPTG was added to a final concentration of 0.5 mM and induced at 25℃ for 24 h.

[0070] Purification: The fermentation broth was centrifuged at 10000×g for 15 min at 4℃, and the supernatant was collected as crude enzyme solution. The crude enzyme solution was concentrated using a 10kDa ultrafiltration tube and replaced with 20 mM sodium dihydrogen phosphate buffer (pH 6.0). The concentrated solution was loaded onto a DEAE Sepharose Fast Flow anion exchange column (2.5 cm × 20 cm) and eluted with a linear gradient of 20 mM sodium dihydrogen phosphate buffer (pH 6.0) containing 0–0.5 M NaCl. The enzyme activity peak was collected. SDS-PAGE analysis showed a purity >95%. The purified enzyme solution was adjusted to a final mass concentration of 4 g / L and stored at -20℃ for later use.

[0071] The study investigated immobilization efficiency and immobilized enzyme activity.

[0072] Fixed efficiency: ; In the formula: C initial Total protein concentration in enzyme solution before immobilization reaction (unit: mg / mL). V initial Volume of enzyme solution before immobilization reaction (unit: mL); C residue After the immobilization reaction was completed, the residual protein concentration (unit: mg / mL) was measured after all washing solutions were combined. V residue Total volume of all washing solutions combined (unit: mL).

[0073] Protein concentration was determined using the Bradford method.

[0074] After testing, the immobilization efficiency of the immobilized Aspergillus niger mannanase prepared in Example 1 was 79.03%, and the relative enzyme activity was 84% ​​(calculated based on the aforementioned baseline). Figure 1This is a schematic diagram of the immobilization of Aspergillus niger mannanase according to the present invention, illustrating the ternary structure of epoxy resin carrier, affinity peptide and Aspergillus niger mannanase, wherein one end of the affinity peptide is covalently bound to the epoxy group of epoxy resin, and the other end is bound to the inactive center region of Aspergillus niger mannanase.

[0075] Analysis of the activity of immobilized Aspergillus niger mannanase Enzyme activity was measured at 5°C intervals within a temperature gradient of 20-60°C to determine the optimal reaction temperature; for example... Figure 3 The optimal temperature analysis curve for the immobilized Aspergillus niger mannanase prepared in Example 1 is shown. The horizontal axis represents temperature (°C), and the vertical axis represents relative enzyme activity (%). The results show that the optimal reaction temperature for this enzyme is 50°C.

[0076] Simultaneously, the enzyme solution was incubated at 30, 40, 50, and 60 °C for 4 h, respectively. Every h, the incubated enzyme solution was collected, and the relative enzyme activity before incubation was defined as 100%. Residual activity was measured to assess thermostability. Figure 6 The temperature stability analysis curve of the immobilized Aspergillus niger mannanase prepared in Example 1 is shown. The horizontal axis represents the incubation time (h), and the vertical axis represents the relative enzyme activity (%). The results show that the enzyme has good stability in the range of 40-50℃.

[0077] After determining the optimal temperature, the substrate was dissolved and reacted using a buffer system with a pH range of 3.0-7.0 (citrate-phosphate buffer pH 3.0-5.0, phosphate buffer pH 6.0-7.0). The optimal reaction pH was determined by enzyme activity assay at the optimal temperature. Figure 4 The optimal pH analysis curve for the immobilized Aspergillus niger mannanase prepared in Example 1 is shown. The horizontal axis represents pH value, and the vertical axis represents relative enzyme activity (%). The results show that the optimal reaction pH for this enzyme is 4.0.

[0078] In addition, the enzyme solution was incubated at 4 °C for 96 h in different pH buffer systems. The remaining activity of the incubated enzyme solution was measured at intervals to evaluate its pH stability. All activity assays were performed in triplicate. Figure 4 The pH stability analysis curve of the immobilized Aspergillus niger mannanase prepared in Example 1 is shown. The horizontal axis represents pH value and the vertical axis represents relative enzyme activity (%). The results show that the enzyme has good stability in the pH range of 4-5.

[0079] After testing, the optimal temperature for immobilized Aspergillus niger mannanase was 50℃, and the optimal pH was 4. The enzyme exhibited good stability at 40-50℃ and pH 4-5. Under conditions of 50℃ and pH 4, the enzyme activity of the immobilized Aspergillus niger mannanase was tested after repeated use, with each reaction lasting 1 hour. After 6 reactions, the relative enzyme activity of the immobilized Aspergillus niger mannanase remained at 81%. The relative enzyme activity of the non-immobilized (Comparative Example 1) Aspergillus niger mannanase was 68.3%. Figure 7 The curve showing the relationship between the number of times the immobilized Aspergillus niger mannanase prepared in Example 1 was used and the relative enzyme activity. The horizontal axis represents the number of uses (times), and the vertical axis represents the relative enzyme activity (%). The results show that the immobilized enzyme of the present invention has good reusability.

