Dsrna agents for inhibiting angiotensinogen expression, derivatives and uses thereof
Patent Information
- Application Number
- CN202610186698.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2025-02-20
- Filing Date
- 2026-02-09
- Publication Date
- 2026-08-21
AI Technical Summary
包括siRNA剂在内,目前市面上的降压药物都面临着安全性和耐受性的问题,并且药效时间短,亟待研发新的安全、持续、有效的降压药,为高血压患者提供更多的选择和机会
1、本发明针对血管紧张素原(AGT)设计相应dsRNA,通过偶联GalNAc以有效的将dsRNA递送至肝脏,对肝脏部位的AGT mRNA进行干扰,可有效减少AGT的合成和分泌。
Smart Images

Figure CN122609570A_ABST
Abstract
Description
Technical Field
[0001] This invention pertains to RNA interference technology, specifically to angiotensinogen, and more specifically to dsRNA agents and their derivatives for inhibiting angiotensinogen expression and their applications. Background Technology
[0002] RNA interference (RNAi) is a molecular biological phenomenon of gene silencing induced by double-stranded RNA. Its mechanism involves inhibiting gene expression by blocking the transcription or translation of specific genes. When a double-stranded RNA homologous to the coding region of endogenous messenger RNA (mRNA) is introduced into a cell, the mRNA degrades, leading to gene silencing. Small interfering RNAs (siRNAs), with a length of 20-25 nt, can trigger RNAi, specifically downregulating or shutting down the expression of specific genes. They are highly efficient, easy to synthesize, and easy to manipulate, making this technology widely used in exploring gene function and in gene therapy for infectious diseases and malignant tumors.
[0003] N-acetylgalactosamine (GalNAc) is a monosaccharide that recognizes the sialic acid glycoprotein receptor, which is highly expressed in hepatocytes. Using GalNAc derivatives, such as divalent or trivalent branched linkers, attached to the 3' end of the positive strand of siRNA can promote siRNA specific targeting to liver tissue, thereby improving its bioavailability and reducing dosage and side effects.
[0004] Hypertension is one of the most common chronic diseases. According to relevant Chinese guidelines, the blood pressure cutoff for the diagnosis of hypertension is ≥140 / 90 mmHg, and blood pressure in the range of 120–139 / 80–89 mmHg is defined as prehypertension. The pathogenesis of hypertension is complex, and blood pressure regulation is mainly affected by cardiac output and peripheral resistance. Sympathetic nervous system excitation and excessive sodium intake can lead to increased cardiac output; decreased elasticity and increased stiffness of large arteries, as well as activation of the renin-angiotensin-aldosterone system (RAAS), can all increase vascular resistance, all of which can lead to elevated blood pressure. Angiotensinogen (AGT) is a glycoprotein synthesized by the liver and is a rate-limiting substrate of the RAAS system. Angiotensinogen is converted into angiotensin I under the action of renin. Specifically, when the body loses blood or kidney disease leads to a decrease in circulating blood volume and renal blood flow, it can promote the secretion of renin (an acidic protease) by the juxtaglomerular cells of the juxtaglomerular apparatus. Once renin enters the bloodstream, it hydrolyzes angiotensinogen (an alpha globulin) produced by the liver into angiotensin I (a decapeptide). As angiotensin I flows through the pulmonary circulation, it is hydrolyzed into angiotensin II (an octapeptide) by enzymes in the lungs. Some angiotensin II is further hydrolyzed into angiotensin III (a hecapeptide) by angiotensinase A in plasma and tissue fluid. Angiotensin II regulates blood pressure and is a key component of the renin-angiotensin system. It constricts peripheral arterioles and veins, raising blood pressure, and stimulates the adrenal cortex to secrete hormones such as aldosterone, promoting the reabsorption of sodium and water by the kidneys, further increasing blood volume and maintaining electrolyte balance. In conclusion, angiotensinogen plays a crucial role in blood pressure regulation and fluid balance in the human body.
[0005] The prior art CN119040325A discloses a dual-targeting siRNA agent, which includes two different siRNAs or pharmaceutically acceptable salts thereof targeting two different genes. The two different siRNAs or their salts are linked by a pharmaceutically acceptable ligand. The siRNAs are dsRNAs composed of a sense strand and an antisense strand. The two different genes are selected from two of angiotensinogen (AGT), proprotein convertase subtilisin 9, and human angiopoietin-like protein 3. This agent can be used to prepare drugs for treating hypertension.
