DNA probe combination capable of reducing target RNA content in tumor cells and application thereof

Abstract

The application discloses a DNA probe combination capable of reducing the content of target RNA in tumor cells and application thereof. The DNA probe combination comprises a DNA structure formed by base complementary pairing and hybridization between two or more single-stranded DNA chains, and the single-stranded DNA at least comprises a DNA sequence capable of specifically combining with target RNA. The probe combination can form a DNA nanostructure through base complementary pairing and hybridization. The DNA nanostructure can combine with target RNA after entering tumor cells, triggers flap endonuclease 1 in the tumor cells to cut the target RNA, and thus reduces the level of the target RNA in the cells. The structure formed by the DNA probe combination has the ability of simultaneously combining with multiple target RNAs and thus multivalently degrading the RNAs, and has a good application prospect in tumor cell gene function regulation and treatment.

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, specifically relating to a DNA probe combination that can reduce the content of target RNA in tumor cells and its application. Background Technology

[0002] Cancer is one of the world's deadliest diseases, seriously threatening human health and life. The occurrence and development of tumors involve the abnormal expression or mutation of various genes, which are often involved in cell proliferation, differentiation, aging, death, and other processes. Currently, gene therapy, as an emerging revolutionary treatment technology, can theoretically regulate the expression of any abnormal gene in cancer cells. Compared with other treatments, gene therapy has advantages such as high efficiency, high selectivity, low side effects, and no drug resistance. Over the past few decades, more than 4,600 gene therapy clinical trials have been conducted worldwide, of which 29% have entered Phase II / III / IV clinical trials.

[0003] Nucleic acid drugs for cancer treatment mainly include small interfering RNA (siRNA), antisense oligonucleotides (ASO), messenger RNA (mRNA), short hairpin RNA (shRNA), and gene editing systems (e.g., the CRISPR / Cas9 system). Each nucleic acid drug can specifically target cells at the genetic level in its own way. siRNA typically consists of 20-30 nucleotides and binds to Argonaute family proteins to degrade target genes. ASO typically consists of 16-22 nucleotides and can inhibit the expression of specific RNAs. mRNA is a single-stranded RNA that carries the genetic information for protein translation. shRNA can effectively bind to the RNA-induced silencing complex and degrade target RNA. The CRISPR / Cas9 system requires the design of sgRNAs that are perfectly complementary to specific regions of the target gene to ensure that they can accurately bind and guide the Cas9 protein for cleavage.

[0004] Although the aforementioned nucleic acid drugs can cleave or degrade target RNA, they can only degrade one gene at a time, easily leading to the activation of compensatory pathways. Therefore, they need to act on two or more genes simultaneously. Furthermore, since the enzymes required for these nucleic acid drugs to function are present in the same quantity in tumor cells and normal cells, when the target genes are the same in tumor cells and normal cells, these nucleic acid drugs cannot achieve selectivity in tumor cells on their own. They require vectors that can specifically target or stimulate responsiveness in tumor cells. Summary of the Invention

[0005] Purpose of the invention: The technical problem to be solved by the present invention is to provide a DNA probe combination that can not only achieve multi-target degradation, but also selectively kill tumor cells by utilizing the highly expressed flap endonuclease 1 (FEN1) in tumor cells, thereby reducing the content of target RNA in tumor cells. The 5' overhanging base in the probe combination can complementarily pair with the target RNA to form a three-base overlapping structure, so that the RNA is recognized and cleaved by the highly expressed FEN1 in tumor cells, thereby reducing the level of target RNA in the cell, reducing the expression of the corresponding target protein, and ultimately affecting cell function.

[0006] Another technical problem that this invention aims to solve is to provide a method for reducing the content of target RNA in tumor cells.

[0007] Another technical problem that this invention aims to solve is to provide a kit for reducing the content of target RNA in tumor cells.

[0008] The final technical problem to be solved by this invention is to provide the application of DNA probe assemblies in the preparation of drugs for treating tumors.

