SiRNA, conjugates and pharmaceutical compositions thereof for inhibiting expression of TRAF6 gene and uses thereof

CN122609569APending Publication Date: 2026-08-21BEIJING WINSUNNY PHARMA CO LTD
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202610181467.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2025-02-21
Filing Date
2026-02-09
Publication Date
2026-08-21

AI Technical Summary

Technical Problem

TRAF6靶向治疗的发展可能为癌症患者带来益处,目前还没有TRAF6的靶向药物

Benefits of technology

[0088]本申请提供的siRNA、药物组合物和siRNA缀合物在体外细胞实验以及体内动物实验中均显示出优异的TRAF6基因表达抑制活性,具有良好的治疗TRAF6基因过表达相关的疾病的潜力,并且其抑制活性能够保持较长的时间,具有优秀的长效作用。例如,本申请公开的siRNA及其缀合物能够降低肝脏中TRAF6 mRNA的表达,毒副作用低,血浆稳定性好,且可在长达42天、甚至84天的时间内均保持较高的抑制活性,因而具有良好的临床应用前景。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

The present application relates to siRNA, siRNA conjugate, pharmaceutical composition comprising the same, and use thereof for inhibiting the expression of TRAF6 gene. Each of the nucleotides in the siRNA is independently modified or unmodified, and the siRNA comprises a sense strand and an antisense strand. The siRNA, conjugate and pharmaceutical composition thereof can be effective in treating and / or preventing diseases associated with overexpression of TRAF6 gene.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to siRNA that inhibits TRAF6 gene expression, siRNA conjugates, pharmaceutical compositions comprising the same, methods of preparation thereof, and uses thereof. Background Technology

[0002] TRAF6 is a member of the TNF receptor-associated factor (TRAF) protein family. TRAF proteins are associated with and mediate signal transduction of members of the TNF receptor superfamily. Structurally, TRAF6 can be divided into an N-terminal activation domain and a C-terminal TRAF domain. The activation domain includes a ring finger structure and five zinc finger structures. The TRAF domain consists of a TRAF-N domain with a helical coil structure and a highly conserved TRAF-C domain. The TRAF domain mediates signal transduction from members of the TNF receptor superfamily.

[0003] TRAF6 is a ubiquitin ligase that plays a crucial role in cell signaling. Matrix metalloproteinases (MMPs) are known to be involved in tumor metastasis, and TRAF6 induces MMP-9 expression by binding to BSG (basigin, a transmembrane glycoprotein). Therefore, siRNAs targeting TRAF6 hold promise as potential inhibitors of TRAF6 in suppressing tumor growth and metastasis.

[0004] Furthermore, TRAF6 promotes the activation of ASK1 (apoptosis signal-regulated kinase 1), a potent inducer of hepatic stellate cells that can cause fibrosis and increase the risk of cirrhosis. Overexpression of TRAF6 exacerbates diet-induced liver inflammation and fibrosis.

[0005] In summary, inhibiting the expression of the TRAF6 gene in patients can prevent and treat diseases associated with tumors, inflammation, and liver disease, such as colon cancer, breast cancer, neuroinflammation, myeloid malignancies, pancreatic cancer, and non-alcoholic steatohepatitis (NASH). The development of TRAF6-targeted therapy may benefit cancer patients; currently, there are no specific drugs targeting TRAF6.

[0006] The present invention aims to provide siRNA, siRNA conjugates and pharmaceutical compositions thereof, which can selectively and effectively inhibit the expression of the TRAF6 gene, thereby achieving the purpose of disease treatment. Summary of the Invention

[0007] This invention provides an siRNA capable of inhibiting TRAF6 gene expression. The siRNA comprises a sense strand and an antisense strand, wherein each nucleotide in the siRNA is independently modified or unmodified. The sense strand contains nucleotide sequence I, and the antisense strand contains nucleotide sequence II. Nucleotide sequence I and nucleotide sequence II are at least partially anticomplementary to form a double-stranded region. The nucleotide sequence I and nucleotide sequence II are selected from the following sequences:

[0008] (1) The nucleotide sequence I comprises the nucleotide sequence shown in SEQ ID NO: 72, and the nucleotide sequence II comprises the nucleotide sequence shown in SEQ ID NO: 73:

[0009] 5'- CUAUGAGUCUGCUAA-3' (SEQ ID NO: 72)

[0010] 5'-UUAGCAGACUCAUAG-3' (SEQ ID NO: 73);

[0011] (2) The nucleotide sequence I comprises the nucleotide sequence shown in SEQ ID NO: 74, and the nucleotide sequence II comprises the nucleotide sequence shown in SEQ ID NO: 75:

[0012] 5'- CCUGUUGUGAUUCAU-3' (SEQ ID NO: 74)

[0013] 5'-AUGAAUCACAACAGG-3' (SEQ ID NO: 75);

[0014] (3) The nucleotide sequence I comprises the nucleotide sequence shown in SEQ ID NO: 23, and the nucleotide sequence II comprises the nucleotide sequence shown in SEQ ID NO: 24.

[0015] In one embodiment, the nucleotide sequence I and the nucleotide sequence II are substantially anticomplementary, substantially anticomplementary, or completely anticomplementary; substantially anticomplementary means that there are no more than 3 base mismatches between the two nucleotide sequences; substantially anticomplementary means that there are no more than 1 base mismatch between the two nucleotide sequences; completely anticomplementary means that there are no mismatches between the two nucleotide sequences.

[0016] In one embodiment, the sense strand further contains nucleotide sequence III, and the antisense strand further contains nucleotide sequence IV, each of which is independently 0-6 nucleotides in length, wherein nucleotide sequence III is attached to the 5' end of nucleotide sequence I, and nucleotide sequence IV is attached to the 3' end of nucleotide sequence II, and nucleotide sequences III and IV are of equal length and substantially anticomplementary or completely anticomplementary; and / or, nucleotide sequence III is attached to the 3' end of nucleotide sequence I, and nucleotide sequence IV is attached to the 5' end of nucleotide sequence II, and nucleotide sequences III and IV are of equal length and substantially anticomplementary or completely anticomplementary.

[0017] In one embodiment, the siRNA comprises a sense strand and an antisense strand, wherein each nucleotide in the siRNA is independently modified or unmodified, wherein the sense strand contains nucleotide sequences I and III, and the antisense strand contains nucleotide sequences II and IV, wherein nucleotide sequences I and III are at least partially anticomplementary to nucleotide sequences II and IV to form a double-stranded region, wherein nucleotide sequences I and III, and nucleotide sequences II and IV are selected from the following sequences:

[0018] (1) The nucleotide sequences I and III comprise or consist of nucleotide sequences as shown in SEQ ID NO: 5, and the nucleotide sequences II and IV comprise or consist of nucleotide sequences as shown in SEQ ID NO: 18.

[0019] (2) The nucleotide sequences I and III comprise or consist of the nucleotide sequences shown in SEQ ID NO: 23, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequences shown in SEQ ID NO: 70.

[0020] (3) The nucleotide sequences I and III comprise or consist of the nucleotide sequences shown in SEQ ID NO: 36, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequences shown in SEQ ID NO: 48.

[0021] (4) The nucleotide sequences I and III comprise or consist of the nucleotide sequences shown in SEQ ID NO: 53, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequences shown in SEQ ID NO: 71.

[0022] In one embodiment, the sense strand further contains nucleotide sequence V and / or the antisense strand further contains nucleotide sequence VI, wherein nucleotide sequences V and VI are each independently 0 to 3 nucleotides in length, nucleotide sequence V is attached to the 3' end of the sense strand to form a 3' overhang of the sense strand, and / or nucleotide sequence VI is attached to the 3' end of the antisense strand to form a 3' overhang of the antisense strand. In a preferred embodiment, the length of nucleotide sequence V or VI is 2 nucleotides. In a preferred embodiment, nucleotide sequence V is identical to or differs from the nucleotide at the corresponding position of the target mRNA, or nucleotide sequence VI is mismatched or complementary to the nucleotide at the corresponding position of the target mRNA. In a preferred embodiment, nucleotide sequence V or VI is two consecutive thymine deoxyribonucleotides or two consecutive uracil ribonucleotides.

[0023] In one embodiment, the length of the double-stranded region is 15-30 nucleotide pairs. In a preferred embodiment, the length of the double-stranded region is 17-23 nucleotide pairs. In a more preferred embodiment, the length of the double-stranded region is 19-21 nucleotide pairs.

[0024] In one embodiment, the sense or antisense strand has 15-30 nucleotides. In a preferred embodiment, the sense or antisense strand has 19-25 nucleotides. In a more preferred embodiment, the sense or antisense strand has 19-23 nucleotides.

[0025] In one embodiment, at least one nucleotide in the sense strand or the antisense strand is a modified nucleotide, and / or at least one phosphate ester group is a phosphate ester group with a modifying group; preferably, the phosphate ester group with a modifying group is a thiophosphate ester group formed by replacing an oxygen atom in the phosphodiester bond of the phosphate ester group with a sulfur atom.

[0026] In one embodiment, the 5' terminal nucleotide of the antisense strand is connected to a 5' phosphate-derived group or a 5' phosphate group, or the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate-derived group or a 5' phosphate group.

[0027] In one embodiment, the 5' terminal nucleotide of the positive strand is linked to a reverse debased deoxyribose residue, and / or the 3' terminal nucleotide of the positive strand is linked to a reverse debased deoxyribose residue.

[0028] In one embodiment, the modified nucleotide is selected from 2'-fluoro-modified nucleotides, 2'-alkoxy-modified nucleotides, 2'-substituted alkoxy-modified nucleotides, 2'-alkyl-modified nucleotides, 2'-substituted alkyl-modified nucleotides, 2'-deoxy-modified nucleotides, 2'-amino-modified nucleotides, 2'-substituted amino-modified nucleotides, nucleotide analogs, or any combination of two or more thereof.

[0029] In one embodiment, the modified nucleotide is selected from 2'-F modified nucleotides, 2'-O-CH3 modified nucleotides, 2'-O-CH2-CH2-O-CH3 modified nucleotides, 2'-O-CH2-CH=CH2 modified nucleotides, 2'-CH2-CH2-CH=CH2 modified nucleotides, 2'-deoxy modified nucleotides, nucleotide analogs, or any combination of two or more thereof.

[0030] In one embodiment, each nucleotide in the sense strand and the antisense strand is independently a 2'-fluorinated nucleotide or a non-fluorinated nucleotide.

[0031] In a preferred embodiment, in the positive strand, 2'-fluorinated nucleotides are located at positions 7, 9, 10, and 11 in a 5' to 3' orientation, with the remaining positions being non-fluorinated nucleotides; or, 2'-fluorinated nucleotides are located at positions 11, 12, 13, and 17 in a 3' to 5' orientation, with the remaining positions being non-fluorinated nucleotides; or, 2'-fluorinated nucleotides are located at positions 9, 11, 13, and 17 in a 3' to 5' orientation, with the remaining positions being non-fluorinated nucleotides; or, 2'-fluorinated nucleotides are located at positions 6, 11, and 13 in a 3' to 5' orientation, with the remaining positions being non-fluorinated nucleotides; and / or

[0032] In the antisense strand, 2'-fluorinated nucleotides are located at positions 2, 6, 14, and 16 in the 5' to 3' direction, with the remaining positions being non-fluorinated nucleotides; or, 2'-fluorinated nucleotides are located at positions 2, 7, 10, and 14, with the remaining positions being non-fluorinated nucleotides; or, 2'-fluorinated nucleotides are located at positions 2, 3, 5, 7, 10, 12, and 14, with the remaining positions being non-fluorinated nucleotides; or, 2'-fluorinated nucleotides are located at positions 2, 7, and 14, with the remaining positions being non-fluorinated nucleotides.

[0033] In one embodiment, each non-fluorinated modified nucleotide is independently selected from a nucleotide or nucleotide analog formed by replacing the hydroxyl group at the 2' position of the ribosyl group of the nucleotide with a non-fluorinated group, wherein the nucleotide analog is selected from a pseudouracil, isonucleotide, LNA, ENA, cET BNA, UNA, and GNA.

[0034] In one embodiment, each nucleotide in the sense strand and the antisense strand is independently a 2'-fluoro-modified nucleotide, a 2'-methoxy-modified nucleotide, a GNA-modified nucleotide, a 2'-deoxy-modified nucleotide, or any combination of two or more thereof.

[0035] In a preferred embodiment, in the positive strand, 2'-fluoromodified nucleotides are located at positions 7, 9, 10, and 11 in a 5' to 3' orientation, with the remaining positions being 2'-methoxymodified nucleotides; or, 2'-fluoromodified nucleotides are located at positions 11, 12, 13, and 17 in a 3' to 5' orientation, with the remaining positions being 2'-methoxymodified nucleotides; or, 2'-fluoromodified nucleotides are located at positions 9, 11, 13, and 17 in a 3' to 5' orientation, with the remaining positions being 2'-methoxymodified nucleotides; or, 2'-fluoromodified nucleotides are located at positions 6, 11, and 13 in a 3' to 5' orientation, with the remaining positions being 2'-methoxymodified nucleotides; and / or

[0036] In the antisense strand, 2'-fluoromodified nucleotides are located at positions 2, 6, 14, and 16 in the 5' to 3' direction, with the remaining positions being 2'-methoxymodified nucleotides; or, 2'-fluoromodified nucleotides are located at positions 2, 7, 10, and 14, with the remaining positions being 2'-methoxymodified nucleotides; or, 2'-fluoromodified nucleotides are located at positions 2, 3, 5, 7, 10, 12, and 14, with position 6 being a GNA-modified nucleotide and the remaining positions being 2'-methoxymodified nucleotides; or, 2'-fluoromodified nucleotides are located at positions 2, 7, and 14, with positions 5 and 12 being 2'-deoxymodified nucleotides and the remaining positions being 2'-methoxymodified nucleotides.

[0037] In some embodiments, the siRNA is oriented from the 5' end to the 3' end.

[0038] The positive chain contains thiophosphate groups located at the following positions:

[0039] Between the first and second nucleotides starting at the 5' end of the positive strand;

[0040] Between the second and third nucleotides starting at the 5' end of the positive strand;

[0041] or,

[0042] The positive chain contains thiophosphate groups located at the following positions:

[0043] Between the reverse debased deoxyribose residue starting at the 5' end of the positive strand and the first nucleotide;

[0044] Between the first and second nucleotides starting at the 5' end of the positive strand;

[0045] Between the reverse debased deoxyribose residue starting at the 3' end of the positive strand and the first nucleotide;

[0046] or,

[0047] The positive chain contains thiophosphate groups located at the following positions:

[0048] Between the first and second nucleotides starting at the 5' end of the positive strand;

[0049] Between the second and third nucleotides starting at the 5' end of the positive strand;

[0050] The reverse debasing deoxyribose residue starting at the 3' end of the positive strand is between the first nucleotide and the first nucleotide.

[0051] In some embodiments, the siRNA, oriented from the 5' end to the 3' end, contains a phosphate thioester group located at the following positions:

[0052] Between the first and second nucleotides starting at the 5' end of the antisense strand;

[0053] Between the second and third nucleotides starting at the 5' end of the antisense strand;

[0054] Between the first and second nucleotides starting at the 3' end of the antisense strand;

[0055] Between the second and third nucleotides starting at the 3' end of the antisense strand.