[0080] Example 2 The same affinity peptide and Aspergillus niger mannanase as in Example 1 were used.

[0081] Preparation of immobilized Aspergillus niger mannanase 1 g of epoxy resin LX1000EP was added to 1.5 mL of affinity peptide solution (the affinity peptide was dissolved in 1 mol / L potassium phosphate buffer at pH 5.5 to a final mass concentration of 0.3 g / L). The solution was fixed for 6 h at 150 r / min in a shaker at 22°C. Then, 3 mL of Aspergillus niger mannanase (the expressed Aspergillus niger mannanase was dissolved in 1 mol / L potassium phosphate buffer at pH 5.5 to a final mass concentration of 5 g / L) was added. The solution was fixed for 12 h at 150 r / min in a shaker at 22°C. The carrier surface residue was washed away with 2 mL of potassium phosphate buffer to obtain immobilized Aspergillus niger mannanase.

[0082] The performance of the immobilized Aspergillus niger mannanase was tested using the same test method as in Example 1. The test results showed that the epoxy resin-affinity peptide immobilization efficiency of the Aspergillus niger mannanase prepared in Example 2 was 81.3%, and the relative enzyme activity was 86%. After six reactions, the relative enzyme activity of the immobilized Aspergillus niger mannanase remained at 82%.

[0083] Example 3 The same affinity peptide and Aspergillus niger mannanase as in Example 1 were used.

[0084] 1 g of epoxy resin LX1000EP was added to 0.5 mL of affinity peptide solution (the affinity peptide was dissolved in 1 mol / L potassium phosphate buffer at pH 5.5 to a final mass concentration of 0.2 g / L). The solution was fixed for 6 h at 150 r / min in a shaker at 22°C. Then, 2 mL of Aspergillus niger mannanase (the expressed Aspergillus niger mannanase was dissolved in 1 mol / L potassium phosphate buffer at pH 5.5 to a final mass concentration of 2 g / L) was added. The solution was fixed for 12 h at 150 r / min in a shaker at 22°C. The carrier surface residue was washed away with 2 mL of potassium phosphate buffer to obtain immobilized Aspergillus niger mannanase.

[0085] The performance of the immobilized Aspergillus niger mannanase was tested using the same test method as in Example 1. The test results showed that the epoxy resin-affinity peptide immobilization efficiency of the Aspergillus niger mannanase prepared in Example 3 was 78.83%, and the relative enzyme activity was 82%. After six reactions, the relative enzyme activity of the immobilized Aspergillus niger mannanase remained at 78%.

[0086] Example 4 The same affinity peptide and Aspergillus niger mannanase as in Example 1 were used.

[0087] 1 g of epoxy resin LX1000EP was added to 2 mL of affinity peptide solution (the affinity peptide was dissolved in 1 mol / L potassium phosphate buffer at pH 5.5 to a final mass concentration of 0.6 g / L). The solution was fixed for 6 h at 150 r / min in a shaker at 22°C. Then, 6 mL of Aspergillus niger mannanase (the expressed Aspergillus niger mannanase was dissolved in 1 mol / L potassium phosphate buffer at pH 5.5 to a final mass concentration of 6 g / L) was added. The solution was fixed for 12 h at 150 r / min in a shaker at 22°C. The carrier surface residue was washed away with 2 mL of potassium phosphate buffer to obtain immobilized Aspergillus niger mannanase.

[0088] The performance of the immobilized Aspergillus niger mannanase was tested using the same test method as in Example 1. The test results showed that the epoxy resin-affinity peptide immobilization efficiency of the Aspergillus niger mannanase prepared in Example 4 was 80.55%, and the relative enzyme activity was 87%. After six reactions, the relative enzyme activity of the immobilized Aspergillus niger mannanase remained at 82%.

[0089] Comparative Example 1 Compared to Example 1, Comparative Example 1 did not use affinity peptides and epoxy resins, but instead used Aspergillus niger mannanase directly expressed by Bacillus subtilis.

[0090] Comparative Example 2 Compared to Example 1, Comparative Example 2 did not use affinity peptides; instead, Aspergillus niger mannanase was directly immobilized on an epoxy resin LX1000EP carrier.