[0009] Technical Solution: To solve the above-mentioned technical problems, the present invention provides a DNA probe combination that can reduce the content of target RNA in tumor cells. The DNA probe combination includes a DNA structure formed by base complementary pairing hybridization between two or more single-stranded DNA strands. The single-stranded DNA contains at least one DNA sequence that can specifically bind to the target RNA. The DNA sequence that can specifically bind to the target RNA includes a sequence that can specifically bind to flap endonuclease 1 or a DNA polymerase with 5' exonuclease activity.

[0010] Since the DNA probe combination's ability to reduce target RNA depends on the high expression of the FEN1 enzyme in tumor cells, while the FEN1 enzyme content is low in normal cells, the target RNA expression will not be affected even if the DNA probe combination enters normal cells.

[0011] Furthermore, the DNA probe assembly consists of two or three or more single-stranded DNA strands, each strand forming a polymer through base pairing, which contains a 3' indentation and a 5' protrusion of a DNA double strand.

[0012] The two single-stranded DNAs include palindromic sequences or are partially complementary. The single-stranded DNA strands hybridize through complementary base pairing to form a dimer, and the dimer contains a 3' indented and a 5' protruding DNA double strand. The two or more single-stranded DNAs consist of three or more single-stranded DNAs. The three or more single-stranded DNAs hybridize through partial sequences to form a trimer or polymer. The trimer or polymer contains a 3' indented and a 5' protruding DNA double strand. Preferably, the sequence of the single-stranded DNA is as shown in one or more of SEQ ID NO.1, SEQ ID NO.2, or SEQ ID NO.3.

[0013] The tumor cells are cells that highly express flap endonuclease 1 or DNA polymerases with 5' exonuclease activity.

[0014] Among them, tumor cells include lung adenocarcinoma cells, cervical cancer cells, breast cancer cells, or colorectal cancer cells, etc.

[0015] The target RNA includes messenger RNA or microRNA.

[0016] The present invention also includes a method for reducing the content of target RNA in tumor cells, the method comprising introducing the DNA probe combination into tumor cells.

[0017] The DNA probe combination is introduced into tumor cells by means of nucleic acid chemical modification and / or delivery using a delivery system.

[0018] The nucleic acid chemical modifications include N-acetylgalactosamine, cell-penetrating peptides, and lipoic acid derivatives; the delivery systems include lipid nanoparticles, micelles, protein carriers, exosomes, and inorganic nanoparticles. The carrier delivery system includes, for example, Lipo6000. TM Transfection reagents, including but not limited to one.

[0019] The DNA probe assembly, upon entering tumor cells, hybridizes with target RNA to form a triple-base overlapping structure. This structure is then recognized and cleaved by enzymes highly expressed in the tumor cells, thereby reducing the levels of RNA and related proteins. The effects of reducing intracellular target RNA levels include altered cell function, decreased cell viability, and cell death.

[0020] The highly expressed enzymes include, but are not limited to, flap endonuclease 1 or DNA polymerases with 5' exonuclease activity.

[0021] The present invention also includes a kit for reducing the content of target RNA in tumor cells, comprising the aforementioned DNA probe combination.

[0022] The present invention also includes the application of the aforementioned DNA probe combination in the preparation of drugs for treating tumors.

[0023] Beneficial Effects: Compared with existing technologies, this invention has the following advantages: The DNA probe combination of this invention can selectively reduce the content of target RNA in tumor cells with high FEN1 enzyme expression. The DNA probe combination in this invention can exert multivalent effects, that is, simultaneously bind to one or more target RNAs, resulting in high efficiency. This invention allows for the replacement of the 5' overhanging base sequence in the DNA probe combination to act on different targets. This invention uses DNA probes, which are easier to synthesize and preserve than RNA and have lower costs. The DNA probe combination of this invention induces the reduction of target RNA by the endogenous FEN1 enzyme in tumor cells, eliminating the need for additional delivery of exogenous FEN1 enzyme, making the system simple and easy to construct. The DNA probe combination in this invention can inhibit tumor cell proliferation by cleaving target RNA, providing a novel method for inhibiting tumor cell growth. Attached Figure Description

[0024] Figure 1 Diagram of a dimer structure for degrading the same target RNA.