[0056] In one embodiment, each nucleotide in the sense strand and the antisense strand is independently a 2'-fluoro-modified nucleotide, a 2'-methoxy-modified nucleotide, a GNA-modified nucleotide, a 2'-deoxy-modified nucleotide, or any combination of two or more thereof.

[0057] In a preferred embodiment, 2'-fluoromodified nucleotides are located at positions 7, 9, 10, and 11 of the sense strand in a 5' to 3' orientation, with the remaining positions being 2'-methoxymodified nucleotides; 2'-fluoromodified nucleotides are located at positions 2, 6, 14, and 16 of the antisense strand in a 5' to 3' orientation, with the remaining positions being 2'-methoxymodified nucleotides, wherein the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate-derived group or a 5' phosphate group.

[0058] In a preferred embodiment, 2'-fluoromodified nucleotides are located at positions 7, 9, 10, and 11 of the sense strand in a 5' to 3' orientation, with the remaining positions being 2'-methoxymodified nucleotides; 2'-fluoromodified nucleotides are located at positions 2, 6, 14, and 16 of the antisense strand in a 5' to 3' orientation, with the remaining positions being 2'-methoxymodified nucleotides, wherein the 5' terminal nucleotide of the antisense strand is linked to a 5'-trans-vinylphosphonate group.

[0059] In a preferred embodiment, 2'-fluorinated nucleotides are located at positions 11, 12, 13, and 17 of the sense strand in a 3' to 5' orientation, with the remaining positions being 2'-methoxylated nucleotides; 2'-fluorinated nucleotides are located at positions 2, 7, 10, and 14 of the antisense strand in a 5' to 3' orientation, with the remaining positions being 2'-methoxylated nucleotides, wherein the 5' terminal nucleotide of the antisense strand is linked to a 5'-trans-vinylphosphonate group.

[0060] In a preferred embodiment, 2'-fluoromodified nucleotides are located at positions 9, 11, 13, and 17 of the sense strand in a 3' to 5' orientation, with the remaining positions being 2'-methoxymodified nucleotides; 2'-fluoromodified nucleotides are located at positions 2, 7, 10, and 14 of the antisense strand in a 5' to 3' orientation, with the remaining positions being 2'-methoxymodified nucleotides, wherein the 5' terminal nucleotide of the antisense strand is linked to a 5'-trans-vinylphosphonate group.

[0061] In a preferred embodiment, 2'-fluoromodified nucleotides are located at positions 6, 11, and 13 of the sense strand in a 3' to 5' orientation, with the remaining positions being 2'-methoxymodified nucleotides; 2'-fluoromodified nucleotides are located at positions 2, 7, 10, and 14 of the antisense strand in a 5' to 3' orientation, with the remaining positions being 2'-methoxymodified nucleotides, wherein the 5' terminal nucleotide of the antisense strand is linked to a 5'-trans-vinylphosphonate group.

[0062] In a preferred embodiment, 2'-fluorinated nucleotides are located at positions 9, 11, 13, and 17 of the sense strand in the 3' to 5' direction, with the remaining positions being 2'-methoxylated nucleotides; 2'-fluorinated nucleotides are located at positions 2, 3, 5, 7, 10, 12, and 14 of the antisense strand in the 5' to 3' direction, with position 6 being a GNA-modified nucleotide and the remaining positions being 2'-methoxylated nucleotides, wherein the 5' terminal nucleotide of the antisense strand is linked to a 5'-trans-vinylphosphonate group.

[0063] In a preferred embodiment, 2'-fluoro-modified nucleotides are located at positions 9, 11, 13, and 17 of the sense strand in a 3' to 5' orientation, with the remaining positions being 2'-methoxy-modified nucleotides; 2'-fluoro-modified nucleotides are located at positions 2, 7, and 14 of the antisense strand in a 5' to 3' orientation, with the nucleotides at positions 5 and 12 being 2'-deoxy-modified nucleotides, and the remaining positions being 2'-methoxy-modified nucleotides, wherein the 5' terminal nucleotide of the antisense strand is linked to a 5'-trans-vinylphosphonate group.

[0064] In a preferred embodiment, 2'-fluorinated nucleotides are located at positions 11, 12, 13, and 17 of the sense strand in the 3' to 5' direction, with the remaining positions being 2'-methoxylated nucleotides; 2'-fluorinated nucleotides are located at positions 2, 3, 5, 7, 10, 12, and 14 of the antisense strand in the 5' to 3' direction, with position 6 being a GNA-modified nucleotide and the remaining positions being 2'-methoxylated nucleotides, wherein the 5' terminal nucleotide of the antisense strand is linked to a 5'-trans-vinylphosphonate group.

[0065] In one specific embodiment, the present invention provides siRNAs selected from Table 1; preferably, the siRNAs are selected from N-ER-FY048178, N-ER-FY048178M45, N-ER-FY048178M49, N-ER-FY048178M51, N-ER-FY048200, N-ER-FY048200M49, N-ER-FY048203, N-ER-FY048203M49, N-ER-FY048205, and N-ER-FY048205M49.

[0066] The present invention also provides an siRNA conjugate containing the siRNA of the present invention and a conjugating group conjugated to the siRNA. In one embodiment, in the siRNA conjugate, the sense strand and antisense strand of the siRNA are complementary to form a double-stranded region of the siRNA conjugate, and the 3' end of the sense strand forms a blunt end, and the 3' end of the antisense strand has 1-3 protruding nucleotides extending out of the double-stranded region.

[0067] In one embodiment, the conjugating group is selected from:

[0068]

[0069]

[0070]

[0071]

[0072]

[0073]

[0074]

[0075]

[0076] In one embodiment of the present invention, when the conjugating group is L96, the siRNA conjugate has the structure shown in the following formula (the double helix structure represents the siRNA, and the conjugating group is attached to the 3' end of the positive strand of the siRNA):

[0077]

[0078] In the above conjugate structure, X can be selected as O or S. In one embodiment, X is O.

[0079] In one specific embodiment, the siRNA conjugate is selected from the siRNA conjugates in Table 3; preferably, the siRNA conjugate is selected from N-ER-FY048178M45L96, N-ER-FY048178M49L96, N-ER-FY048178M51L96, N-ER-FY048200M49L96, N-ER-FY048203M49L96, and N-ER-FY048205M49L96.

[0080] The present invention also provides a pharmaceutical composition comprising the siRNA of the present invention, or the siRNA conjugate of the present invention, and a pharmaceutically acceptable carrier.

[0081] The present invention also provides a kit comprising the siRNA of the present invention, or the siRNA conjugate of the present invention, or the pharmaceutical composition of the present invention.

[0082] The present invention also provides the use of the siRNA of the present invention, or the siRNA conjugate of the present invention, or the pharmaceutical composition of the present invention for the preparation of a medicament for inhibiting TRAF6 gene expression.

[0083] The present invention also provides the use of the siRNA of the present invention, or the siRNA conjugate of the present invention, or the pharmaceutical composition of the present invention for the preparation of medicaments for the prevention and / or treatment of diseases related to TRAF6 gene overexpression.

[0084] In one implementation, the disease is colon cancer, breast cancer, neuroinflammation, myeloid malignancy, pancreatic cancer, or non-alcoholic steatohepatitis (NASH).

[0085] The present invention also provides a method for inhibiting TRAF6 gene expression, comprising contacting or administering a therapeutically effective amount of the siRNA of the present invention, or the siRNA conjugate of the present invention, or the pharmaceutical composition of the present invention to cells expressing TRAF6.

[0086] The present invention also provides methods for treating and / or preventing diseases associated with TRAF6 gene overexpression, comprising administering a therapeutically effective amount of the siRNA of the present invention, or the siRNA conjugate of the present invention, or the pharmaceutical composition of the present invention to a subject in need.

[0087] Beneficial effects

[0088] The siRNA, pharmaceutical composition, and siRNA conjugates provided in this application have demonstrated excellent TRAF6 gene expression inhibitory activity in both in vitro cell experiments and in vivo animal experiments, showing promising potential for treating diseases related to TRAF6 gene overexpression. Furthermore, their inhibitory activity is sustained for a long period, exhibiting excellent long-lasting effects. For example, the siRNA and its conjugates disclosed in this application can reduce TRAF6 mRNA expression in the liver with low toxicity, good plasma stability, and can maintain high inhibitory activity for up to 42 days or even 84 days, thus demonstrating promising clinical application prospects.

[0089] The siRNA provided in this application showed a good inhibitory effect on the TRAF6 gene in human hepatocellular carcinoma cell line Huh7. Detailed Implementation

[0090] definition

[0091] Throughout this specification, unless otherwise specified, in this technical field, "G", "C", "A", "T" and "U" generally represent the bases of guanine, cytosine, adenine, thymine, and uracil, respectively. However, it is also generally known in the art that each of "G", "C", "A", "T" and "U" generally also represents a nucleotide containing guanine, cytosine, adenine, thymine, and uracil as a base, respectively. This is a common practice in representing deoxyribonucleic acid sequences and / or ribonucleic acid sequences. Therefore, in the context of this disclosure, the meanings of "G", "C", "A", "T", and "U" include all the above-mentioned possible situations. In this application, "nucleotide" and "ribonucleotide" are used interchangeably, and "deoxyribonucleotide" and "2'-deoxy modified nucleotide" are used interchangeably. Lowercase letters a, u, c, g: indicate nucleotides modified with 2'-methoxy groups; Af, Gf, Cf, Uf: indicate nucleotides modified with 2'-fluoride groups; "dG", "dC", "dA": indicate nucleotides modified with 2'-deoxy groups; when "T" is at the overhang, it indicates thymine ribonucleotide (T); when "T" is in the double-stranded region, it indicates that the uracil ribonucleotide (U) at the corresponding position in the double-stranded region of the siRNA sequence has been replaced with thymine ribonucleotide (T); (invAb) is a reverse debased deoxyribose residue; lowercase letter s indicates that the two nucleotides adjacent to s on the left and right are linked by a thiophosphate group or that the nucleotide is linked to (invAb); P1: indicates that the nucleotide adjacent to the right of P1 is a 5'-phosphate nucleotide; EVP: indicates that the nucleotide adjacent to the right of EVP is a 5'-trans-vinylphosphonate nucleotide; A , U , C , G (Underline + bold + italic): indicates a GNA-modified nucleotide; Base indicates a base, such as A, U, G, C, or T.

[0092] In the foregoing and hereinafter, "2'-fluorinated nucleotide" refers to a nucleotide formed by replacing the hydroxyl group at the 2' position of the ribosyl group with fluorine. "Non-fluorinated nucleotide" refers to a nucleotide or nucleotide analog formed by replacing the hydroxyl group at the 2' position of the ribosyl group with a non-fluorinated group. In this disclosure, "non-fluorinated modification" also includes nucleotide substitution, for example, replacing uracil (U) with thymine (T); correspondingly, "non-fluorinated nucleotide" also includes nucleotides after the aforementioned base substitution. In some embodiments, each non-fluorinated nucleotide is independently selected from one of the nucleotides or nucleotide analogs formed by replacing the hydroxyl group at the 2' position of the ribosyl group with a non-fluorinated group. The nucleotides formed by replacing the hydroxyl group at the 2' position of the ribosyl group with a non-fluorinated group are well known to those skilled in the art, and these nucleotides may be selected from one of the following: 2'-alkoxy modified nucleotides, 2'-substituted alkoxy modified nucleotides, 2'-alkyl modified nucleotides, 2'-substituted alkyl modified nucleotides, 2'-amino modified nucleotides, 2'-substituted amino modified nucleotides, and 2'-deoxy modified nucleotides.

[0093] As used in this specification, "2'-deoxy-modified nucleotide" or "2'-deoxy modification" refers to the replacement of ribonucleotides A, U, C, and G with their corresponding deoxyribonucleotides dA, T, dC, and dG during the modification process. For example, following the 5' to 3' direction, the nucleotide at position 5 of the antisense strand of N-ER-FY048178 is replaced with a deoxyribonucleotide, which means that uracil ribonucleic acid (U) at position 5 is replaced with thymine nucleotide (T); similarly, adenine ribonucleotide (A) is replaced with its corresponding adenine deoxyribonucleotide (dA); cytosine ribonucleotide (C) is replaced with its corresponding cytosine deoxyribonucleotide (dC); and guanine ribonucleotide (G) is replaced with its corresponding guanine deoxyribonucleotide (dG). In this document, "2'-deoxy-modified nucleotide" or "2'-deoxy modification" is also referred to as "nucleotide replacement with deoxyribonucleotide".

[0094] "Alkyl" includes straight-chain, branched, or cyclic saturated alkyl groups. For example, alkyl groups include, but are not limited to, methyl, ethyl, propyl, cyclopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, cyclobutyl, n-pentyl, cyclohexyl, and similar groups. For example, "C 1-6 The "C" in "alkyl" 1-6 "" refers to a group consisting of 1, 2, 3, 4, 5 or 6 carbon atoms arranged in a straight chain, branched chain or cyclic form.

[0095] "Alkoxy" herein refers to an alkyl group that is attached to the remainder of a molecule by an oxygen atom (-O-alkyl), wherein the alkyl group is as defined herein. Non-limiting examples of alkoxy groups include methoxy, ethoxy, trifluoromethoxy, difluoromethoxy, n-propoxy, isopropoxy, n-butoxy, tert-butoxy, n-pentoxy, etc.

[0096] "Nucleotide analogues" refer to groups that can replace nucleotides in nucleic acids, but whose structure differs from that of adenine ribonucleotides, guanine ribonucleotides, cytosine ribonucleotides, uracil ribonucleotides, or thymine deoxyribonucleotides. Examples include pseudouracil (X), isonucleotides, bridged nucleic acids (BNA), or acyclic nucleotides.

[0097] Pseudoruracil (Ѱ) refers to a natural structural analog of a uracil nucleoside, in which the ribose is not linked to the N1 of the uracil ring, but rather to the C5 of the pyrimidine ring; the structural formula of pseudouridine is shown below:

[0098] .

[0099] BNA refers to a restricted or inaccessible nucleotide. BNA can contain a five-membered, six-membered, or seven-membered ring with a "fixed" C3'-endoglucan condensation bridging structure. This bridge is usually incorporated into the 2'-, 4'-position of the ribose to provide a 2', 4'-BNA nucleotide, such as LNA, ENA, cET BNA, etc., where LNA is shown as formula (1), ENA as shown as formula (2), and cET BNA as shown as formula (3).

[0100] Equation (1) Equation (2) Equation (3)

[0101] Acyclic nucleotides are a class of nucleotides formed by opening the sugar ring of a nucleotide, such as unopened nucleic acid (UNA) or glycerol nucleic acid (GNA), where UNA is shown as formula (4) and GNA is shown as formula (5).

[0102] Equation (4) Equation (5)

[0103] In formulas (4) and (5) above, R is selected from H, OH or alkoxy (O-alkyl).

[0104] Isonucleotides are compounds formed by changing the position of the bases in the ribose ring of a nucleotide. For example, compounds formed by moving the bases from the 1'-position to the 2'-position or 3'-position of the ribose ring, as shown in formula (6) or (7).

[0105] Equation (6) Equation (7)

[0106] In the compounds of formulas (6) to (7) above, R is selected from H, OH, F or non-fluorine groups as described above.