[0091] The specific preparation process is as follows: Take 1g of epoxy resin LX1000EP and add 4mL of Aspergillus niger mannanase solution (dissolved in 1 mol / L potassium phosphate buffer at pH 5.5, with a final mass concentration of 4g / L).

[0092] The sample was fixed for 18 hours at 150 r / min in a shaker at 22°C (the total fixation time was the same as in Example 1).

[0093] The carrier surface residue was washed away with 2 mL of potassium phosphate buffer to obtain the directly immobilized enzyme.

[0094] The performance of the immobilized enzyme prepared in Comparative Example 2 was tested using the same testing method as in Example 1. The test results showed that the immobilization efficiency was 52.33%, and the relative enzyme activity was 61% (calculated based on the aforementioned baseline). After six reactions, the relative enzyme activity remained at 51.4%.

[0095] Comparative Example 3 Compared to Example 1, Comparative Example 3 used another affinity peptide predicted by a deep learning algorithm. The binding site of this affinity peptide is located in the active region of Aspergillus niger mannanase, and the sequence is: RMKMTANTQTRNWSW.

[0096] The control affinity peptide described above (0.4 g / L, dissolved in potassium phosphate buffer, pH 5.5) was used.

[0097] The immobilization steps were exactly the same as in Example 1: 1 g of epoxy resin LX1000EP was added to 1 mL of control affinity peptide solution, and the mixture was fixed at 22°C and 150 r / min for 6 h. Then, 4 mL of Aspergillus niger mannanase solution was added, and the mixture was fixed under the same conditions for 12 h. After washing, the immobilized enzyme was obtained.

[0098] The performance of the immobilized enzyme prepared in Comparative Example 3 was tested using the same testing method as in Example 1. The test results showed that the immobilization efficiency was 71.2%, and the relative enzyme activity was 35% (calculated based on the aforementioned baseline). After six reactions, the relative enzyme activity remained at 77%.

[0099] In this comparative example, the immobilization efficiency was similar to that of Example 1, but the relative enzyme activity was significantly lower than that of Example 1. Analysis suggests that the binding site of this affinity peptide is located in the active center region of Aspergillus niger mannanase. Although efficient immobilization is achieved, steric hindrance prevents the substrate from approaching the active site, leading to a significant decrease in enzyme activity.

[0100] The fourth aspect of this embodiment provides a method for preparing plant-based savory flavor compounds, comprising the following steps: S1. Mix the crushed plant material with water, and then crush it to obtain plant pulp; S2. Add the above-mentioned immobilized Aspergillus niger mannanase to the plant slurry obtained in S1, carry out enzymatic hydrolysis, separate, and obtain the enzymatic hydrolysate. S3. Concentrate the enzymatic hydrolysate obtained in S2 by vacuum distillation to obtain a concentrated solution; S4. Spray dry the concentrated solution obtained in S3 to obtain plant saponins.

[0101] Example 5 (1) Extraction of plant savory compounds without the addition of immobilized Aspergillus niger mannanase The plant-based ingredients are a mixture of celery, shepherd's purse, lotus root, bok choy, purslane, cabbage, rapeseed, lettuce, and fennel, in the following proportions by weight: 50 parts celery, 10 parts shepherd's purse, 8 parts lotus root, 8 parts bok choy, 6 parts purslane, 5 parts cabbage, 5 parts rapeseed, 5 parts lettuce, and 3 parts fennel. The ingredients are washed, dried, and then pulverized.

[0102] After pulverizing, water was added to the raw material at a ratio of 1:6. The water-soluble raw material was then subjected to ultrasonic extraction at a temperature of 45 ℃, a power of 600 W, a frequency of 80 kHz, and a time of 100 min.

[0103] The extracted solution was concentrated by vacuum distillation at a working pressure of -0.10 MPa, a temperature of 45℃, and a time of 120 min. The solids content in the concentrated extract was 2.8%.

[0104] The concentrated extract was spray-dried at an inlet air temperature of 150℃ and an outlet air temperature of 70℃ to obtain plant saponins. The nutritional components of the plant saponins were tested, and the results are shown in Table 1. Its sodium content was 9.21%, and it had a relatively strong salty taste.

[0105] Table 1 Nutritional composition of plant scavenging agents (2) Application of immobilized Aspergillus niger mannanase in the extraction of savory compounds from plants The plant-based ingredients are a mixture of celery, shepherd's purse, lotus root, bok choy, purslane, cabbage, rapeseed, lettuce, and fennel, in parts by weight: 50 parts celery, 10 parts shepherd's purse, 8 parts lotus root, 8 parts bok choy, 6 parts purslane, 5 parts cabbage, 5 parts rapeseed, 5 parts lettuce, and 3 parts fennel. The ingredients are washed, dried, and then pulverized.