[0025] Figure 2 Diagram of the dimer structure for degrading two target RNAs.

[0026] Figure 3 The diagram shows the trimeric and multimeric structures of RNAs that degrade three or more target RNAs.

[0027] Figure 4 This is an electrophoresis diagram of a trimeric DNA probe assembly.

[0028] Figure 5 The effect of trimeric DNA probe combinations on target RNA.

[0029] Figure 6 The effects of a trimeric DNA probe combination on the viability of tumor DNA cells and normal cells. Detailed Implementation

[0030] Example 1: Preparation of DNA probe assemblies

[0031] DNA probe assemblies were prepared by annealing.

[0032] Experimental Procedure: Preparation of Dimeric DNA Probe Assemblies. First, two single-stranded DNAs with identical or different 5' end sequences were prepared into 100 μM solutions using TM buffer (20 mM Tris, 10 mM MgCl2, pH 7.5). Then, the two solutions were mixed in an equal ratio (1:1) and annealed at 95 °C for 5 min. The reaction was then carried out at room temperature for at least 4 h to form the DNA probe assemblies.

[0033] The resulting DNA probe combination that degrades the same target RNA, such as Figure 1 ; Degradation of dimers of two target RNAs, such as Figure 2 .

[0034] Preparation of trimer or multimer DNA probe assemblies. Three or more single-stranded DNAs with the same or different 5' end sequences were prepared into 100 μM solutions using TM buffer (20 mM Tris, 10 mM MgCl2, pH 7.5). The three or more solutions were then mixed in equal proportions (1:1:1) and annealed at 95 °C for 5 min. The mixture was then allowed to react at room temperature for at least 4 h to form the DNA probe assemblies.

[0035] The resulting trimer and multimer structures that degrade three or more target RNAs are as follows: Figure 3 .

[0036] Example 2 Characterization of Trimeric DNA Probe Assemblies

[0037] This invention selects a combination of trimer DNA probes to verify the degradation of target RNA in tumor cells.

[0038] First, the three DNA single strands (Y1, Y2, and Y3) were dissolved separately in TM buffer (20mM Tris, 10mM MgCl2, pH 7.5) to form a solution of a certain concentration (100μM). Then, the three were mixed in equal proportion (1:1:1) and annealed at 95℃ for 5 min. The mixture was then reacted at room temperature for more than 4 h to form trimer Y.

[0039] The DNA probe sequence is (5'-3'):

[0040] Y1:TCTTGCCTACGCCACTGAAGTAGCACCACCTTCACGATGAACC(SEQ IDNO.1)

[0041] Y2: TCTTGCCTACGCCACTGTTCATCGTGAAGGTCATACCCTTAGGC (SEQ IDNO.2)

[0042] Y3: TCTTGCCTACGCCACTCCTAAGGGTATGATGGTGCTACTTCC (SEQ IDNO.3)

[0043] Next, the above-mentioned trimer DNA probe combination was characterized by 12% non-denaturing polyacrylamide gel electrophoresis. Specifically, 10 mL of 12% non-denaturing polyacrylamide gel was prepared with the following formulation: 4 mL of 30% acrylamide, 2 mL of 5×TBE, 70 μL of 10% perthioamide, and 10 μL of tetramethylethylenediamine. The remaining volume was brought to a final volume with double-distilled water. After the gel solidified, the sample was loaded. Initially, the sample was transferred to the gel at 80 V, then the voltage was adjusted to 120 V. After electrophoresis, the gel was incubated with TBE buffer containing Gel Red for 15-20 min, and then photographed using a gel imaging system.

[0044] The results are as follows Figure 4 The fourth "Y" lane showed a slower band than the previous three (Y1, Y2, and Y3), indicating the successful assembly of the trimer DNA probe combination Y.

[0045] Example 3: DNA probe combination transfected into tumor cells

[0046] To deliver DNA probe combinations into tumor cells, this invention employs a transfection method.