[0107] In some embodiments, the nucleotide analogue is selected from one of pseudouracil, isonucleotide, LNA, ENA, cET BNA, UNA, and GNA. In some embodiments, each non-fluorinated nucleotide is a 2'-methoxy-modified nucleotide, a GNA-modified nucleotide, or any combination of two or more thereof. In some preferred embodiments, each non-fluorinated nucleotide is a 2'-methoxy-modified nucleotide.

[0108] In this document, "2'-methoxy-modified nucleotide" refers to a nucleotide formed by replacing the 2'-hydroxyl group of the ribosome with a methoxy group. "Thiophosphate group" refers to a thiophosphate group formed by replacing an oxygen atom in the phosphodiester bond of the phosphate group with a sulfur atom.

[0109] The "thiophosphate group" refers to the structure of the following formula:

[0110] .

[0111] The "5'-phosphate nucleotide" refers to the structure of the following formula:

[0112] ,

[0113] Wherein, R is selected from H, OH, F, alkoxy (O-alkyl) or non-fluorine groups as described above.

[0114] In the context of this specification, the terms "complementary" and "reverse complementary" are used interchangeably and have the meanings known to those skilled in the art: in a double-stranded nucleic acid molecule, the bases of one strand are paired complementaryly with the bases of the other strand. The purine base adenine (A) always pairs with the pyrimidine base thymine (T) in DNA or with uracil (U) in RNA; the purine base guanine (G) always pairs with the pyrimidine base cytosine (C) in DNA or RNA. Each base pair comprises one purine and one pyrimidine. When adenine on one strand always pairs with thymine (or uracil) on the other strand, and guanine always pairs with cytosine, the two strands are considered complementary, and the sequence of the complementary strand can be inferred from its sequence. Correspondingly, "mismatch" in the art means, in the case of a double-stranded nucleic acid, that the bases at corresponding positions are not paired complementaryly.

[0115] Unless otherwise specified above and below, "substantially anticomplementary" means that there are no more than 3 base mismatches between the two nucleotide sequences involved; "substantially anticomplementary" means that there are no more than 1 base mismatch between the two nucleotide sequences; and "completely anticomplementary" means that there are no base mismatches between the two nucleotide sequences.

[0116] In the preceding and following text, the existence or "nucleotide difference" between one nucleotide sequence and another nucleotide sequence refers to a change in the type of bases at the same position of the nucleotides compared to the latter. For example, if a nucleotide base in the latter is A, and the corresponding nucleotide base at the same position in the former is U, C, G, or T, then a nucleotide difference is considered to exist or exist between the two nucleotide sequences at that position. In some embodiments, replacing the nucleotide at the original position with a baseless nucleotide or its equivalent can also be considered as a nucleotide difference at that position.

[0117] In this context, "double-stranded region" refers to the double-stranded region of the siRNA formed by the complementary complementarity of the sense and antisense strands; "protruding end" refers to one or more unpaired nucleotides that protrude from the double-stranded structure of the siRNA when one 3' end of one strand extends beyond the 5' end of the other strand, or vice versa. "Flat-ended" or "blunt-terminated" means that there are no unpaired nucleotides at that end of the siRNA, i.e., no nucleotide protrusions. A "flat-ended" siRNA is a double-stranded siRNA that is double-stranded throughout its entire length, i.e., without nucleotide protrusions at either end of the molecule.

[0118] Throughout this application, particularly in the description of the preparation methods of the siRNA, pharmaceutical compositions, or siRNA conjugates, unless otherwise specified, the nucleoside monomer refers to the modified or unmodified nucleoside phosphorus amide monomer used in solid-phase phosphorus amide synthesis, depending on the type and sequence of nucleotides in the desired siRNA or siRNA conjugate. Solid-phase phosphorus amide synthesis is a method known to those skilled in the art for RNA synthesis. All nucleoside monomers used in this application are commercially available.

[0119] In the context of this application, unless otherwise stated, "conjugation" refers to the covalent connection between two or more chemical parts, each with a specific function; correspondingly, "conjugate" refers to a compound formed by the covalent connection of these chemical parts. Further, "siRNA conjugate" refers to a compound formed by the covalent attachment of one or more chemical parts with specific functions to siRNA. siRNA conjugate should be understood, depending on the context, as a collective term for multiple siRNA conjugates or a siRNA conjugate represented by a specific chemical formula. In the context of this application, "conjugating group" should be understood as a specific compound that can be reactively conjugated to siRNA to ultimately form the siRNA conjugate of this application.

[0120] Various hydroxyl protecting groups may be used in this application. Generally, protecting groups insensitize chemical functional groups to specific reaction conditions and can be added to and removed from the functional group in the molecule without substantially impairing the rest of the molecule. In some embodiments, protecting groups are stable under basic conditions but can be removed under acidic conditions. In some embodiments, non-exclusive examples of hydroxyl protecting groups that may be used in this application include monomethoxytriphenylmethyl, 9-phenylxanthine-9-yl (Pixyl), and 9-(p-methoxyphenyl)xanthine-9-yl (Mox). In some embodiments, non-exclusive examples of hydroxyl protecting groups that may be used in this application include Tr (triphenylmethyl), MMTr (4-methoxytriphenylmethyl), DMTr (4,4'-dimethoxytriphenylmethyl), and TMTr (4,4',4''-trimethoxytriphenylmethyl).

[0121] As used in this specification, "optional" or "optionally" means that the event or condition described thereafter may or may not occur, and the description includes both the occurrence and non-occurrence of the event or condition.

[0122] The term “subject” as used in this specification refers to any animal, such as a mammal or marsupial. Subjects in this application include, but are not limited to, humans, non-human primates (e.g., rhesus monkeys or other types of macaques), mice, pigs, horses, donkeys, cattle, sheep, rats, rabbits, or any kind of poultry.

[0123] As used in this specification, “treatment” means a method of obtaining a beneficial or desired outcome, including but not limited to treatment benefits. A “treatment benefit” means the eradication or improvement of the underlying disorder being treated. Furthermore, a treatment benefit is obtained by eradicating or improving one or more physiological symptoms associated with the underlying disorder, thereby observing improvement in the subject, although the subject may still be suffering from the underlying disorder.

[0124] As used in this specification, “prevention” means a method of obtaining a beneficial or desired outcome, including but not limited to preventive benefits. To obtain a “preventive benefit,” siRNA, siRNA conjugates, or pharmaceutical compositions may be given to subjects at risk of developing a specific disease, or to subjects who report one or more physiological symptoms of a disease, even if a diagnosis of the disease may not have been made.

[0125] siRNA

[0126] This application relates to an siRNA capable of inhibiting TRAF6 gene expression. The siRNA of this application contains nucleotide groups as basic structural units, as is known to those skilled in the art, and these nucleotide groups contain phosphate groups, ribose groups, and bases. Typically, an active, i.e., functional siRNA is about 12-40 nucleotides in length, and in some embodiments about 15-30 nucleotides.

[0127] The siRNA of this application contains a sense strand and an antisense strand, each nucleotide in the siRNA being independently modified or unmodified. The sense strand contains a nucleotide sequence I, and the antisense strand contains a nucleotide sequence II. Nucleotide sequence I and nucleotide sequence II are at least partially anticomplementary to form a double-stranded region. In some embodiments, the length of the double-stranded region is 15-30 nucleotide pairs. In other embodiments, the length of the double-stranded region is 17-23 nucleotide pairs. In still other embodiments, the length of the double-stranded region is 19-21 nucleotide pairs. In yet another embodiment, the length of the double-stranded region is 19 or 21 nucleotide pairs.

[0128] In some embodiments, the positive strand further contains nucleotide sequence III, and the antisense strand further contains nucleotide sequence IV, each nucleotide sequence III and IV being independently 0-6 nucleotides in length. Nucleotide sequence III is attached to the 5' end of nucleotide sequence I, and nucleotide sequence IV is attached to the 3' end of nucleotide sequence II. Nucleotide sequences III and IV are of equal length and are substantially anticomplementary or completely anticomplementary. In some embodiments, the sense strand further contains nucleotide sequence III, and the antisense strand further contains nucleotide sequence IV, each of which is independently 0-6 nucleotides in length. Nucleotide sequence III is attached to the 5' end of nucleotide sequence I, and nucleotide sequence IV is attached to the 3' end of nucleotide sequence II. Nucleotide sequences III and IV are of equal length and are substantially anticomplementary or completely anticomplementary. Alternatively, nucleotide sequences III attached to the 5' and 3' ends of nucleotide sequence I are independently selected (i.e., the nucleotide sequences III attached to the 5' and 3' ends of nucleotide sequence I are the same or different), and nucleotide sequences IV attached to the 5' and 3' ends of nucleotide sequence II are independently selected (i.e., the nucleotide sequences IV attached to the 5' and 3' ends of nucleotide sequence II are the same or different).

[0129] In some embodiments, the positive strand further contains nucleotide sequence V and / or the antisense strand further contains nucleotide sequence VI, wherein nucleotide sequences V and VI are each independently 0 to 3 nucleotides in length, with nucleotide sequence V attached to the 3' end of the positive strand to form a 3' overhang, and / or nucleotide sequence VI attached to the 3' end of the antisense strand to form a 3' overhang. In some embodiments, the length of nucleotide sequence V or VI is 2 nucleotides. In other embodiments, nucleotide sequence V is identical to or differs from the nucleotide at the corresponding position on the target mRNA, or nucleotide sequence VI is mismatched or complementary to the nucleotide at the corresponding position on the target mRNA. In other embodiments, nucleotide sequence V or VI is two consecutive thymine deoxyribonucleotides or two consecutive uracil ribonucleotides.

[0130] The sense and antisense strands provided in this application may have the same or different lengths. In some embodiments, the sense or antisense strand has 15-30 nucleotides. In other embodiments, the sense or antisense strand has 19-25 nucleotides. In still other embodiments, the sense or antisense strand has 19-23 nucleotides. The length ratio of the sense and antisense strands of the siRNA provided in this application can be 15 / 15, 16 / 16, 17 / 17, 18 / 18, 19 / 19, 19 / 20, 19 / 21, 19 / 22, 19 / 23, 20 / 19, 20 / 20, 20 / 21, 20 / 22, 20 / 23, 21 / 19, 21 / 20, 21 / 21, 21 / 22, 21 / 23. Examples of possible siRNA length ratios include 22 / 19, 22 / 20, 22 / 21, 22 / 22, 22 / 23, 23 / 19, 23 / 20, 23 / 21, 23 / 22, 23 / 23, 24 / 24, 25 / 25, 26 / 26, 27 / 27, 28 / 28, 29 / 29, 30 / 30, 22 / 24, 22 / 25, 22 / 26, 23 / 24, 23 / 25, or 23 / 26. In some embodiments, the length ratio of the sense strand to the antisense strand of the siRNA is 19 / 19, 21 / 21, 19 / 21, 21 / 23, or 23 / 23, in which case the siRNA of this disclosure exhibits better cellular mRNA silencing activity.

[0131] Studies have found that different modification strategies can have drastically different effects on the stability, bioactivity, and cytotoxicity of siRNA. For example, CN201010106762.1 investigated various chemical modification strategies for siRNA, confirming seven effective modification methods. Compared with unmodified siRNA, one of the modification methods resulted in siRNA that improved blood stability while maintaining inhibitory activity essentially equivalent to that of unmodified siRNA.

[0132] The nucleotides in the siRNA of the present invention are each independently modified or unmodified. In some embodiments, each nucleotide in the siRNA of the present invention is an unmodified nucleotide; in some embodiments, some or all of the nucleotides in the siRNA of the present invention are modified nucleotides, and these modifications on the nucleotide groups do not cause a significant weakening or loss of the function of the siRNA of the present invention in inhibiting TRAF6 gene expression. In some embodiments, the siRNA of this application contains at least one modified nucleotide.

[0133] In the context of this application, the term "modified nucleotide" as used refers to a nucleotide or nucleotide analog formed by replacing the 2' hydroxyl group of the ribosyl group with another group, or a nucleotide having a modified base. The modified nucleotide does not result in a significant reduction or loss of the siRNA's ability to repress gene expression. For example, the modified nucleotide disclosed in JKWatts, GF Deleavey, and MJ Damha, Chemically modified siRNA: tools and applications. Drug Discov Today, 2008, 13(19-20): 842-55 may be selected.

[0134] In some embodiments, at least one nucleotide in the sense strand or antisense strand of the siRNA provided by the present invention is a modified nucleotide, and / or at least one phosphate ester group is a phosphate ester group with a modifying group; in other words, at least a portion of the phosphate ester group and / or ribosome in the phosphate-sugar backbone of at least one single strand of the sense strand and the antisense strand is a phosphate ester group and / or a ribosome with a modifying group. In some embodiments, the phosphate ester group with a modifying group is a thiophosphate ester group formed by replacing an oxygen atom in the phosphodiester bond of the phosphate ester group with a sulfur atom.

[0135] In some embodiments, the 5' terminal nucleotide of the antisense strand is linked to a 5' phosphate group or a 5' phosphate-derived group. In some embodiments, the 5' terminal nucleotide of the antisense strand is not linked to a 5' phosphate group or a 5' phosphate-derived group.

[0136] When the 5' terminal nucleotide of the antisense strand is attached to a 5' phosphate group or a 5' phosphate derivative, the following structure is formed:

[0137] Equation (8) Equation (9) Equation (10).

[0138] Formula (8) shows a structure formed by linking a 5' nucleotide to a 5' phosphate group, Formula (9) shows a structure formed by linking a 5' nucleotide to a 5' phosphate-derived group (EVP), and Formula (10) shows a structure formed by linking a 5' nucleotide to a 5' phosphate-derived group (5' methylene phosphate group). R' is a hydroxyl group or is replaced by various groups known to those skilled in the art. For example, the substituted modified nucleotide can be a 2'-fluoro (2'-F) modified nucleotide, a 2'-alkoxy modified nucleotide, a 2'-substituted alkoxy modified nucleotide, a 2'-alkyl modified nucleotide, a 2'-substituted alkyl modified nucleotide, a 2'-amino modified nucleotide, a 2'-substituted amino modified nucleotide, or a 2'-deoxy modified nucleotide.

[0139] In some embodiments, the 5' terminal nucleotide of the sense or antisense strand is not linked to a 5' phosphate group, a 5' phosphate-derived group, or a reverse debased deoxyribose residue (i.e., the ribose group of the 5' terminal nucleotide of the sense or antisense strand is a 5' hydroxyl group), and its structure is shown below:

[0140] (Formula X)

[0141] Wherein, R is a hydroxyl group or hydrogen, or is substituted by various groups known to those skilled in the art. For example, R can be 2'-fluoro(2'-F), 2'-alkoxy, 2'-substituted alkoxy, 2'-alkyl, 2'-substituted alkyl, 2'-amino, or 2'-substituted amino.

[0142] An exemplary modified nucleotide has the following structure:

[0143] ;

[0144] In this configuration, the hydroxyl group at the 2' position of the ribose group is replaced by R. These hydroxyl groups at the 2' position can be replaced by various groups known to those skilled in the art; for example, the modified nucleotide can be a 2'-fluoro (2'-F) modified nucleotide, a 2'-alkoxy modified nucleotide, a 2'-substituted alkoxy modified nucleotide, a 2'-alkyl modified nucleotide, a 2'-substituted alkyl modified nucleotide, a 2'-amino modified nucleotide, a 2'-substituted amino modified nucleotide, or a 2'-deoxy modified nucleotide.