[0006] Commonly used antihypertensive drugs include six classes: diuretics, calcium channel blockers (CCBs), angiotensin-converting enzyme inhibitors (ACEIs), angiotensin receptor blockers (ARBs), beta-blockers, and alpha-blockers. Including siRNA agents, currently available antihypertensive drugs face safety and tolerability issues, and their effects are short-lived. There is an urgent need to develop new, safe, sustained-release, and effective antihypertensive drugs to provide more choices and opportunities for hypertensive patients. Summary of the Invention
[0007] This invention addresses the problems existing in the prior art by providing a dsRNA agent for inhibiting angiotensinogen expression, its derivatives, and their applications. This invention designs corresponding dsRNAs targeting angiotensinogen (AGT), and through coupling with GalNAc, effectively delivers the dsRNAs to the liver, interfering with AGT mRNA in the liver and effectively reducing cellular AGT expression.
[0008] To achieve the above objectives, the technical solution adopted by the present invention is as follows:
[0009] On one hand, the present invention provides a double-stranded ribonucleic acid (dsRNA) agent or a salt thereof for inhibiting angiotensinogen (AGT) expression, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double-stranded region by base pairing, wherein the sense strand is selected from SEQ ID NO.1-102 or its modified sequence, and the antisense strand is selected from SEQ ID NO.106-207 or its modified sequence.
[0010] Preferably, at least one nucleotide in the sense strand or the antisense strand is a modified nucleotide.
[0011] Preferably, at least one nucleotide in the sense strand or the antisense strand is a nucleotide analog or a nucleotide with a hydroxyl group modified at the 2' position of the ribosyl group; the nucleotide analog includes isonucleotides, LNA, ENA, cEt-BNA, UNA, or GNA; the nucleotide with a hydroxyl group modified at the 2' position of the ribosyl group includes nucleotides modified with 2'-O-methyl, 2'-O-methoxyethyl, 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl, 2'-O-dimethylaminoethyl, 2'-O-dimethylaminopropyl, T0-dimethylaminoethoxyethyl, or 2'-ON-methylacetamide.
[0012] Preferably, at least one phosphate group in the sense chain or the antisense chain is a phosphate group with a modifying group.
[0013] Preferably, the sense chain is selected from the modification sequences shown in SEQ ID NO.211-233, and the antisense chain is selected from the modification sequences shown in SEQ ID NO.235-257; wherein m represents 2'-O-methyl substitution modification, f represents 2'-fluorination modification, and s represents thiosclerosis modification.
[0014] Preferably, the dsRNA sequence is selected from one of the following dsRNA sequences: A) YJH-014B-1861 m2, whose sense strand nucleotide sequence is shown in SEQ ID NO.229: fU-s-mG-s-fU-mG-fA-mA-fA-fC-fA-mA-fA-mA-fA-mA-fG-mU-fG-mU-fG-mU-fU, and whose antisense strand nucleotide sequence is shown in SEQ ID NO.253: mA-s-fA-s-mC-fA-mC-fU-mU-mU-fU-mU-mU-mG-mU-fU-mU-fC-mA-fC-mA-s-mA-s-mA; B) YJH-014B-1867 m2, whose sense strand nucleotide sequence is shown in SEQ ID NO.231: fA-s-mC-s-fA-mA-fA-mA-fA-fA-fG-mU-fG-mU-fU-mC-fC-mC-fU-mU-fU, and whose antisense strand nucleotide sequence is shown in SEQ ID NO.255: mA-s-fA-s-mA-fG-mG-fG-mA-mC-fA-mC-mU-mU-fU-mU-fU-mU-fG-mU-s-mU-s-mU; C) YJH-014B-1882 m2, whose sense strand nucleotide sequence is shown in SEQ ID NO.233: fC-s-mU-s-fU-mU-fU-mC-fA-fA-fG-mU-fU-mG-fA-mG-fA-mA-fC-mA-fA, and whose antisense strand nucleotide sequence is shown in SEQ ID NO.257: mU-s-fU-s-mG-fU-mU-fC-mU-fC-mA-fA-mC-mU-mU-fG-mA-fA-mA-mG-s-mG-s-mG-s-mG; Where mA, mG, mC, and mU are 2'-O-methyl modified A, G, C, and U, respectively; fA, fG, fC, and fU are 2'-fluorine modified A, G, C, and U, respectively; and s represents thiophosphate linkage.