[0106] After pulverizing, water was added to the raw material at a ratio of 1:6. The water-soluble raw material was then subjected to ultrasonic extraction at a temperature of 45 ℃, a power of 600 W, a frequency of 80 kHz, and a time of 100 min.

[0107] The extracted solution was treated with 1 g / L of immobilized Aspergillus niger mannanase at 45°C for 1 h, followed by vacuum distillation for concentration. The working pressure was -0.10 MPa, the temperature was 45°C, and the time was 120 min. The solid content in the concentrated extract was 5.7% (for the plant material treated with immobilized Aspergillus niger mannanase for the sixth time, the solid content in the concentrated extract was 4.4%).

[0108] The concentrated extract was spray-dried at an inlet air temperature of 150℃ and an outlet air temperature of 70℃ to obtain plant saponins. The nutritional components of the extract were tested, and the results are shown in Tables 2 and 3.

[0109] Table 2. Nutritional composition of plant materials after initial treatment with immobilized Aspergillus niger mannanase. Table 3. Nutritional composition of plant materials treated with immobilized Aspergillus niger mannanase for the 6th time after 5 applications. In some embodiments, the plant materials comprise the following components by weight: 48-52 parts celery, 8-12 parts shepherd's purse, 6-10 parts lotus root, 6-10 parts bok choy, 4-8 parts purslane, 3-7 parts cabbage, 3-7 parts rapeseed, 3-7 parts lettuce, and 1-5 parts fennel. For example, 48 parts celery, 12 parts shepherd's purse, 6 parts lotus root, 10 parts bok choy, 4 parts purslane, 7 parts cabbage, 3 parts rapeseed, 7 parts lettuce, and 1 part fennel. Alternatively, 52 parts celery, 8 parts shepherd's purse, 10 parts lotus root, 6 parts bok choy, 8 parts purslane, 3 parts cabbage, 7 parts rapeseed, 3 parts lettuce, and 5 parts fennel. In a specific implementation case, the ratio of these two plant raw materials was used, and the immobilized Aspergillus niger mannanase prepared in Examples 1-4 was used to prepare plant savory ingredients. After testing, the sodium content was 7%-15% and the peptide content was 3%-7%.

[0110] In some embodiments, in step S1, the ratio of plant material to water is 1:6-8. For example, the ratio is 1:6. The ratio is 1:7. The ratio is 1:8.

[0111] In some embodiments, the conditions for ultrasonic breaking in S1 are: temperature 40-50°C, power 500-700 W, frequency 60-100 kHz, and time 80-120 min. For example, the conditions for ultrasonic breaking in S1 are: temperature 40°C, power 700 W, frequency 60 kHz, and time 120 min. Alternatively, the conditions for ultrasonic breaking in S1 are: temperature 50°C, power 500 W, frequency 100 kHz, and time 80 min.

[0112] In some embodiments, in S2, the amount of immobilized Aspergillus niger mannanase added is 0.5-2 g / L of plant pulp. For example, in S2, the amount of immobilized Aspergillus niger mannanase added is 0.5 g / L of plant pulp. In S2, the amount of immobilized Aspergillus niger mannanase added is 1.5 g / L of plant pulp. In S2, the amount of immobilized Aspergillus niger mannanase added is 2 g / L of plant pulp.

[0113] In some embodiments, in S2, the enzymatic hydrolysis reaction temperature is 40-50°C, and the enzymatic hydrolysis time is 0.5-2 h. For example, in S2, the enzymatic hydrolysis reaction temperature is 40°C, and the enzymatic hydrolysis time is 2 h. For example, in S2, the enzymatic hydrolysis reaction temperature is 50°C, and the enzymatic hydrolysis time is 0.5 h. For example, in S2, the enzymatic hydrolysis reaction temperature is 44°C, and the enzymatic hydrolysis time is 1.2 h.

[0114] In some embodiments, in S3, the conditions for vacuum distillation are: pressure of -0.09 to -0.10 MPa, temperature of 40-50°C, and time of 90-150 min.