[0145] In some embodiments, the positive strand may contain one or more capping residues or portions, sometimes referred to in the art as a “cap,” “terminal cap,” or “capping residue.” As used herein, a “capping residue” is a nonnucleotide compound or other portion that may be incorporated at one or more ends of the nucleotide sequence of the siRNA disclosed herein. In some cases, capping residues may provide certain beneficial properties to the siRNA, such as protection against exonuclease degradation. In some embodiments, an inverse debased deoxyribose residue (invAb) is added as a capping residue. In some embodiments, the capping residue appears at the 5' end, the 3' end, or both the 5' and 3' ends of the positive strand.

[0146] In some embodiments, one or more inverse debased deoxyribose residues (invAb) are added to the 3' end of the positive strand. In some embodiments, one or more inverse debased deoxyribose residues (invAb) are added to the 5' end of the positive strand. In some embodiments, one or more inverse debased deoxyribose residues (invAb) are added to both the 5' end and the 3' end of the positive strand. The inverse debased deoxyribose residues may be linked to the terminal nucleotide via a phosphodiester bond, a thiophosphate group, or other nucleoside bonds. When describing modification sites in the modification method, (invAb) is not counted as the first site of the sequence. The chemical structure of the inverse debased deoxyribose residue is shown below:

[0147] Formula C is used when (invAb) is located at the 3' end of the siRNA; Formula B is used when (invAb) is located at the 5' end of the siRNA.

[0148] Formula B Formula C.

[0149] siRNA conjugates

[0150] This application relates to an siRNA conjugate containing the aforementioned siRNA and a conjugate group conjugated to the siRNA.

[0151] In this application, the sense strand and antisense strand of the siRNA conjugate form the double-stranded region of the siRNA conjugate.

[0152] In some preferred embodiments, the siRNA conjugate is obtained by conjugating siRNA with a conjugating group. Specifically, the sense and antisense strands of the siRNA are complementary to form a double-stranded region of the siRNA, and the conjugating group is conjugated to the 3' end of the sense strand to form the siRNA conjugate.

[0153] Generally, the conjugation group comprises at least one pharmaceutically acceptable target group, or further comprises a linker, and the siRNA, the linker, and the target group are sequentially linked. In some embodiments, there are 1-6 target groups. In some embodiments, there are 2-4 target groups. The siRNA molecule can be non-covalently or covalently conjugated to the conjugation group, for example, it can be covalently conjugated to the conjugation group. The conjugation site of the siRNA and the conjugation group can be at the 3' end or 5' end of the siRNA's sense strand, at the 5' end of the antisense strand, or within the siRNA's internal sequence. In some embodiments, the conjugation site of the siRNA and the conjugation group is at the 3' end of the siRNA's sense strand.

[0154] In some embodiments, the conjugate group may be attached to a phosphate group, a 2'-hydroxyl group, or a base of a nucleotide. In some embodiments, the conjugate group may also be attached to a 3'-hydroxyl group, in which case the nucleotides are linked by a 2'-5' phosphodiester bond. When the conjugate group is attached to the end of the siRNA chain, it is typically attached to a phosphate group of the nucleotide; when the conjugate group is attached to the inner sequence of the siRNA, it is typically attached to a ribose ring or a base. Various connection methods can be found in the reference: Muthiah Manoharan et al. siRNA conjugates carrying sequentially assembled trivalent N-acetylgalactosamine linked through nucleosides elicit robust gene silencing in vivo inhepatocytes. ACS Chemical biology, 2015, 10 (5): 1181-7.

[0155] In some embodiments, the siRNA and the conjugate group are linked by acid-labile or reducible chemical bonds. These bonds can degrade in the acidic environment of the endosomes, thus freeing the siRNA. For non-degradable conjugates, the conjugate group can be attached to the positive and negative strands of the siRNA to minimize the impact of the conjugate on the siRNA's activity.

[0156] In some embodiments, the pharmaceutically acceptable targeting group may be a ligand commonly used in the field of siRNA delivery, such as the various ligands described in WO2009082607A2, which are incorporated herein by reference in their entirety.

[0157] In some embodiments, the pharmaceutically acceptable targeting group may be selected from one or more ligands formed from the following targeting molecules or their derivatives: lipophilic molecules, such as cholesterol, bile acids, vitamins (e.g., vitamin E), lipid molecules of different chain lengths; polymers, such as polyethylene glycol; polypeptides, such as transmembrane peptides; aptamers; antibodies; quantum dots; carbohydrates, such as lactose, polylactose, mannose, galactose, N-acetylgalactosamine (GalNAc); folic acid; receptor ligands expressed by hepatocytes, such as desialyl glycoprotein, desialyl sugar residues, lipoproteins (e.g., high-density lipoprotein, low-density lipoprotein, etc.), glucagon, neurotransmitters (e.g., adrenaline), growth factors, transferrin, etc.

[0158] In some embodiments, each ligand is independently selected from a ligand capable of binding to a cell surface receptor. In some embodiments, at least one ligand is capable of binding to a hepatocyte surface receptor. In some embodiments, at least one ligand is capable of binding to a mammalian cell surface receptor. In some embodiments, at least one ligand is capable of binding to a human hepatocyte surface receptor. In some embodiments, at least one ligand is capable of binding to the liver surface desialylate glycoprotein receptor (ASGPR). The types of these ligands are well known to those skilled in the art, and their function is generally to bind to specific receptors on the surface of target cells, mediating the delivery of ligand-linked siRNA to the target cells.

[0159] In some embodiments, the pharmaceutically acceptable targeting group can be any ligand that binds to the desialylate glycoprotein receptor (ASGPR) on the surface of mammalian hepatocytes. In some embodiments, each ligand is independently a desialylate glycoprotein, such as asialolesomucoid (ASOR) or asialofetin (ASF). In some embodiments, the ligand is a sugar or a sugar derivative.

[0160] In some embodiments, at least one ligand is a sugar. In some embodiments, each ligand is a sugar. In some embodiments, at least one ligand is a monosaccharide, polysaccharide, modified monosaccharide, modified polysaccharide, or sugar derivative. In some embodiments, at least one of the ligands may be a monosaccharide, disaccharide, or trisaccharide. In some embodiments, at least one ligand is a modified sugar. In some embodiments, each ligand is a modified sugar. In some embodiments, each ligand is independently selected from polysaccharides, modified polysaccharides, monosaccharides, modified monosaccharides, polysaccharide derivatives, or monosaccharide derivatives. In some embodiments, each or at least one ligand is selected from the group consisting of glucose and its derivatives, mannan and its derivatives, galactose and its derivatives, xylose and its derivatives, ribose and its derivatives, fucose and its derivatives, lactose and its derivatives, maltose and its derivatives, arabinose and its derivatives, fructose and its derivatives, and sialic acid.

[0161] In some embodiments, each of the ligands may be independently selected from D-mannose, L-mannose, D-arabinose, D-xylfuranose, L-xylfuranose, D-glucose, L-glucose, D-galactose, L-galactose, α-D-mannose, β-D-mannose, α-D-mannose, β-D-mannose, α-D-glucose pyranose, β-D-mannose pyranose, α-D-glucose pyranose, β-D-glucose pyranose, β-D-glucose pyranose, α-D-glucose pyranose, β-D-glucose pyranose Sugars, α-D-furanose glucose, β-D-furanose glucose, α-D-furanofructose, α-D-fructose pyranose, α-D-galactopyranose, β-D-galactopyranose, α-D-galactopyranose, β-D-galactopyranose, glucosamine, sialic acid, galactosamine, N-acetylgalactosamine, N-trifluoroacetylgalactosamine, N-propionylgalactosamine, N-butyrylgalactosamine, N-isobutyrylgalactosamine 2-Amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-carboxamido-2,3-di-O-methyl-D-mannpyranose, 2-deoxy-2-sulfonamido-D-glucopyranose, N-ethanolyl-α-neuraminic acid, 5-thio-β-D-glucopyranose, 2, 3,4-Tri-O-acetyl-1-thio-6-O-triphenylmethyl-α-D-glucopyranoside methyl ester, 4-thio-β-D-galactopyranose, 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-glucopyranoside ethyl ester, 2,5-dehydrated-D-aloxonitrile, ribose, D-ribose, D-4-thioribose, L-ribose, or L-4-thioribose. Other options for the ligands may be found, for example, in CN105378082A, which is incorporated herein by reference in its entirety.

[0162] In some embodiments, the pharmaceutically acceptable targeting group in the siRNA conjugate can be galactose or N-acetylgalactosamine, wherein the galactose or N-acetylgalactosamine molecule can be monovalent, divalent, trivalent, or tetravalent. It should be understood that the terms monovalent, divalent, trivalent, and tetravalent refer to the molar ratio of siRNA molecules to galactose or N-acetylgalactosamine molecules in the siRNA conjugate after the siRNA molecule forms a conjugate with a conjugate group containing galactose or N-acetylgalactosamine as a targeting group, respectively, being 1:1, 1:2, 1:3, or 1:4. In some embodiments, the pharmaceutically acceptable targeting group is N-acetylgalactosamine. In some embodiments, when the siRNA described in this application is conjugated with a conjugate group containing N-acetylgalactosamine, the N-acetylgalactosamine molecule is trivalent or tetravalent. In some embodiments, when the siRNA described in this application is conjugated with a conjugating group containing N-acetylgalactosamine, the N-acetylgalactosamine molecule is trivalent.

[0163] The targeting group can be linked to the siRNA molecule via a suitable adapter. Those skilled in the art can select a suitable adapter based on the specific type of the targeting group. For details on these adapters, the types of targeting groups, and the connection methods with siRNA, please refer to the disclosure of WO2015006740A2, which is incorporated herein by reference in its entirety.

[0164] siRNA synthesis methods

[0165] Nucleoside monomers are linked sequentially from 3' to 5' along the nucleotide arrangement using the conventional solid-phase phosphorous amide method. Each linkage of a nucleoside monomer involves four steps: deprotection, coupling, oxidation or sulfidation, and capping. When two nucleotides are linked using a phosphate ester, the linkage of the next nucleoside monomer involves these four steps. When two nucleotides are linked using a thiophosphate ester, the linkage of the next nucleoside monomer involves these four steps. The present invention selects nucleotide monomers based on the target synthetic sequence. The selected nucleotide monomers are those commonly used by those skilled in the art; for example, the nucleotide monomer for synthesizing A can be, but is not limited to, adenosine-3-phosphate. It should be understood that these monomers, when present in oligonucleotides, are linked together via 5'-3' phosphodiester bonds or 5'-3' thiophosphate groups. When, for example, the last nucleotide in the 5'-3' direction has a hydroxyl group at the 3' position, this is achieved using conventional methods in the art.

[0166] For example, the synthesis conditions for the siRNA in this application can be as follows:

[0167] The deprotection conditions included: a reaction temperature of 25°C, a reaction time of 70 seconds, a deprotection reagent selected from a dichloromethane solution of dichloroacetic acid (3% V / V), and a molar ratio of the deprotection reagent to the 4,4'-dimethoxytriphenylmethyl protecting group on the solid support of 5:1.

[0168] The coupling reaction conditions included: a reaction temperature of 25°C, a reaction time of 600 seconds, a coupling reagent selected from a 0.25 M acetonitrile solution of 5-ethylthio-1H-tetrazole (ETT), a molar ratio of nucleic acid sequence to nucleoside monomer linked on the solid-phase support of 1:10, and a molar ratio of nucleic acid sequence to coupling reagent linked on the solid-phase support of 1:65.

[0169] The oxidation reaction conditions included: a reaction temperature of 25°C, a reaction time of 15 seconds, and the oxidizing agent was selected from a 0.05 M tetrahydrofuran solution. The molar ratio of the oxidizing agent to the nucleic acid sequence linked on the solid-phase support in the coupling step was 30:1. The reaction was carried out in a mixed solvent of tetrahydrofuran:water:pyridine = 3:1:1.

[0170] The sulfidation reaction conditions included: a reaction temperature of 25°C, a reaction time of 300 seconds, and the sulfidation reagent was selected from hydroflavin. The molar ratio of the sulfidation reagent to the nucleic acid sequence linked on the solid-phase support in the coupling step was 120:1. The reaction was carried out in a mixed solvent of acetonitrile and pyridine in a ratio of 1:1.

[0171] The capping reaction conditions included: a reaction temperature of 25°C, a reaction time of 15 seconds, and the capping reagent being a mixed solution of CapA (10% acetic anhydride acetonitrile solution) and CapB (10% N-methylimidazolium pyridine / acetonitrile solution) in a molar ratio of 1:1. The molar ratio of the capping reagent to the nucleic acid sequence linked on the solid-phase support was acetic anhydride:N-methylimidazolium:the nucleic acid sequence linked on the solid-phase support was 1:1:1.

[0172] After linking all nucleoside monomers, the nucleic acid sequences linked on the solid-phase support were sequentially subjected to ammonolysis, purification, and desalting to obtain the siRNA sense and antisense strands. Finally, the two strands were heated and annealed to obtain the product.

[0173] Methods for ammonolysis, purification, desalting, and annealing are well known in the art. For example, ammonolysis is performed by contacting the nucleotide sequence linked to a solid-phase support with concentrated ammonia; purification is performed by chromatography; desalting is performed by reversed-phase chromatography; and annealing is performed by gradually cooling after mixing sense and antisense strands in equimolar ratios under different stringent conditions.

[0174] The synthesized siRNAs are shown in Tables 1 and 2.

[0175] siRNA conjugate synthesis method

[0176] Taking the synthesis of L96 as an example:

[0177] The first step involves reacting DMTr-L96 with succinic anhydride to obtain compound L96-A:

[0178]

[0179] Preparation process: DMTr-L96, succinic anhydride, 4-dimethylaminopyridine, and diisopropylethylamine were added to dichloromethane and stirred at 25°C for 24 hours. The reaction solution was then washed with 0.5 M triethylamine phosphate, and the aqueous phase was washed three times with dichloromethane. The combined organic phases were evaporated to dryness under reduced pressure to obtain the crude product. Then, column chromatography was used to purify the product to obtain pure L96-A.

[0180] The second step involves reacting L96-A with NH2-SPS to obtain L96-B:

[0181]

[0182] Preparation process: L96-A, O-benzotriazole-tetramethylurea hexafluorophosphate (HBTU), and diisopropylethylamine (DIPEA) were mixed and dissolved in acetonitrile. The mixture was stirred at room temperature for 5 minutes to obtain a homogeneous solution. Aminomethyl resin (NH2-SPS, 100-200 mesh) was added to the reaction solution, and the reaction was initiated at 25°C on a shaker. After 18 hours of reaction, the mixture was filtered. The filter cake was washed successively with dichloromethane and acetonitrile to obtain the filter cake. The obtained filter cake was subjected to a capping reaction with a CapA / CapB mixed solution to obtain L96-B, which is the solid-phase support containing the conjugated molecules.

[0183] The third step is to prepare siRNA conjugates.

[0184] Using L96-B as a solid-phase carrier, the sense strand of the siRNA conjugate was synthesized according to the siRNA synthesis method described above, and the antisense strand of the siRNA conjugate was synthesized using the same method. Annealing was then performed to generate the siRNA conjugate of this application.