[0015] Preferably, the dsRNA agent or its salt further includes a ligand.
[0016] Preferably, the ligand is conjugated to the 3' end of the positive strand of the dsRNA agent or its salt.
[0017] Preferably, the ligand includes monoclonal antibodies, biclonal antibodies, monosaccharides, polysaccharides, and cationic polymers.
[0018] Preferably, the ligand is N-acetylgalactosamine (GalNAc) or a derivative thereof.
[0019] Preferably, the ligand is one or more GalNAc derivatives attached via a monovalent, divalent, or trivalent branching junction.
[0020] Preferably, the ligand has the following structural formula: .
[0021] Preferably, the ligand is L96, and L96 is N-[tris(GalNAc-alkyl)-amide-decanoyl]-4-hydroxyprolyl.
[0022] Preferably, the dsRNA agent or its salt is conjugated to the ligand as shown in the following formula: , where X is O or S.
[0023] Preferably, X is 0.
[0024] On the other hand, the present invention provides a cell comprising the above-described dsRNA agent or a salt thereof.
[0025] On the other hand, the present invention provides a pharmaceutical composition for inhibiting the expression of a gene encoding AGT, the pharmaceutical composition comprising the above-mentioned dsRNA agent or a salt thereof.
[0026] On the other hand, the present invention provides a kit comprising the above-described dsRNA agent or a salt thereof, or comprising the above-described pharmaceutical composition.
[0027] On the other hand, the present invention provides the use of the above-mentioned dsRNA agent or its salt, or the above-mentioned pharmaceutical composition, or the above-mentioned kit in the preparation of a drug for inhibiting AGT expression in cells or a drug for treating hypertension.
[0028] Compared with the prior art, the present invention has the following beneficial effects: 1. This invention designs corresponding dsRNAs for angiotensinogen (AGT) and delivers them to the liver by coupling with GalNAc, thereby interfering with AGT mRNA in the liver and effectively reducing AGT synthesis and secretion.
[0029] 2. The dsRNA provided by this invention can significantly inhibit the expression of AGT mRNA in cells, effectively reduce the content of AGT protein, and has a long duration of action. It can be used to prepare drugs for treating hypertension. Attached Figure Description
[0030] Figure 1 The IC50 of the GalNAc-coupled siRNA modification sequence in Example 3 inhibiting AGT mRNA expression in HepG2 cells. 50 Curve, number of multiple holes n=3.
[0031] Figure 2 The protein inhibition efficiency in hAGT mouse serum 7 days after administration of the GalNAc-conjugated siRNA modified sequence in Example 5; compared with the Blank group (no administration group), the t-test analysis showed that... The difference was highly significant (P < 0.01). The difference was highly significant (P < 0.001), without the following. This indicates no significant difference; each dot in the bar chart represents the value of a parallel experiment, with n=6 animals in each parallel group.
[0032] Figure 3 The protein inhibition efficiency in the serum of hAGT mice 14 days after administration of the GalNAc-conjugated siRNA modified sequence in Example 5; compared with the Blank group, the t-test analysis showed that... The difference was highly significant (P < 0.001), without the following. This indicates no significant difference; each dot in the bar chart represents the value of a parallel experiment, with n=5 animals in each parallel group.
[0033] Figure 4 The GalNAc-conjugated siRNA modified sequence in Example 5 was administered 14 days prior to the knockdown efficiency of AGT mRNA in the liver of hAGT mice; compared with the Blank group, the t-test analysis showed that... The difference was highly significant (P < 0.001), without the following. This indicates no significant difference; each dot in the bar chart represents the value of a parallel experiment, with n=6 animals in each parallel group.