[0047] Specific steps: Taking a 96-well plate as an example. One day before transfection, seed approximately 5000 A549 cells into each well of a 96-well plate and culture them until the cell density reaches approximately 70-90% the next day. On the second day, before performing the transfection step, replace the culture medium in each well of the 96-well plate with 90 μL of fresh 1640 medium containing 10% fetal bovine serum (Gibico) without antibiotics. For cells to be transfected into 96-well plates, 12 clean, sterile centrifuge tubes were divided into two groups of six tubes each. 4.9 μL of antibiotic-free and serum-free 1640 medium was added to the first group of six tubes, and 4.8 μL to the second group of six tubes. Then, 0.1 μL of the trimeric DNA probe combination prepared in Example 2 at different concentrations (0, 62.5, 125, 250, 500, and 1000 μM) was added to the first group of six tubes containing 4.9 μL of medium, and the mixture was gently pipetted to mix. In the other group of six tubes containing 4.8 μL of medium, 0.2 μL of Lipo6000 was added to each tube. TM Mix the transfection reagent gently by pipetting, being careful not to vortex or centrifuge. After standing at room temperature for 5 minutes (usually no longer than 25 minutes), gently add all the culture medium from each tube in group 1 containing the trimer DNA probe combination to group 2 containing Lipo6000. TMIn the corresponding tubes of the transfection reagent culture medium, gently invert the centrifuge tube or gently pipette to mix, and let stand at room temperature for 5 minutes. For both adherent and suspension cells, use 10 μL of Lipo6000 per well in a 96-well plate. TM Add the transfection reagent-DNA probe mixture evenly to the entire well, then mix gently. For higher transfection efficiency, replace the culture medium with fresh complete medium 4-6 hours after transfection. Continue culturing for approximately 24-48 hours, and then assess the transfection effect using an appropriate method, such as MTT assay for cell viability.

[0048] Next, the same transfection method was used to investigate the effect of the DNA probe combination on the activity of tumor cells. At the same time, it was also investigated whether the DNA probe combination would have cytotoxicity when the cell line was replaced with normal cells NIH3T3 with a low FEN1 enzyme content.

[0049] Experimental procedure: Tumor cells (A549) and normal cells (NIH3T3) purchased from the ATCC cell bank in the United States were seeded in 96-well plates at a density of 3000 cells / well. After the cells adhered, A549 cells were transfected with different concentrations of the trimer DNA probe combination prepared in Example 2 (with final concentrations of 0, 0.0625, 0.125, 0.25, 0.5 and 1 μM, respectively) under the same conditions and methods as described above. The cells were incubated for 48 h, and cell viability was finally determined by the MTT assay.

[0050] The results are as follows Figure 5 As shown, after treatment of tumor cells A549 with the trimer DNA probe combination, cell viability decreased with increasing trimer DNA probe combination concentration. At a concentration of 1 μM, the cell viability of A549 cells was 30%, effectively inhibiting tumor cell proliferation. However, for normal cells, the cell viability after treatment with the trimer DNA probe combination was over 80%, indicating that it has low toxicity to normal cells and good selectivity for tumor cells.

[0051] Example 4: Expression level of target RNA after treatment of tumor cells with a trimeric DNA probe combination

[0052] In this embodiment, KRAS was selected as the target RNA. KRAS is one of the common mutant genes in the RAS gene family, involved in the regulation of signaling pathways such as cell growth, differentiation, proliferation, and survival. After KRAS mutation, its protein is continuously activated, abnormally activating downstream signaling pathways, leading to uncontrolled cell growth and tumorigenesis. The KRAS mRNA level after treatment of tumor cells with a trimeric DNA probe combination was further evaluated by real-time quantitative PCR (RT-qPCR).