[0185] The synthesized siRNA conjugates are shown in Table 3.

[0186] Pharmaceutical Composition

[0187] This application provides a pharmaceutical composition containing siRNA as an active ingredient and a pharmaceutically acceptable carrier as described above.

[0188] The pharmaceutically acceptable carrier can be a carrier commonly used in the field of siRNA delivery, such as, but not limited to, lipid nanoparticles (LNP), magnetic nanoparticles (e.g., Fe3O4 or Fe2O3-based nanoparticles), carbon nanotubes, mesoporous silicon, calcium phosphate nanoparticles, polyethylenimine (PEI), polyamidoamine (PAMAM) dendrimer, poly(L-lysine) (PLL), chitosan, 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), poly(D&L-lactic / glycolic acid) copolymer (PLGA), and poly(2-aminoethylethylene) phosphate. One or more of the following: phosphate), PPEEA, and poly(2-dimethylaminoethyl methacrylate) (PDMAEMA) and their derivatives.

[0189] The pharmaceutical composition does not have specific requirements for the content of siRNA and pharmaceutically acceptable carriers; the content of each component can be the conventional content.

[0190] In some embodiments, the pharmaceutical composition may also contain other pharmaceutically acceptable excipients, which may be one or more of a variety of formulations or compounds conventionally used in the art. For example, the other pharmaceutically acceptable excipients may include at least one of pH buffers, protectants, and osmotic pressure regulators.

[0191] The pH buffer solution can be a tris(hydroxymethyl)aminomethane hydrochloride buffer with a pH of 7.5-8.5 and / or a phosphate buffer with a pH of 5.5-8.5, for example, a phosphate buffer with a pH of 5.5-8.5.

[0192] The protective agent may be at least one selected from inositol, sorbitol, sucrose, trehalose, mannose, maltose, lactose, and glucose. Based on the total weight of the pharmaceutical composition, the content of the protective agent may be 0.01-30% by weight.

[0193] The osmotic pressure regulator may be sodium chloride and / or potassium chloride. The content of the osmotic pressure regulator results in an osmotic pressure of 200-700 milliosm / kg (mOsm / kg) for the pharmaceutical composition. The content of the osmotic pressure regulator can be readily determined by those skilled in the art based on the desired osmotic pressure.

[0194] In some embodiments, the pharmaceutical composition may be a liquid formulation, such as an injection; or it may be a lyophilized powder for injection, which is mixed with liquid excipients to form a liquid formulation for administration. The liquid formulation may be used, but is not limited to, for subcutaneous, intramuscular, or intravenous administration, or may be administered via a spray to the lungs, or via a spray to other organs or tissues (such as the liver). In some embodiments, the pharmaceutical composition is used for intravenous administration.

[0195] In some embodiments, the pharmaceutical composition may be in the form of a liposomal formulation. In some embodiments, the pharmaceutically acceptable carrier used in the liposomal formulation comprises an amine-containing transfection compound (hereinafter also referred to as an organic amine), a cofactor lipid, and / or a polyethylene glycol-modified lipid.

[0196] The following examples are used to further illustrate the present invention, but do not limit the present invention in any way.

[0197] Example

[0198] Other objects, features, and advantages of this disclosure will become apparent from the following detailed description. However, it should be understood that the detailed description and specific embodiments (although illustrating specific implementations of this disclosure) are given for illustrative purposes only, as various changes and modifications that can be made within the spirit and scope of this disclosure will become apparent to those skilled in the art upon reading this detailed description.

[0199] Unless otherwise specified, the experimental techniques and methods used in this embodiment are conventional techniques and methods. For example, experimental methods in the following embodiments that do not specify specific conditions are generally performed according to conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise specified, the materials and reagents used in the embodiments can be obtained through legitimate commercial channels.

[0200] Example 1: Preparation of siRNA

[0201] siRNA molecules with the sequences shown in Tables 1 and 2 were synthesized by Tianlin Biotechnology (Shanghai) Co., Ltd.

[0202] Table 1 siRNA and its sequence

[0203] siRNA ID Ss: 5'- 3' SEQ ID NO: As: 5' - 3' SEQ ID NO: N-ER-FY048177 GUUACUAUGAGUCUGCUAA 1 UUAGCAGACUCAUAGUAACUU 2 N-ER-FY048177M6 gsusuacuAfuGfAfGfucugcuaa 3 usUfsagcAfgacucauAfgUfaacsusu 4 N-ER-FY048178 UACUAUGAGUCUGCUAAACUA 5 UAGUUUAGCAGACUCAUAGUAAC 6 N-ER-FY048178M6 usascuauGfaGfUfCfugcuaaacua 7 usAfsguuUfagcagacUfcAfuaguasasc 8 N-ER-FY048178M44 usascuAfugaGfUfCfugcuaaacua 9 EVPusAfsguuuAfgcAfgacUfcauaguasasc 10 N-ER-FY048178M45 usascuAfugaGfuCfuGfcuaaacua 11 EVPusAfsguuuAfgcAfgacUfcauaguasasc 10 N-ER-FY048178M46 usascuaugaGfuCfugcuAfaacua 12 EVPusAfsguuuAfgcAfgacUfcauaguasasc 10 N-ER-FY048178M47 usascuAfugaGfuCfuGfcuaaacua 11 <![CDATA[EVPusAfsGfuUf U AfgcAfgAfcUfcauaguasasc]]> 13 N-ER-FY048178M48 usascuAfugaGfuCfuGfcuaaacua 11 EVPusAfsguTuAfgcagdAcUfcauaguasasc 14 N-ER-FY048178M49 (invAb)susacuAfugaGfUfCfugcuaaacuas(invAb) 15 EVPusAfsguuuAfgcAfgacUfcauaguasasc 10 N-ER-FY048178M50 (invAb)susacuAfugaGfUfCfugcuaaacuas(invAb) 15 <![CDATA[EVPusAfsGfuUf U AfgcAfgAfcUfcauaguasasc]]> 13 N-ER-FY048178M51 usascuAfugaGfUfCfugcuaaacuas(invAb) 16 EVPusAfsguuuAfgcAfgacUfcauaguasasc 10 N-ER-FY048179 CUAUGAGUCUGCUAAACUA 17 UAGUUUAGCAGACUCAUAGUA 18 N-ER-FY048179M6 csusaugaGfuCfUfGfcuaaacua 19 usAfsguuUfagcagacUfcAfuagsusa 20 N-ER-FY048005 CUAUGAGUCUGCUAAACUA 17 UAGUUUAGCAGACUCAUAG 21 N-ER-FY048005M6 csusaugaGfuCfUfGfcuaaacua 19 usAfsguuUfagcagacUfcAfuagsTsT 22 N-ER-FY048200 CUGCUAAAAUGGAAACUCA 23 UGAGUUUCCAUUUUAGCAGUC 24 N-ER-FY048200M6 csusgcuaAfaAfUfGfgaaacuca 25 usGfsaguUfuccauuuUfaGfcagsusc 26 N-ER-FY048200M8 csusgcuaAfaAfUfGfgaaacuca 25 EVPusGfsaguUfuccauuUfaGfcagsusc 27 N-ER-FY048200M44 csusGfcuaAfAfAfuggaaacuca 28 EVPusGfsaguuUfccAfuuuUfagcagsusc 29 N-ER-FY048200M45 csusGfcuaAfaAfuGfgaaacuca 30 EVPusGfsaguuUfccAfuuuUfagcagsusc 29 N-ER-FY048200M46 csusgcuaAfaAfuggaAfacuca 31 EVPusGfsaguuUfccAfuuuUfagcagsusc 29 N-ER-FY048200M47 csusGfcuaAfaAfuGfgaaacuca 30 <![CDATA[EVPusGfsAfgUf U UfccAfuUfuUfagcagsusc]]> 32 N-ER-FY048200M48 csusGfcuaAfaAfuGfgaaacuca 30 EVPusGfsagTuUfccauTuUfagcagsusc 33 N-ER-FY048200M49 (invAb)scsuGfcuaAfAfAfuggaaacucas(invAb) 34 EVPusGfsaguuUfccAfuuuUfagcagsusc 29 N-ER-FY048200M50 (invAb)scsuGfcuaAfAfAfuggaaacucas(invAb) 34 <![CDATA[EVPusGfsAfgUf U UfccAfuUfuUfagcagsusc]]> 32 N-ER-FY048200M51 csusGfcuaAfAfAfuggaaacucas(invAb) 35 EVPusGfsaguuUfccAfuuuUfagcagsusc 29 N-ER-FY048203 GAGAAACCUGUUGUGAUUCAU 36 AUGAAUCACACAGGUUUCUCCU 37 N-ER-FY048203M6 gsasgaaaCfcUfGfUfugugauucau 38 asUfsgaaUfcacaacaGfgUfuucucscsu 39 N-ER-FY048203M44 gsasgaAfaccUfGfUfugugauucau 40 EVPasUfsgaauCfacAfacaGfguuucucscsu 41 N-ER-FY048203M45 gsasgaAfaccUfgUfuGfugauucau 42 EVPasUfsgaauCfacAfacaGfguuucucscsu 41 N-ER-FY048203M46 gsasgaaaccUfgUfugugAfuucau 43 EVPasUfsgaauCfacAfacaGfguuucucscsu 41 N-ER-FY048203M47 gsasgaAfaccUfgUfuGfugauucau 42 <![CDATA[EVPasUfsGfaAf U CfacAfaCfaGfguuucucscsu]]> 44 N-ER-FY048203M49 (invAb)sgsagaAfaccUfGfUfugugauucaus(invAb) 45 EVPasUfsgaauCfacAfacaGfguuucucscsu 41 N-ER-FY048203M50 (invAb)sgsagaAfaccUfGfUfugugauucaus(invAb) 45 <![CDATA[EVPasUfsGfaAf U CfacAfaCfaGfguuucucscsu]]> 44 N-ER-FY048203M51 gsasgaAfaccUfGfUfugugauucaus(invAb) 46 EVPasUfsgaauCfacAfacaGfguuucucscsu 41 N-ER-FY048204 GAAACCUGUUGUGAUUCAU 47 AUGAAUCACACAGGUUUCUC 48 N-ER-FY048204M6 gsasaaccUfgUfUfGfugauucau 49 asUfsgaaUfcacaacaGfgUfuucsusc 50 N-ER-FY048073 GAAACCUGUUGUGAUUCAU 47 AUGAAUCACACAGGUUUC 51 N-ER-FY048073M6 gsasaaccUfgUfUfGfugauucau 49 asUfsgaaUfcacaacaGfgUfuucsTsT 52 N-ER-FY048205 AACCUGUUGUGAUUCAAA 53 UUAUGAUCACAACAGGUUUC 54 N-ER-FY048205M6 asasccugUfuGfUfGfauucauaa 55 usUfsaugAfaucacaaCfaGfguususc 56 N-ER-FY048205M8 asasccugUfuGfUfGfauucauaa 55 EVPusUpUpUpCfaGfFollowc 57 N-ER-FY048205M44 basicallyCfcugUfUfGfugauucauaa 58 EVPusExceptionDoordoorCconfigurec 59 N-ER-FY048205M45 basicCfcugUfuGfuGfauucauaa 60 EVPusExceptionDoordoorCconfigurec 59 N-ER-FY048205M46 asasccugUfuEscapeUfcauaa 61 EVPusExceptionDoordoorCconfigurec 59 N-ER-FY048205M47 basicCfcugUfuGfuGfauucauaa 60 <![CDATA[EVPusUfsAfuGf A AfucAfcAfaCfagguususc]]> 62 N-ER-FY048205M48 basicCfcugUfuGfuGfauucauaa 60 EVPusWindowsAccessdAaCfacsusc 63 N-ER-FY048205M49 (invAb) sasaCfcugUfUfGfugaucauaas(invAb) 64 EVPusExceptionDoordoorCconfigurec 59 N-ER-FY048205M50 (invAb) sasaCfcugUfUfGfugaucauaas(invAb) 64 <![CDATA[EVPusUfsAfuGf A AfucAfcAfaCfagguususc]]> 62 N-ER-FY048205M51 asasCfcugUfUfGfugauucauaas(invAb) 65 EVPusExceptionDoordoorCconfigurec 59 N-ER-FY048206 CCUGUGCAUTAGCCCU 66 AGGGCUAUGAAUCAACAGGUU 67 N-ER-FY048206M6 ccsguuGfuGfAfUfucauagcccu 68 asGfsggcUfaugaauucAfcAfacaggsusu 69

[0204] Table 2 siRNA and its sequence

[0205] siRNA ID Ss: 5'- 3' SEQ ID NO: Height: 5' - 3' SEQ ID NO: siRNA 1 UACUAUGACUCUACUACUA 5 WAGUUUAGCACUCAWATER 18 siRNA 2 STRATEGY 23 UGAGUUUCCAUUUAGCAG 70 siRNA 3 ACCEPTANCE 36 AUGAAUCACAGE 48 siRNA 4 ACCURACY 53 UUAUGAAUGAACAGGUU 71

[0206] In this sequence, the uppercase letters “G”, “C”, “A”, “T”, and “U” typically represent nucleotides containing guanine, cytosine, adenine, thymine, and uracil as bases, respectively; the lowercase letters a, u, c, and g indicate nucleotides modified with a 2'-methoxy group; Af, Gf, Cf, and Uf indicate nucleotides modified with a 2'-fluoride group; “dG”, “dC”, and “dA” indicate nucleotides modified with a 2'-deoxy group; when “T” is at the overhang, it indicates thymine ribonucleotide (T); when it is in the double-stranded region of siRNA, it indicates that the uracil ribonucleotide (U) at the corresponding position in the sequence has been replaced with thymine ribonucleotide (T); (invAb) is a reverse debased deoxyribose residue; the lowercase letter s indicates that the two nucleotides adjacent to the letter s on the left and right are linked by a thiophosphate group, or that the nucleotide is linked to (invAb); EVP indicates that the nucleotide adjacent to the right of the EVP is a 5'-trans-vinylphosphonate nucleotide; A , U , C , G (Underlined + Bold + Italic): Indicates GNA-modified nucleotides.