[0034] Figure 5 This refers to the knockdown efficiency of AGT mRNA in the liver of hAGT mice 7 days after administration of the m1-modified and m2-modified sequences in Example 6; compared with the Blank group, the t-test analysis showed that... The difference was highly significant (P < 0.01). The difference was highly significant (P < 0.001), without the following. This indicates no significant difference; each dot in the bar chart represents the value of a parallel experiment, with n=4 animals in each parallel group.
[0035] Figure 6 This demonstrates the knockdown efficiency of AGT mRNA in the liver of hAGT mice 7 days after administration of the GalNAc-conjugated siRNA modified sequence in Example 7; compared with the Blank group, the t-test analysis showed that... The difference was highly significant (P < 0.01). The difference is considered highly significant (P < 0.001); each dot in the bar chart represents the value of a parallel experiment, with n = 3 animals in each parallel group.
[0036] Figure 7 The protein inhibition efficiency in hAGT mouse serum 7 days after administration of the GalNAc-conjugated siRNA modified sequence in Example 8; compared with the Blank group, the t-test analysis showed that... The differences were statistically significant (P < 0.05). The difference was highly significant (P < 0.01). The difference is considered highly significant (P < 0.001); each dot in the bar chart represents the value of a parallel experiment, with n = 3 animals in each parallel group.
[0037] Figure 8 The knockdown effect of the GalNAc-coupled siRNA modified sequence in primary monkey hepatocytes in Example 9; compared with the Blank group, the t-test analysis showed that... The difference is highly significant (P < 0.01); each dot in the bar chart represents the value of a parallel experiment, and the number of replicates n = 3.
[0038] Figure 9 The knockdown effect of the GalNAc-coupled siRNA modified sequence in human primary hepatocytes in Example 10; compared with the Blank group, the t-test analysis showed that... The difference was highly significant (P < 0.01). The difference is considered highly significant (P < 0.001); each dot in the bar chart represents the value of a parallel experiment, with a replicate number of wells n = 3.
[0039] Figure 10The results of the GalNAc-coupled siRNA modified sequence in Example 11 showed a long-term antihypertensive effect in the hAGT humanized mouse hypertension model over 28 days, with n=3 parallel animals in each group; where MBP refers to mean blood pressure, i.e., the average blood pressure measured over 24 hours.
[0040] Figure 11 The results of different doses of GalNAc-coupled siRNA modified sequences in Example 12 showed a long-term antihypertensive effect in the hAGT humanized mouse hypertension model over 28 days, with n=5 parallel animals in each group; mean arterial pressure is the average blood pressure measured over 24 hours.
[0041] Figure 12 This is the result of long-acting hAGT mRNA knockdown at different doses of GalNAc-conjugated siRNA modified sequences in a humanized hAGT mouse hypertension model at 28 days, as shown in Example 12. Compared to the Model group, the results were analyzed using a one-way ANOVA test. The difference is considered highly significant (P < 0.0001); each dot in the bar chart represents the value of a parallel experiment, with n = 5 animals in each parallel group.
[0042] Figure 13 This is the result of long-acting hAGT protein knockdown at different doses of GalNAc-conjugated siRNA modified sequences in a humanized hAGT mouse hypertension model after 28 days, as shown in Example 12. Compared to the Model group, the results were analyzed using a one-way ANOVA test. The difference is considered highly significant (P < 0.0001); each dot in the bar chart represents the value of a parallel experiment, with n = 5 animals in each parallel group.
[0043] Figure 14 This describes the knockdown effect of different modified sequences of GalNAc-coupled siRNA in Example 13. Compared to the NC group, the results were analyzed using a t-test. The difference was highly significant (P < 0.01). The difference is considered highly significant (P < 0.001); each dot in the bar chart represents the value of a parallel experiment, with a replicate number of wells n = 3.
[0044] Figure 15This is a comparison of the knockdown effect of the GalNAc-coupled siRNA modified sequence and the Yangshen group in Example 14. Compared with the NC group, the results were analyzed using a t-test. The difference is considered highly significant (P < 0.001); each dot in the bar chart represents the value of a parallel experiment, with a replicate number of wells n = 3.
[0045] Figure 16 To evaluate the long-term knockdown effect of the GalNAc-coupled sequence in the cynomolgus monkey hypertension model in Example 15, the number of parallel animals in each group was n=4.