[0053] Experimental procedure: First, A549 cells were subjected to a growth rate of 2 × 10⁻⁶. 4Cells / wells were cultured in 6-well plates at a density maintained for 24 hours. Then, using the same transfection method as in Example 3, the trimer DNA probe combination prepared in Example 2 at a final concentration of 1 μM was transfected into tumor cells A549 and incubated for 48 hours. Subsequently, RNA was extracted from the cells using a Trizol kit and cDNA was synthesized using a reverse transcription kit. cDNA (100 ng, 2 μL), KRAS primers ((positive 5'-GAACAGTAGACACAAAACAGGCTC-3′ (SEQ ID NO.4), 10 μM, 0.4 μL), antisense 5'-AAGGCATCATCAACACCCTGTC-3′ (SEQ ID NO.5), 10 μM, 0.4 μL)) and GAPDH primers ((positive 5'-GCACCGTCAAGGCTGAAC-3′ (SEQ ID NO.6), 10 μM, 0.4 μL), antisense 5'-TGGTGACGCCAGTGGA-3′ (SEQ ID NO.7), 10 μM, 0.4 μL)) and TB Green Fast qPCR-Mix (10 μL) was mixed and run on a real-time PCR system. The PCR program consisted of 40 temperature cycles (95℃ for 30 s, 60℃ for 20 s) followed by melting curve analysis (95℃ for 0 s, 65℃ for 15 s, 95℃ for 0 s). Finally, 2... (-ΔΔCt) The method calculates and compares the relative differences in mRNA content. The control group data is set to have 100% expression, and the experimental group is normalized using the control group data.

[0054] The results are shown in Figure 6 Compared with untreated cell groups, the trimeric DNA probe combination significantly reduced the content of KRAS mRNA in tumor cells after incubation.

Claims

1. A DNA probe combination capable of reducing the content of target RNA in tumor cells, characterized in that, The DNA probe assembly comprises a DNA structure formed by base complementary pairing hybridization between two or more single-stranded DNA strands, wherein the single-stranded DNA contains at least one DNA sequence that can specifically bind to the target RNA, and the DNA sequence that can specifically bind to the target RNA includes a sequence that can specifically bind to flap endonuclease 1 or a DNA polymerase with 5' exonuclease activity.

2. The DNA probe combination for reducing the content of target RNA in tumor cells according to claim 1, characterized in that, The two single-stranded DNAs include palindromic sequences or are partially complementary. The single-stranded DNA strands hybridize through complementary base pairing to form a dimer, and the dimer contains a 3' indented and a 5' overhanging DNA double strand. The two or more single-stranded DNAs consist of three or more single-stranded DNAs. The three or more single-stranded DNAs hybridize through partial sequence interactions to form a trimer or polymer. The trimer or polymer contains a 3' indented and a 5' overhanging DNA double strand. Preferably, the sequence of the single-stranded DNA is as shown in one or more of SEQ ID NO.1, SEQ ID NO.2, or SEQ ID NO.

3.

3. The DNA probe combination that can reduce the content of target RNA in tumor cells according to claim 1, characterized in that, The tumor cells are cells that highly express flap endonuclease 1 or DNA polymerases with 5' exonuclease activity.

4. The DNA probe combination according to claim 1, which can reduce the content of target RNA in tumor cells, is characterized in that, Tumor cells include lung adenocarcinoma cells, cervical cancer cells, breast cancer cells, or colorectal cancer cells.

5. The DNA probe combination according to claim 1, which can reduce the content of target RNA in tumor cells, is characterized in that, The target RNA includes messenger RNA or microRNA.

6. A method for reducing the content of target RNA in tumor cells, characterized in that, The method includes introducing the DNA probe combination according to any one of claims 1 to 5 into tumor cells.

7. The method for reducing the content of target RNA in tumor cells according to claim 6, characterized in that, The DNA probe assemblies are introduced into tumor cells by means of nucleic acid chemical modification and / or delivery using a delivery system.

8. The method for reducing the content of target RNA in tumor cells according to claim 6, characterized in that, After the DNA probe combination enters the tumor cells, it hybridizes with the target RNA to form a triple-base overlapping structure, and is then recognized and cleaved by a highly expressed enzyme in the tumor cells, thereby reducing the content of RNA and related proteins. Preferably, the highly expressed enzyme includes flap endonuclease 1 or a DNA polymerase with 5' exonuclease activity.

9. A kit for reducing the content of target RNA in tumor cells, characterized in that, It comprises the DNA probe combination according to any one of claims 1 to 5.

10. The use of the DNA probe combination according to any one of claims 1 to 5 in the preparation of a medicament for treating tumors.

Images