[0207] Tianlin Biotechnology (Shanghai) Co., Ltd. synthesized siRNA conjugates with the sequences shown in Table 3 below:

[0208] Table 3. siRNA conjugates and their sequences:

[0209] siRNA ID Ss: 5′→3′ SEQ ID NO: Ace: 5′→3′ SEQ ID NO: N-ER-FY048178M44L96 usascuAfugaGfUfCfugcuaaacuaL96 76 EVPusAfsguuuAfgcAfgacUfcauaguasasc 10 N-ER-FY048178M45L96 usascuAfugaGfuCfuGfcuaaacuaL96 77 EVPusAfsguuuAfgcAfgacUfcauaguasasc 10 N-ER-FY048178M46L96 usascuaugaGfuCfugcuAfaacuaL96 78 EVPusAfsguuuAfgcAfgacUfcauaguasasc 10 N-ER-FY048178M47L96 usascuAfugaGfuCfuGfcuaaacuaL96 77 <![CDATA[EVPusAfsGfuUf U AfgcAfgAfcUfcauaguasasc]]> 13 N-ER-FY048178M48L96 usascuAfugaGfuCfuGfcuaaacuaL96 77 EVPusAfsguTuAfgcagdAcUfcauaguasasc 14 N-ER-FY048178M49L96 (invAb)susacuAfugaGfUfCfugcuaaacuas(invAb)L96 79 EVPusAfsguuuAfgcAfgacUfcauaguasasc 10 N-ER-FY048178M50L96 (invAb)susacuAfugaGfUfCfugcuaaacuas(invAb)L96 79 <![CDATA[EVPusAfsGfuUf U AfgcAfgAfcUfcauaguasasc]]> 13 N-ER-FY048178M51L96 usascuAfugaGfUfCfugcuaaacuas(invAb)L96 80 EVPusAfsguuuAfgcAfgacUfcauaguasasc 10 N-ER-FY048200M44L96 csusGfcuaAfAfAfuggaaacucaL96 81 EVPusGfsaguuUfccAfuuuUfagcagsusc 29 N-ER-FY048200M45L96 csusGfcuaAfaAfuGfgaaacucaL96 82 EVPusGfsaguuUfccAfuuuUfagcagsusc 29 N-ER-FY048200M46L96 csusgcuaAfaAfuggaAfacucaL96 83 EVPusGfsaguuUfccAfuuuUfagcagsusc 29 N-ER-FY048200M47L96 csusGfcuaAfaAfuGfgaaacucaL96 82 <![CDATA[EVPusGfsAfgUf U UfccAfuUfuUfagcagsusc]]> 32 N-ER-FY048200M48L96 csusGfcuaAfaAfuGfgaaacucaL96 82 EVPusGfsagTuUfccauTuUfagcagsusc 33 N-ER-FY048200M49L96 (invAb)scsuGfcuaAfAfAfuggaaacucas(invAb)L96 84 EVPusGfsaguuUfccAfuuuUfagcagsusc 29 N-ER-FY048200M50L96 (invAb)scsuGfcuaAfAfAfuggaaacucas(invAb)L96 84 <![CDATA[EVPusGfsAfgUf U UfccAfuUfuUfagcagsusc]]> 32 N-ER-FY048200M51L96 csusGfcuaAfAfAfuggaaacucas(invAb)L96 85 EVPusGfsaguuUfccAfuuuUfagcagsusc 29 N-ER-FY048203M44L96 gsasgaAfaccUfGfUfugugauucauL96 86 EVPasUfsgaauCfacAfacaGfguuucucscsu 41 N-ER-FY048203M45L96 gsasgaAfaccUfgUfuGfugauucauL96 87 EVPasUfsgaauCfacAfacaGfguuucucscsu 41 N-ER-FY048203M46L96 gsasgaaaccUfgUfugugAfuucauL96 88 EVPasUfsgaauCfacAfacaGfguuucucscsu 41 N-ER-FY048203M47L96 gsasgaAfaccUfgUfuGfugauucauL96 87 <![CDATA[EVPasUfsGfaAf U CfacAfaCfaGfguuucucscsu]]> 44 N-ER-FY048203M49L96 (invAb)sgsagaAfaccUfGfUfugugauucaus(invAb)L96 89 EVPasUfsgaauCfacAfacaGfguuucucscsu 41 N-ER-FY048203M50L96 (invAb)sgsagaAfaccUfGfUfugugauucaus(invAb)L96 89 <![CDATA[EVPasUfsGfaAf U CfacAfaCfaGfguuucucscsu]]> 44 N-ER-FY048203M51L96 gsasgaAfaccUfGfUfugugauucaus(invAb)L96 90 EVPasUfsgaauCfacAfacaGfguuucucscsu 41 N-ER-FY048205M44L96 basisCfcugUfUfGfugauucauaaL96 91 EVPusUfsaugaAfucAfcaaCfagguususc 59 N-ER-FY048205M45L96 asasCfcugUfuGfuGfauucauaaL96 92 EVPusUfsaugaAfucAfcaaCfagguususc 59 N-ER-FY048205M46L96 asasccugUfuGfugauUfcauaaL96 93 EVPusUfsaugaAfucAfcaaCfagguususc 59 N-ER-FY048205M47L96 asasCfcugUfuGfuGfauucauaaL96 92 <![CDATA[EVPusUfsAfuGf A AfucAfcAfaCfagguususc]]> 62 N-ER-FY048205M48L96 asasCfcugUfuGfuGfauucauaaL96 92 EVPusUfsaudGaAfucacdAaCfagguususc 63 N-ER-FY048205M49L96 (invAb)sasaCfcugUfUfGfugauucauaas(invAb)L96 94 EVPusUfsaugaAfucAfcaaCfagguususc 59 N-ER-FY048205M50L96 (invAb)sasaCfcugUfUfGfugauucauaas(invAb)L96 94 <![CDATA[EVPusUfsAfuGf A AfucAfcAfaCfagguususc]]> 62 N-ER-FY048205M51L96 asasCfcugUfUfGfugauucauaas(invAb)L96 95 EVPusUfsaugaAfucAfcaaCfagguususc 59

[0210] Among them, L96 is connected to the 3' end of the positive chain in Table 1 via a phosphodiester bond to obtain the conjugate shown in Table 3. L96 is:

[0211]

[0212] In Tables 1, 2, and 3, if the left side of the 5' terminal nucleotide of the positive strand, the modified positive strand, and the modified positive strand with the connecting conjugate group is not marked with EVP or (invAb), it means that the ribosome group of the 5' terminal nucleotide is 5' hydroxyl, and its structure is shown in Formula X:

[0213] (Formula X)

[0214] Wherein, Base represents a base, such as A, U, G, C or T; R is a hydroxyl group or hydrogen or is substituted by various groups known to those skilled in the art, for example, R can be 2'-fluoro (2'-F), 2'-alkoxy, 2'-substituted alkoxy, 2'-alkyl, 2'-substituted alkyl, 2'-amino, 2'-substituted amino.

[0215] In Tables 1 and 2, if the left side of the 5' terminal nucleotide of the antisense strand and the modified antisense strand is not marked with EVP, it means that the ribosome group of the 5' terminal nucleotide is 5' hydroxyl, and its structure is as shown in Formula X.

[0216] In Tables 1 and 2, when the 3' ends of the sense strand and the modified sense strand are not connected (invAb), the 3' position of the nucleotide at the 3' end of the sense strand and the modified sense strand is a hydroxyl group. In Tables 1, 2 and 3, the 3' position of the nucleotide at the 3' end of the antisense strand and the modified antisense strand is a hydroxyl group.

[0217] Example 2: siRNA inhibits TRAF6 gene expression

[0218] 2.1 Experimental Materials:

[0219] Huh7 cells were purchased from the Cell Bank of the Chinese Academy of Sciences, catalog number SCSP-526.

[0220] RNA Extraction Kit, catalog number QIAGEN-74106;

[0221] Lipo® RNAiMAX transfection reagent, purchased from Invitrogen, catalog number 13778150;

[0222] FastStart Universal Probe Master, purchased from Roche, item number 04914058001;

[0223] FastKing RT Kit (with gDNase), purchased from TIANGEN, item number KR11602;

[0224] FBS, purchased from Gibco, item number 10099141;

[0225] Opti-medium: serum-reduced culture medium, purchased from Gibco, catalog number 31985070;

[0226] DMEM, purchased from Gibco, item number 11965118;

[0227] RPMI 1640 Medium, purchased from Gibco, item number 11875093;

[0228] TRAF6 probe, purchased from Taqman, part number Hs00371512_g1;

[0229] GAPDH probe, purchased from Thermo, part number Hs99999905_m1.

[0230] 2.2 Experimental Methods:

[0231] 2.2.1 Cells were seeded in DMEM medium in 96-well plates and cultured for 24 hours. The cultured cells were then resuspended in 10% FBBS-RPMI 1640 Medium to a density of 2.22 × 10⁻⁶ cells / well. 5 A 90 μL / well cell suspension was spread into each well of a 96-well plate, resulting in 20,000 cells per well.

[0232] 2.2.2 The dry powder of the siRNA to be tested and the siRNA conjugate (for ease of description, it is collectively referred to as siRNA in the experimental process description of this embodiment) was centrifuged at low temperature and high speed, and then dissolved in ultrapure distilled water to prepare a 100 μM siRNA stock solution.

[0233] 2.2.3 Prepare 0.1 nM siRNA transfection dilution buffer

[0234] (1) Preparation of 0.1 μM siRNA stock solution:

[0235] a. Take 2 μL of the 100 μM siRNA stock solution obtained in step 2.2.2 above, add 18 μL of ultrapure distilled water to obtain a siRNA dilution solution with a final concentration of 10 μM.

[0236] b. Take 2 μL of the 10 μM siRNA dilution obtained in step a, add 18 μL of ultrapure distilled water to obtain a final concentration of 1 μM siRNA dilution.

[0237] c. Take 2 μL of the 1 μM siRNA dilution solution obtained in step b, add 18 μL of ultrapure distilled water to obtain a stock solution with a final concentration of 0.1 μM siRNA.

[0238] d. Take 2 μL of the 0.1 μM siRNA stock solution obtained in step c, add 18 μL of ultrapure distilled water to obtain a final concentration of 0.01 μM siRNA stock solution;

[0239] (2) Take 10 μL of the 0.01 μM siRNA stock solution prepared in step (1) and add 90 μL of Opti-medium to obtain a 1 nM siRNA dilution solution;

[0240] (3) Take 3 μL of Lipo® RNAiMAX transfection reagent and add 97 μL of Opti-medium to obtain Lipo® RNAiMAX transfection reagent dilution; mix Lipo® RNAiMAX transfection reagent dilution with 1 nM siRNA dilution at a volume ratio of 1:1, let stand for 5 minutes, and add 20 μL of transfection mixture to a 96-well plate to transfect the cultured Huh7 cells (final volume 100 μL, the concentration of siRNA in this system is 0.1 nM).

[0241] A 1 nM siRNA transfection dilution can be prepared using a similar procedure as described above.

[0242] 2.2.4 After transfection, culture for 48 hours, with two replicates for each concentration.

[0243] 2.2.5 Extract total RNA according to the RNA extraction kit instructions:

[0244] 2.2.6 The extracted total RNA was reverse transcribed into cDNA using a reverse transcription kit, following these steps:

[0245] a) Remove gDNA using gDNAase according to Table 4;

[0246] Table 4

[0247] Volume / μL 5×gDNA wiper Mix 2 RNase-free water 8

[0248] 42°C, 2 min;

[0249] b) Perform the reverse transcription procedure as described in Table 5 below.

[0250] Table 5

[0251] Volume / μL 10×RT Mix 2 HiScript Ⅲ Enzyme Mix 2 <![CDATA[Oligo(dT) 20 VN]]> 1 Random hexamers 1 RNase-free water 4

[0252] 50°C, 15 min; 85°C, 5 s.

[0253] c) Store the reverse transcription product at 4°C for real-time PCR analysis.

[0254] 2.2.7 Perform real-time PCR analysis

[0255] a) Prepare the qPCR reaction mixture as shown in Tables 6 and 7 below. Throughout the entire process, all reagents should be kept on ice.

[0256] Table 6

[0257] Volume / μL 2×TaqMan® Fast Advanced Master Mix 5 20×TRAF6 Probe 0.5 cDNA template 4.5

[0258] Table 7

[0259] Volume / μL 2×TaqMan® Fast Advanced Master Mix 5 20×GAPDH Probe 0.5 cDNA template 4.5

[0260] b) Perform the qPCR procedure as described below.

[0261] 50°C, 2 minutes; 95°C, 10 minutes;

[0262] 95°C, 15 seconds, 60°C, 1 minute (this operation is repeated 40 times);

[0263] 2.2.8 Results Analysis

[0264] a) Use Quant Studio 6 Flex software with default settings to automatically calculate the Ct value;

[0265] b) Calculate the relative expression level of the gene using the following formula:

[0266] ΔCt = Ct (TRAF6 gene) –Ct (GAPDH)

[0267] ΔCt = ΔCt (sample group) - ΔCt (mock group)

[0268] mRNA expression relative to the Mock group = 2 -ΔΔCt .

[0269] The Mock group indicates that the group without siRNA was compared to the test sample group.

[0270] Inhibition rate (%) = (Relative expression level of mRNA in the Mock group - Relative expression level of mRNA in the test sample group) / Relative expression level of mRNA in the Mock group × 100%

[0271] 2.3 Results of the Silence Experiment

[0272] The concentrations of 0.1 nM and 1 nM were selected for testing, and the results are shown in Table 8.

[0273] Table 8. Inhibition rate of the siRNA of the present invention

[0274] siRNA ID 1 nM - 48 h (%) 0.1 nM - 48 h (%) siRNA ID 1 nM - 48 h (%) 0.1 nM - 48 h (%) N-ER-FY048177 42.31 28.58 N-ER-FY048203 69.80 69.50 N-ER-FY048177M6 19.97 12.21 N-ER-FY048203M6 81.26 39.20 N-ER-FY048178 69.96 66.28 N-ER-FY048203M44 74.90 73.71 N-ER-FY048178M6 70.90 59.76 N-ER-FY048203M45 72.54 58.41 N-ER-FY048178M44 77.23 74.02 N-ER-FY048203M46 69.34 67.52 N-ER-FY048178M45 78.49 73.46 N-ER-FY048203M47 76.56 68.55 N-ER-FY048178M46 78.52 70.12 N-ER-FY048203M49 70.76 67.86 N-ER-FY048178M47 75.98 65.41 N-ER-FY048203M50 81.00 71.93 N-ER-FY048178M48 78.94 71.10 N-ER-FY048203M51 73.81 67.86 N-ER-FY048178M49 70.55 68.05 N-ER-FY048204 68.79 68.65 N-ER-FY048178M50 75.94 67.13 N-ER-FY048204M6 61.44 16.49 N-ER-FY048178M51 81.96 77.90 N-ER-FY048073 58.25 54.82 N-ER-FY048179 69.92 69.91 N-ER-FY048073M6 76.49 57.60 N-ER-FY048179M6 67.89 63.84 N-ER-FY048205 72.47 53.85 N-ER-FY048005 71.99 57.63 N-ER-FY048205M6 74.11 53.18 N-ER-FY048005M6 82.15 76.45 N-ER-FY048205M8 71.66 69.74 N-ER-FY048200 74.50 60.51 N-ER-FY048205M44 73.40 67.70 N-ER-FY048200M6 71.39 31.93 N-ER-FY048205M45 69.12 69.11 N-ER-FY048200M8 78.54 74.81 N-ER-FY048205M46 73.36 63.03 N-ER-FY048200M44 81.86 75.06 N-ER-FY048205M47 74.57 64.60 N-ER-FY048200M45 76.69 75.52 N-ER-FY048205M48 80.71 75.82 N-ER-FY048200M46 83.73 76.21 N-ER-FY048205M49 74.76 73.31 N-ER-FY048200M47 73.38 67.84 N-ER-FY048205M50 69.32 66.87 N-ER-FY048200M48 75.21 75.00 N-ER-FY048205M51 70.91 64.07 N-ER-FY048200M49 82.55 77.06 N-ER-FY048206 53.62 48.19 N-ER-FY048200M50 80.82 79.02 N-ER-FY048206M6 67.28 20.24 N-ER-FY048200M51 84.17 65.91

[0275] Table 9 Inhibition rate of the siRNA conjugate of the present invention

[0276] siRNA ID 1 nM-48 h(%) 0.1 nM-48 h(%) siRNA ID 1 nM-48 h(%) 0.1 nM-48 h(%) N-ER-FY048178M44L96 79.22 70.81 N-ER-FY048203M44L96 72.99 69.88 N-ER-FY048178M45L96 75.04 74.92 N-ER-FY048203M45L96 67.88 56.70 N-ER-FY048178M46L96 81.25 73.97 N-ER-FY048203M46L96 73.97 59.93 N-ER-FY048178M47L96 75.20 71.92 N-ER-FY048203M47L96 73.67 71.72 N-ER-FY048178M48L96 76.74 75.50 N-ER-FY048203M49L96 75.27 73.76 N-ER-FY048178M49L96 78.22 74.23 N-ER-FY048203M50L96 73.95 73.55 N-ER-FY048178M50L96 75.19 74.15 N-ER-FY048203M51L96 71.65 71.14 N-ER-FY048178M51L96 56.15 54.93 N-ER-FY048205M44L96 64.24 58.76 N-ER-FY048200M44L96 75.63 74.42 N-ER-FY048205M45L96 66.88 63.34 N-ER-FY048200M45L96 80.07 72.15 N-ER-FY048205M46L96 72.15 71.70 N-ER-FY048200M46L96 77.48 76.99 N-ER-FY048205M47L96 71.25 65.23 N-ER-FY048200M47L96 81.74 69.78 N-ER-FY048205M48L96 72.83 66.99 N-ER-FY048200M48L96 78.05 69.11 N-ER-FY048205M49L96 72.57 70.86 N-ER-FY048200M49L96 81.18 79.03 N-ER-FY048205M50L96 67.62 62.94 N-ER-FY048200M50L96 82.55 76.66 N-ER-FY048205M51L96 66.59 50.23 N-ER-FY048200M51L96 75.04 72.27

[0277] As can be seen from Tables 8 and 9, the siRNA and siRNA conjugate of the present invention can significantly inhibit the expression of the TRAF6 gene at both 1 nM and 0.1 nM.