[0046] Figure 17 To evaluate the long-term knockdown effect of the GalNAc-coupled sequence in the cynomolgus monkey hypertension model in Example 15, the number of parallel animals in each group was n=4.
[0047] Figure 18 To demonstrate the long-term antihypertensive effect of the GalNAc-coupled sequence in Example 16 on a cynomolgus monkey hypertension model for up to 60 days, the number of parallel animals in each group was n=4, where the mean arterial pressure was the average of the blood pressure measured over 24 hours. Detailed Implementation
[0048] Unless otherwise specified, all raw materials used in this invention are commercially available products and their sources are not specifically limited.
[0049] In the following embodiments, In the siRNA modified sequence, mA, mG, mC, and mU are 2'-O-methyl modified A, G, C, and U, respectively; fA, fG, fC, and fU are 2'-fluorine modified A, G, C, and U, respectively; and s is a thiophosphate linker.
[0050] “m1” refers to the following dsRNA modification method: The positive chain 5'-3': nucleotide 1 2'-fluorinated, nucleotide 2 2'-O-methyl substituted, nucleotide 3 2'-fluorinated, nucleotide 4 2'-O-methyl substituted, nucleotide 5 2'-fluorinated, nucleotide 6 2'-O-methyl substituted, nucleotide 7 2'-fluorinated, nucleotide 8 2'-fluorinated, nucleotide 9 2'-fluorinated, nucleotide 10 2'-O-methyl substituted, nucleotide 11 2'-fluorinated, nucleotide 12 2'-O-methyl substituted, nucleotide 13 2'-fluorinated, nucleotide 14 2'-O-methyl substituted, nucleotide 15 2'-fluorinated, nucleotide 16 2'-O-methyl substituted, nucleotide 17 2'-fluorinated, nucleotide 18 2'-O-methyl substituted, nucleotide 19 2'-fluorinated; Antisense strand 5'-3': nucleotide 1 2'-O-methyl substitution, nucleotide 2 2'-fluorination, nucleotide 3 2'-O-methyl substitution, nucleotide 4 2'-fluorination, nucleotide 5 2'-O-methyl substitution, nucleotide 6 2'-fluorination, nucleotide 7 2'-O-methyl substitution, nucleotide 8 2'-fluorination, nucleotide 9 2'-O-methyl substitution, nucleotide 10 2'-fluorination, nucleotide 11 2'-O-methyl substitution, nucleotide 1 2. Nucleotide 2'-O-methyl substitution, 13. Nucleotide 2'-O-methyl substitution, 14. Nucleotide 2'-fluorination, 15. Nucleotide 2'-O-methyl substitution, 16. Nucleotide 2'-fluorination, 17. Nucleotide 2'-O-methyl substitution, 18. Nucleotide 2'-fluorination, 19. Nucleotide 2'-O-methyl substitution, thiophosphate backbone, 20. Nucleotide 2'-fluorination, thiophosphate backbone, 21. Nucleotide 2'-O-methyl substitution.
[0051] “m2” refers to the following dsRNA modification method: The positive chain 5'-3': nucleotide 1 2'-fluorinated, thiophosphate backbone, nucleotide 2 2'-O-methyl substituted, thiophosphate backbone, nucleotide 3 2'-fluorinated, nucleotide 4 2'-O-methyl substituted, nucleotide 5 2'-fluorinated, nucleotide 6 2'-O-methyl substituted, nucleotide 7 2'-fluorinated, nucleotide 8 2'-fluorinated, nucleotide 9 2'-fluorinated, nucleotide 10 2'-O-methyl substituted, nucleotide 11 2'-fluorinated, nucleotide 12 2'-O-methyl substituted, nucleotide 13 2'-fluorinated, nucleotide 14 2'-O-methyl substituted, nucleotide 15 2'-fluorinated, nucleotide 16 2'-O-methyl substituted, nucleotide 17 2'-fluorinated, nucleotide 18 2'-O-methyl substituted, nucleotide 19 2'-fluorinated; Antisense strand 5'-3': nucleotide 1 2'-O-methyl substitution, thiophosphate backbone; nucleotide 2 2'-fluorination, thiophosphate backbone; nucleotide 3 2'-O-methyl substitution; nucleotide 4 2'-fluorination; nucleotide 5 2'-O-methyl substitution; nucleotide 6 2'-fluorination; nucleotide 7 2'-O-methyl substitution; nucleotide 8 2'-fluorination; nucleotide 9 2'-O-methyl substitution; nucleotide 10 2'-fluorination; nucleotide 11 2'-O-methyl substitution. Substitution of nucleotide 12, 2'-O-methyl substitution of nucleotide 13, 2'-O-methyl substitution of nucleotide 14, 2'-fluorination of nucleotide 15, 2'-O-methyl substitution of nucleotide 16, 2'-fluorination of nucleotide 17, 2'-O-methyl substitution of nucleotide 18, 2'-fluorination of nucleotide 19, 2'-O-methyl substitution of nucleotide thiophosphate backbone, 20, 2'-O-methyl substitution of nucleotide thiophosphate backbone, 21, 2'-O-methyl substitution of nucleotide 22.