[0115] In some embodiments, in S4, the spray drying conditions are: inlet temperature 120-160°C, outlet temperature 60-80°C, and spray pressure 8-20 kg / cm². 2 For example, in S4, the spray drying conditions are: inlet temperature 120°C, outlet temperature 60°C, and spray pressure 8 kg / cm². 2 For example, in S4, the spray drying conditions are: inlet temperature 160°C, outlet temperature 80°C, and spray pressure 20 kg / cm². 2 For example, in S4, the spray drying conditions are: inlet temperature 140°C, outlet temperature 70°C, and spray pressure 15 kg / cm². 2 .

[0116] This invention achieves synergistic complementarity of flavor substances and nutrients through a specific formulation combination of plant raw materials; significantly improves the cell wall disruption efficiency and promotes the release of intracellular substances by optimizing the material-liquid ratio and ultrasonic crushing conditions; maximizes the catalytic efficiency of immobilized enzymes by optimizing enzymatic hydrolysis conditions, fully hydrolyzing mannan to release flavor components such as proteins and peptides; and maximizes the retention of heat-sensitive flavor substances and active ingredients while effectively concentrating the extract through systematic optimization of vacuum distillation and spray drying conditions. The resulting plant-based savory flavor enhancer is characterized by low sodium and high peptide content, pure flavor, stable quality, and suitability for large-scale production.

[0117] The sixth aspect of this embodiment provides a seasoning containing the aforementioned plant-based savory ingredients.

[0118] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. An immobilized Aspergillus niger mannanase, characterized in that, The immobilized Aspergillus niger mannanase comprises: Epoxy resin carrier; An affinity peptide, wherein the amino acid sequence of the affinity peptide is GKIKVYTGGKWITVD, and one end of the affinity peptide is covalently bonded to the epoxy group of the epoxy resin carrier; Aspergillus niger mannanase, wherein the Aspergillus niger mannanase binds to the other end of the affinity peptide.

2. A method for preparing immobilized Aspergillus niger mannanase as described in claim 1, characterized in that, Includes the following steps: Step 1: Mix the epoxy resin carrier with the affinity peptide solution and carry out the modification reaction to obtain the affinity peptide-modified epoxy resin. Step 2: Mix the affinity peptide-modified epoxy resin obtained in Step 1 with Aspergillus niger mannanase solution to fix the reaction. Step 3: Wash the material obtained in Step 2 to obtain immobilized Aspergillus niger mannanase.

3. The preparation method according to claim 2, characterized in that, In step 1, the solvent for the affinity peptide solution is a potassium phosphate buffer solution with a pH of 5.0-6.0; and / or, the concentration of the affinity peptide solution is 0.2-0.6 g / L; and / or, the ratio of the epoxy resin carrier to the affinity peptide solution is 1 g: 0.5-2 mL.

4. The preparation method according to claim 2, characterized in that, In step 2, the solvent of the Aspergillus niger mannanase solution is a potassium phosphate buffer solution with a pH of 5.0-6.0; and / or, the concentration of the Aspergillus niger mannanase solution is 2-6 g / L; and / or, the ratio of the affinity peptide-modified epoxy resin to the Aspergillus niger mannanase solution is 1 g: 2-6 mL.

5. The application of the immobilized Aspergillus niger mannanase as described in claim 1 or the immobilized Aspergillus niger mannanase prepared by any one of the preparation methods described in claims 2-4 in catalyzing the hydrolysis reaction of mannan in plant raw materials.

6. A method for preparing plant-based umamiin, characterized in that, Includes the following steps: S1. Mix the crushed plant material with water, and then crush it to obtain plant pulp; S2. Add the immobilized Aspergillus niger mannanase as described in claim 1 to the plant slurry obtained in S1, carry out enzymatic hydrolysis, separate, and obtain enzymatic hydrolysate. S3. Concentrate the enzymatic hydrolysate obtained in S2 by vacuum distillation to obtain a concentrated solution; S4. Spray dry the concentrated solution obtained in S3 to obtain plant saponins.

7. The preparation method according to claim 6, characterized in that, The plant materials include the following components by weight: celery 48-52 parts, shepherd's purse 8-12 parts, lotus root 6-10 parts, bok choy 6-10 parts, purslane 4-8 parts, cabbage 3-7 parts, rapeseed 3-7 parts, lettuce 3-7 parts, and fennel 1-5 parts.

8. The preparation method according to claim 6, characterized in that, In S1, the ratio of plant material to water is 1:6-8.

9. A plant-based umamiin, characterized in that, The plant salicylic acid is prepared by the preparation method according to any one of claims 6 to 8, wherein the sodium content is 7%-15% and the peptide content is 3%-7%.

10. A condiment, characterized in that, It contains the plant-based savory compound as described in claim 9.

Images