[0278] Example 3: In vitro stability test of rat liver homogenate

[0279] 3.1 Experimental reagents and consumables

[0280] Information on the names of the reagents used in this embodiment is shown in Table 10.

[0281] Table 10 Reagent information used in this embodiment

[0282] Reagent Name brand Item number / CAS number <![CDATA[1 M MgCl2]]> Beyotime ST269 ammonium bicarbonate Tianjin Guangfu Fine Chemical GB663-78 Sodium dihydrogen phosphate Tianjin Guangfu Fine Chemical GB / T1267-1999 Sodium hydrogen phosphate Tianjin Guangfu Fine Chemical 10039-32-4 Acetonitrile Honeywell AH015-4HC methanol Honeywell AH230-4HC 0.5 M EDTA Beyotime ST066

[0283] 3.2 Experimental Procedure

[0284] 3.2.1 Preparation of liver homogenate

[0285] 3.2.1.1 Preparation of grinding fluid

[0286] The grinding slurry used in this embodiment was prepared as follows: 1 mL of 5 mM EDTA solution, 1 mL of 100 mM magnesium chloride solution, and 98 mL of purified water were mixed thoroughly and the pH was adjusted to 6.0. The 5 mM EDTA solution was prepared by adding 1 mL of 0.5 M EDTA to a 100 mL volumetric flask, diluting to the mark with purified water, and mixing well. The 100 mM magnesium chloride solution was prepared by adding 1 mL of 1 M magnesium chloride to a 10 mL volumetric flask, diluting to the mark with purified water, and mixing well.

[0287] 3.2.1.2 Tissue homogenization

[0288] Rat liver tissue (collected from SD rats, purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd.) was mixed with homogenizing solution at a ratio of 100 mg: 5 mL to prepare liver homogenate (concentration of 20 mg / mL). After preparation, the homogenate was added to a homogenizer and the homogenization parameters were set as follows: running speed 60 Hz; running time 30 s; pause time 15 s; number of runs 4; running temperature -20℃.

[0289] 3.2.2 Sample Preparation

[0290] The siRNA conjugate sample was prepared into a 1 mg / mL solution using enzyme-free water and set aside for use. The internal standard sample was prepared into a 0.2 mg / mL solution using enzyme-free water.

[0291] 3.2.3 Incubation of biological samples

[0292] (1) Add 250 μL of the prepared liver homogenate to a 2 mL enzyme-free tube.

[0293] (2) Add 50 μL of siRNA conjugate sample solution based on step (1);

[0294] (3) The system is a 300 μL biological sample solution, vortexed, and allowed to stand for 5 min;

[0295] (4) Divide into 2 tubes, each containing 100 μL;

[0296] (5) The system was incubated at 37°C for 48 h.

[0297] 3.2.4 Biological Sample Processing

[0298] Vortex each 100 μL biological sample system, mix well, add 300 μL of Clarity OTX lysis buffer (ClarityOTX Lysis-loading Buffer, purchased from Agilent-FinnoMed, catalog number AL0-8579), vortex, let stand for 30 min, add 100 μL of internal standard solution, vortex, let stand for 5 min, centrifuge for 1 min, and set aside for use (total sample volume approximately 500 μL).

[0299] 3.2.5 Solid-phase extraction:

[0300] (1) Preparation of solid phase extraction reagent

[0301] Activator: Add 200 mL of methanol to the mobile phase bottle and label it as activator;

[0302] Equilibrium buffer: Prepare 1 M phosphate buffer solution [877 mL sodium dihydrogen phosphate (1.56 g / L) + 123 mL disodium hydrogen phosphate (3.58 g / L)], dilute 100 times, adjust pH to 5.5 with phosphate, mix well, and label as equilibrium buffer;

[0303] Rinse solution: Take 500 mL of equilibrium solution into a 1 L mobile phase bottle, add 500 mL of acetonitrile, adjust the pH to 5.5 with phosphoric acid, mix well, and label as rinsing solution;

[0304] Eluent: Weigh 7.9 g of ammonium bicarbonate into a 1 L mobile phase bottle, add 1 L of water, adjust the pH to 9 using sodium hydroxide, take 500 mL of ammonium bicarbonate solution into a 1 L mobile phase bottle, add 500 mL of acetonitrile, mix well, and label as eluent;

[0305] (2) The extraction steps are shown in Table 11 below:

[0306] Table 11 Extraction Step Information

[0307] step process Equilibrium time activation 1 mL of the activator in step (1) above 10 min balance 2 × 1 mL of the equilibration solution from step (1) above 10 minutes each time Sample A biological sample of a certain volume (4 / 5 of the total volume) 10 min rinse 2 × 1 mL of the equilibration solution from step (1) above; 4 × 1 mL of the rinsing solution from step (1) above. 10 minutes each time Washout 3 × 0.75 mL of the eluent from step (1) above 20 minutes each time

[0308] 3.2.6 Post-processing

[0309] Take the eluent (600 μL in three portions, totaling 1800 μL) and place it in a 2 mL EP tube. Concentrate under vacuum for 10 hours at 1800 rpm. Reconstitute the concentrated sample with 100 μL of mobile phase (initial ratio), centrifuge at 12000 rpm for 20 min at 15°C, and inject 10 μL of the supernatant into a high-resolution mass spectrometer. The antisense strand ratio of the siRNA conjugate in this application was semi-quantitatively determined using LC-MS / MS. The calculation formula is: AS remaining percentage = AS MS intensity The sum of / AS chains and all related degradation products MS intensity ×100%, where MS intensity is the mass spectrometry intensity signal value. The metabolic results after in vitro incubation in rat liver homogenate for 48 hours are shown in Table 12.

[0310] Table 12. Remaining percentage of antisense strand in siRNA conjugates (AS%)

[0311] siRNA ID AS% N-ER-FY048178M45L96 98.45 N-ER-FY048178M49L96 98.75 N-ER-FY048178M51L96 98.54 N-ER-FY048200M49L96 97.45 N-ER-FY048203M49L96 97.78 N-ER-FY048205M49L96 96.19

[0312] Where AS represents the antisense strand of the siRNA conjugate, a higher percentage of remaining AS indicates better drug stability and longer-lasting effect. Table 12 shows that the siRNA conjugate of this invention exhibits excellent in vitro stability in rat liver homogenate.

[0313] Example 4: Silent effect of siRNA conjugate in mice expressing the human TRAF6 (hTRAF6) gene

[0314] (1) AAV was used to construct a mouse model overexpressing the hTRAF6 gene.

[0315] Six- to eight-week-old male C57BL / 6 mice (provided by Beijing Vital River Laboratory Animal Technology Co., Ltd.) were introduced into the facility. After 3-5 days of acclimatization feeding, a single intravenous injection of adeno-associated virus (AAV) containing the hTRAF6 gene (pAAV[Exp]-CBh>{TNFRAF6 5'UTR+CDS}:T2A:SEAP, virus provided by Yunzhou Biotechnology (Guangzhou) Co., Ltd.) was administered via tail vein to induce target gene overexpression. The injection dose was 10 × 10⁻⁶. 11 vg / animal, injection volume of 100 μL / animal, followed by feeding with normal feed.

[0316] (2) Efficacy study of siRNA silencing in hTRAF6 mouse model

[0317] Fourteen days after AAV virus injection, mice were divided into groups of five. Mice were subcutaneously administered a single 6 mg / kg dose of the siRNA conjugate described in this application at a volume of 5 μL / g in RNase-free sterile PBS. The control group received the same volume of RNase-free sterile PBS. Serum was collected from mice at the times listed in Table 13 after administration. The serum solution was stored at -80°C. For testing, the mice were thawed on ice, centrifuged, and the supernatant was used for protein content analysis. SEAP protein expression (reflecting hTRAF6 protein expression) was detected using the Phospha-Light™ SEAP reporter gene assay system (Invitrogen™, Thermo Fisher Scientific, catalog number T1017). The inhibition rate (%) of the siRNA conjugate in mice expressing the human TRAF6 (hTRAF6) gene was calculated according to the formula: inhibition rate % = (1 - mean protein expression in the treated group / mean protein expression in the control group) × 100%. The results are shown in Table 13.

[0318] Table 13. In vivo inhibition rate (%) of siRNA conjugates against hTRAF6

[0319] siRNA ID D14 D28 D42 N-ER-FY048178M45L96 65.87 63.45 53.25 N-ER-FY048178M49L96 76.82 72.36 71.17 N-ER-FY048200M49L96 55.92 51.43 54.37 N-ER-FY048203M49L96 61.42 63.95 49.86 N-ER-FY048205M49L96 55.52 43.21 --

[0320] Note: "--" indicates that the inhibition rate on day D28 was lower than the expected efficacy level (less than 50%), so testing was not continued; D represents the number of days, for example, D14 represents day 14.

[0321] To further verify whether the siRNA conjugate of this application can maintain a high in vivo inhibition rate over a long period of time, the group treated with N-ER-FY048178M49L96 was sampled again after day 42 according to the time listed in Table 14. It was found that the siRNA conjugate maintained a high in vivo inhibition rate for up to 84 days. The specific data are shown in Table 14.

[0322] Table 14. In vivo inhibition rate (%) of hTRAF6 by siRNA conjugate N-ER-FY048178M49L96

[0323] siRNA ID D56 D70 D84 N-ER-FY048178M49L96 68.41 65.27 60.02

[0324] As can be seen from Tables 13 and 14, the siRNA conjugate of this application has high inhibitory activity against the hTRAF6 gene in vivo, and can reduce the expression level of hTRAF6 for a long time, thus exhibiting long-lasting effects.

[0325] Example 5: Silent effect of siRNA conjugate in mice expressing the human TRAF6 (hTRAF6) gene.

[0326] Following the methods and conditions described in Example 4, the in vivo inhibition rate of three siRNA conjugates—N-ER-FY048200M51L96, N-ER-FY048203M51L96, and N-ER-FY048178M51L96—on hTRAF6 was tested. The results also showed that N-ER-FY048200M51L96, N-ER-FY048203M51L96, and N-ER-FY048178M51L96 all exhibited high inhibitory activity against the hTRAF6 gene and could reduce hTRAF6 expression levels for a relatively long period, demonstrating long-lasting effects.

Claims

1. A siRNA for inhibiting TRAF6 gene expression, the siRNA comprising a sense strand and an antisense strand, wherein each nucleotide in the siRNA is independently modified or unmodified, wherein the sense strand contains nucleotide sequence I, the antisense strand contains nucleotide sequence II, wherein nucleotide sequence I and nucleotide sequence II are at least partially anticomplementary to form a double-stranded region, wherein nucleotide sequence I and nucleotide sequence II are selected from the following sequences: (1) The nucleotide sequence I comprises the nucleotide sequence shown in SEQ ID NO: 72, and the nucleotide sequence II comprises the nucleotide sequence shown in SEQ ID NO: 73: 5'- CUAUGAGUCUGCUAA-3' (SEQ ID NO: 72) 5'-UUAGCAGACUCAUAG-3' (SEQ ID NO: 73); (2) The nucleotide sequence I comprises the nucleotide sequence shown in SEQ ID NO: 74, and the nucleotide sequence II comprises the nucleotide sequence shown in SEQ ID NO: 75: 5'- CCUGUUGUGAUUCAU-3' (SEQ ID NO: 74) 5'-AUGAAUCACAACAGG-3' (SEQ ID NO: 75); (3) The nucleotide sequence I comprises the nucleotide sequence shown in SEQ ID NO: 23, and the nucleotide sequence II comprises the nucleotide sequence shown in SEQ ID NO:

24.

2. The siRNA according to claim 1, wherein the nucleotide sequence I and the nucleotide sequence II are substantially anticomplementary, substantially anticomplementary, or completely anticomplementary; substantially anticomplementary means that there are no more than 3 base mismatches between the two nucleotide sequences; substantially anticomplementary means that there are no more than 1 base mismatch between the two nucleotide sequences; completely anticomplementary means that there are no mismatches between the two nucleotide sequences.

3. The siRNA according to claim 1 or 2, wherein the sense strand further comprises nucleotide sequence III, and the antisense strand further comprises nucleotide sequence IV, wherein nucleotide sequence III and nucleotide sequence IV are each independently 0-6 nucleotides in length, wherein nucleotide sequence III is attached to the 5' end of nucleotide sequence I, and nucleotide sequence IV is attached to the 3' end of nucleotide sequence II, wherein nucleotide sequence III and nucleotide sequence IV are of equal length and substantially anticomplementary or completely anticomplementary; and / or, wherein nucleotide sequence III is attached to the 3' end of nucleotide sequence I, and nucleotide sequence IV is attached to the 5' end of nucleotide sequence II, wherein nucleotide sequence III and nucleotide sequence IV are of equal length and substantially anticomplementary or completely anticomplementary.

4. The siRNA according to any one of claims 1-3, wherein the siRNA comprises a sense strand and an antisense strand, wherein each nucleotide in the siRNA is independently modified or unmodified, wherein the sense strand contains nucleotide sequences I and III, and the antisense strand contains nucleotide sequences II and IV, wherein nucleotide sequences I and III are at least partially anticomplementary to nucleotide sequences II and IV to form a double-stranded region, wherein nucleotide sequences I and III, and nucleotide sequences II and IV are selected from the following sequences: (1) The nucleotide sequences I and III comprise or consist of the nucleotide sequences shown in SEQ ID NO: 5, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequences shown in SEQ ID NO: 18; (2) The nucleotide sequences I and III comprise or consist of the nucleotide sequences shown in SEQ ID NO: 23, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequences shown in SEQ ID NO: 70; (3) The nucleotide sequences I and III comprise or consist of the nucleotide sequences shown in SEQ ID NO: 36, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequences shown in SEQ ID NO: 48; (4) The nucleotide sequences I and III comprise or consist of the nucleotide sequences shown in SEQ ID NO: 53, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequences shown in SEQ ID NO:

71.

5. The siRNA according to any one of claims 1-4, wherein the sense strand further comprises nucleotide sequence V and / or the antisense strand further comprises nucleotide sequence VI, wherein nucleotide sequences V and VI are each independently 0 to 3 nucleotides in length, wherein nucleotide sequence V is attached to the 3' end of the sense strand to form a 3' overhang of the sense strand and / or nucleotide sequence VI is attached to the 3' end of the antisense strand to form a 3' overhang of the antisense strand; preferably, the length of nucleotide sequence V or VI is 2 nucleotides, wherein, The nucleotide sequence V is identical to or differs from the nucleotide at the corresponding position of the target mRNA, or the nucleotide sequence VI is mismatched or complementary to the nucleotide at the corresponding position of the target mRNA.

6. The siRNA according to any one of claims 1-5, wherein the length of the double-stranded region is 15-30 nucleotide pairs; preferably, the length of the double-stranded region is 17-23 nucleotide pairs; more preferably, the length of the double-stranded region is 19-21 nucleotide pairs.

7. The siRNA according to any one of claims 1-6, wherein the sense strand or antisense strand has 15-30 nucleotides; preferably, the sense strand or antisense strand has 19-25 nucleotides; more preferably, the sense strand or antisense strand has 19-23 nucleotides.

8. The siRNA according to any one of claims 1-7, wherein at least one nucleotide in the sense strand or the antisense strand is a modified nucleotide, and / or at least one phosphate ester group is a phosphate ester group having a modifying group; preferably, the phosphate ester group having a modifying group is a thiophosphate ester group formed by replacing an oxygen atom in the phosphodiester bond of the phosphate ester group with a sulfur atom.

9. The siRNA according to any one of claims 1-8, wherein, The 5' terminal nucleotide of the antisense strand is connected to a 5' phosphate-derived group or a 5' phosphate group, or the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate-derived group or a 5' phosphate group.

10. The siRNA according to any one of claims 1-9, wherein, The 5' terminal nucleotide of the positive strand is linked to a reverse debased deoxyribose residue, and / or the 3' terminal nucleotide of the positive strand is linked to a reverse debased deoxyribose residue.

11. The siRNA according to any one of claims 1-10, wherein the modified nucleotide is selected from 2'-fluoro-modified nucleotides, 2'-alkoxy-modified nucleotides, 2'-substituted alkoxy-modified nucleotides, 2'-alkyl-modified nucleotides, 2'-substituted alkyl-modified nucleotides, 2'-deoxy-modified nucleotides, 2'-amino-modified nucleotides, 2'-substituted amino-modified nucleotides, nucleotide analogs, or any combination of two or more thereof; preferably, the modified nucleotide is selected from 2'-F-modified nucleotides, 2'-O-CH3-modified nucleotides, 2'-O-CH2-CH2-O-CH3-modified nucleotides, 2'-O-CH2-CH=CH2-modified nucleotides, 2'-CH2-CH2-CH=CH2-modified nucleotides, 2'-deoxy-modified nucleotides, nucleotide analogs, or any combination of two or more thereof.

12. The siRNA according to any one of claims 1-11, wherein each nucleotide in the sense strand and the antisense strand is independently a 2'-fluoro-modified nucleotide or a non-fluoro-modified nucleotide; Preferably, in the positive strand, 2'-fluorinated nucleotides are located at positions 7, 9, 10, and 11 along the 5' to 3' direction, with the remaining positions being non-fluorinated nucleotides; or, 2'-fluorinated nucleotides are located at positions 11, 12, 13, and 17 along the 3' to 5' direction, with the remaining positions being non-fluorinated nucleotides; or, 2'-fluorinated nucleotides are located at positions 9, 11, 13, and 17 along the 3' to 5' direction, with the remaining positions being non-fluorinated nucleotides; or, 2'-fluorinated nucleotides are located at positions 6, 11, and 13 along the 3' to 5' direction, with the remaining positions being non-fluorinated nucleotides; and / or In the antisense strand, 2'-fluorinated nucleotides are located at positions 2, 6, 14, and 16 in the 5' to 3' direction, with the remaining positions being non-fluorinated nucleotides; or, 2'-fluorinated nucleotides are located at positions 2, 7, 10, and 14, with the remaining positions being non-fluorinated nucleotides; or, 2'-fluorinated nucleotides are located at positions 2, 3, 5, 7, 10, 12, and 14, with the remaining positions being non-fluorinated nucleotides; or, 2'-fluorinated nucleotides are located at positions 2, 7, and 14, with the remaining positions being non-fluorinated nucleotides.

13. The siRNA of claim 12, wherein each non-fluorinated modified nucleotide is independently selected from a nucleotide or nucleotide analog formed by replacing the hydroxyl group at the 2' position of the ribosyl group of the nucleotide with a non-fluorinated group, said nucleotide analog being selected from pseudouracil, isonucleotide, LNA, ENA, cET BNA, UNA, and GNA.

14. The siRNA according to any one of claims 1-13, wherein each nucleotide in the sense strand and the antisense strand is independently a 2'-fluoro-modified nucleotide, a 2'-methoxy-modified nucleotide, a GNA-modified nucleotide, a 2'-deoxy-modified nucleotide, or any combination of two or more thereof. Preferably, in the positive strand, 2'-fluoromodified nucleotides are located at positions 7, 9, 10, and 11 along the 5' to 3' direction, with the remaining positions being 2'-methoxymodified nucleotides; or, 2'-fluoromodified nucleotides are located at positions 11, 12, 13, and 17 along the 3' to 5' direction, with the remaining positions being 2'-methoxymodified nucleotides; or, 2'-fluoromodified nucleotides are located at positions 9, 11, 13, and 17 along the 3' to 5' direction, with the remaining positions being 2'-methoxymodified nucleotides; or, 2'-fluoromodified nucleotides are located at positions 6, 11, and 13 along the 3' to 5' direction, with the remaining positions being 2'-methoxymodified nucleotides; and / or In the antisense strand, 2'-fluoromodified nucleotides are located at positions 2, 6, 14, and 16 in the 5' to 3' direction, with the remaining positions being 2'-methoxymodified nucleotides; or, 2'-fluoromodified nucleotides are located at positions 2, 7, 10, and 14, with the remaining positions being 2'-methoxymodified nucleotides; or, 2'-fluoromodified nucleotides are located at positions 2, 3, 5, 7, 10, 12, and 14, with position 6 being a GNA-modified nucleotide and the remaining positions being 2'-methoxymodified nucleotides; or, 2'-fluoromodified nucleotides are located at positions 2, 7, and 14, with positions 5 and 12 being 2'-deoxymodified nucleotides and the remaining positions being 2'-methoxymodified nucleotides.

15. The siRNA according to any one of claims 1-14, wherein the positive strand comprises a phosphate thioester group located at the following positions, oriented from the 5' end to the 3' end: Between the first and second nucleotides starting at the 5' end of the positive strand; Between the second and third nucleotides starting at the 5' end of the positive strand; or, The positive chain contains thiophosphate groups located at the following positions: Between the reverse debased deoxyribose residue starting at the 5' end of the positive strand and the first nucleotide; Between the first and second nucleotides starting at the 5' end of the positive strand; Between the reverse debased deoxyribose residue starting at the 3' end of the positive strand and the first nucleotide; or, The positive chain contains thiophosphate groups located at the following positions: Between the first and second nucleotides starting at the 5' end of the positive strand; Between the second and third nucleotides starting at the 5' end of the positive strand; The reverse debasing deoxyribose residue starting at the 3' end of the positive strand is between the first nucleotide and the first nucleotide.

16. The siRNA according to any one of claims 1-15, wherein the antisense strand comprises a phosphate thioester group located at the following positions, in the direction from the 5' end to the 3' end: Between the first and second nucleotides starting at the 5' end of the antisense strand; Between the second and third nucleotides starting at the 5' end of the antisense strand; Between the first and second nucleotides starting at the 3' end of the antisense strand; Between the second and third nucleotides starting at the 3' end of the antisense strand.

17. The siRNA according to any one of claims 1-16, wherein each nucleotide in the sense strand and the antisense strand is independently a 2'-fluoro-modified nucleotide, a 2'-methoxy-modified nucleotide, a GNA-modified nucleotide, a 2'-deoxy-modified nucleotide, or any combination of two or more thereof. Preferably, in the 5' to 3' direction, the 2'-fluorinated nucleotides are located at positions 7, 9, 10, and 11 of the sense strand, and the remaining positions are 2'-methoxylated nucleotides; in the 5' to 3' direction, the 2'-fluorinated nucleotides are located at positions 2, 6, 14, and 16 of the antisense strand, and the remaining positions are 2'-methoxylated nucleotides, wherein the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate-derived group or a 5' phosphate group; Alternatively, in the 5' to 3' direction, 2'-fluorinated nucleotides are located at positions 7, 9, 10, and 11 of the sense strand, with the remaining positions being 2'-methoxylated nucleotides; in the 5' to 3' direction, 2'-fluorinated nucleotides are located at positions 2, 6, 14, and 16 of the antisense strand, with the remaining positions being 2'-methoxylated nucleotides, wherein the 5' terminal nucleotide of the antisense strand is linked to a 5'-trans-vinylphosphonate group; Alternatively, in the 3' to 5' direction, 2'-fluorinated nucleotides are located at positions 11, 12, 13, and 17 of the sense strand, with the remaining positions being 2'-methoxylated nucleotides; in the 5' to 3' direction, 2'-fluorinated nucleotides are located at positions 2, 7, 10, and 14 of the antisense strand, with the remaining positions being 2'-methoxylated nucleotides, wherein the 5' terminal nucleotide of the antisense strand is linked to a 5'-trans-vinylphosphonate group; Alternatively, in the 3' to 5' direction, 2'-fluorinated nucleotides are located at positions 9, 11, 13, and 17 of the sense strand, with the remaining positions being 2'-methoxylated nucleotides; in the 5' to 3' direction, 2'-fluorinated nucleotides are located at positions 2, 7, 10, and 14 of the antisense strand, with the remaining positions being 2'-methoxylated nucleotides, wherein the 5' terminal nucleotide of the antisense strand is linked to a 5'-trans-vinylphosphonate group; Alternatively, in the 3' to 5' direction, 2'-fluorinated nucleotides are located at positions 6, 11, and 13 of the sense strand, with the remaining positions being 2'-methoxylated nucleotides; in the 5' to 3' direction, 2'-fluorinated nucleotides are located at positions 2, 7, 10, and 14 of the antisense strand, with the remaining positions being 2'-methoxylated nucleotides, wherein the 5' terminal nucleotide of the antisense strand is linked to a 5'-trans-vinylphosphonate group; Alternatively, in the 3' to 5' direction, 2'-fluorinated nucleotides are located at positions 9, 11, 13, and 17 of the sense strand, with the remaining positions being 2'-methoxylated nucleotides; in the 5' to 3' direction, 2'-fluorinated nucleotides are located at positions 2, 3, 5, 7, 10, 12, and 14 of the antisense strand, with position 6 being a GNA-modified nucleotide and the remaining positions being 2'-methoxylated nucleotides, wherein the 5' terminal nucleotide of the antisense strand is linked to a 5'-trans-vinylphosphonate group; Alternatively, in the 3' to 5' direction, 2'-fluorinated nucleotides are located at positions 9, 11, 13, and 17 of the sense strand, with the remaining positions being 2'-methoxylated nucleotides; in the 5' to 3' direction, 2'-fluorinated nucleotides are located at positions 2, 7, and 14 of the antisense strand, with the nucleotides at positions 5 and 12 being 2'-deoxylated nucleotides, and the remaining positions being 2'-methoxylated nucleotides, wherein the 5' terminal nucleotide of the antisense strand is linked to a 5'-trans-vinylphosphonate group; Alternatively, in the 3' to 5' direction, 2'-fluorinated nucleotides are located at positions 11, 12, 13, and 17 of the sense strand, with the remaining positions being 2'-methoxylated nucleotides; in the 5' to 3' direction, 2'-fluorinated nucleotides are located at positions 2, 3, 5, 7, 10, 12, and 14 of the antisense strand, with position 6 being a GNA-modified nucleotide and the remaining positions being 2'-methoxylated nucleotides, wherein the 5' terminal nucleotide of the antisense strand is linked to a 5'-trans-vinylphosphonate group.

18. The siRNA according to claims 1-17, wherein the siRNA is selected from the siRNAs in Table 1; preferably, the siRNA is selected from N-ER-FY048178, N-ER-FY048178M45, N-ER-FY048178M49, N-ER-FY048178M51, N-ER-FY048200, N-ER-FY048200M49, N-ER-FY048203, N-ER-FY048203M49, N-ER-FY048205, and N-ER-FY048205M49.

19. An siRNA conjugate comprising the siRNA of any one of claims 1-18 and a conjugating group conjugated to the siRNA.

20. The siRNA conjugate according to claim 19, wherein the conjugating group is selected from:

21. The siRNA conjugate according to claim 19 or 20, wherein the siRNA conjugate is selected from the siRNA conjugates in Table 3; preferably, the siRNA conjugate is selected from N-ER-FY048178M45L96, N-ER-FY048178M49L96, N-ER-FY048178M51L96, N-ER-FY048200M49L96, N-ER-FY048203M49L96, and N-ER-FY048205M49L96.

22. A pharmaceutical composition comprising siRNA of any one of claims 1-18, or siRNA conjugate of any one of claims 19-21, and a pharmaceutically acceptable carrier.

23. A kit comprising the siRNA of any one of claims 1-18, or the siRNA conjugate of any one of claims 19-21, or the pharmaceutical composition of claim 22.

24. Use of the siRNA of any one of claims 1-18, or the siRNA conjugate of any one of claims 19-21, or the pharmaceutical composition of claim 22 for the preparation of an agent that inhibits the expression of the TRAF6 gene.

25. Use of the siRNA of any one of claims 1-18, or the siRNA conjugate of any one of claims 19-21, or the pharmaceutical composition of claim 22 for the preparation of an agent for the prevention and / or treatment of diseases related to TRAF6 gene overexpression.

26. The use according to claim 25, wherein the disease is colon cancer, breast cancer, neuroinflammation, myeloid malignancy, pancreatic cancer, or non-alcoholic steatohepatitis (NASH).

27. A method for inhibiting TRAF6 gene expression, comprising contacting or administering a therapeutically effective amount of siRNA of any one of claims 1-18, or an siRNA conjugate of any one of claims 19-21, or a pharmaceutical composition of claim 22 to cells expressing TRAF6 or to a subject in need.

Citation Information

Patent Citations

  • SiRNA (Small interference ribonucleic acid) as well as medicine composition and pharmaceutical application thereof

    CN102140458B

  • Compositions and methods

    CN105378082A

  • Targeting lipids

    WO2009082607A2

  • Oligonucleotide-ligand conjugates and process for their preparation

    WO2015006740A2