[0052] “m3” refers to the following dsRNA modification: The positive chain 5'-3': nucleotide 1 2'-O-methyl substitution, thiophosphate backbone, nucleotide 2 2'-O-methyl substitution, thiophosphate backbone, nucleotide 3 2'-O-methyl substitution, nucleotide 4 2'-O-methyl substitution, nucleotide 5 2'-fluorinated, nucleotide 6 2'-O-methyl substitution, nucleotide 7 2'-fluorinated, nucleotide 8 2'-fluorinated, nucleotide 9 2'-fluorinated, nucleotide 10 2'-O-methyl substitution, nucleotide 11 2'-O-methyl substitution, nucleotide 12 2'-O-methyl substitution, nucleotide 13 2'-O-methyl substitution, nucleotide 14 2'-O-methyl substitution, nucleotide 15 2'-O-methyl substitution, nucleotide 16 2'-O-methyl substitution, nucleotide 17 2'-O-methyl substitution, nucleotide 18 2'-O-methyl substitution, nucleotide 19 2'-O-methyl substitution; Antisense strand 5'-3': nucleotide 1 2'-O-methyl substitution, thiophosphate backbone; nucleotide 2 2'-fluorination, thiophosphate backbone; nucleotide 3 2'-O-methyl substitution; nucleotide 4 2'-O-methyl substitution; nucleotide 5 2'-O-methyl substitution; nucleotide 6 2'-fluorination; nucleotide 7 2'-O-methyl substitution; nucleotide 8 2'-O-methyl substitution; nucleotide 9 2'-O-methyl substitution; nucleotide 10 2'-O-methyl substitution; nucleotide 11 2'-O-methyl substitution. -O-methyl substitution, nucleotide 12 2'-O-methyl substitution, nucleotide 13 2'-O-methyl substitution, nucleotide 14 2'-fluorinated, nucleotide 15 2'-O-methyl substitution, nucleotide 16 2'-fluorinated, nucleotide 17 2'-O-methyl substitution, nucleotide 18 2'-O-methyl substitution, nucleotide 19 2'-O-methyl substitution, phosphate thioester backbone, nucleotide 20 2'-O-methyl substitution, phosphate thioester backbone, nucleotide 21 2'-O-methyl substitution.
[0053] “m4” refers to the following dsRNA modification method: The positive chain 5'-3': nucleotide 1 is 2'-fluorinated, nucleotide 2 is 2'-O-methyl substituted, nucleotide 3 is 2'-fluorinated, nucleotide 4 is 2'-O-methyl substituted, nucleotide 5 is 2'-fluorinated, nucleotide 6 is 2'-O-methyl substituted, nucleotide 7 is 2'-O-methyl substituted, nucleotide 8 is 2'-O-methyl substituted, nucleotide 9 is 2'-O-methyl substituted, nucleotide 10 is 2'-O-methyl substituted, nucleotide 11 is 2'-O-methyl substituted, nucleotide 12 is 2'-O-methyl substituted, nucleotide 13 is 2'-O-methyl substituted, nucleotide 14 is 2'-O-methyl substituted, nucleotide 15 is 2'-O-methyl substituted, nucleotide 16 is 2'-O-methyl substituted, nucleotide 17 is 2'-O-methyl substituted, nucleotide 18 is 2'-O-methyl substituted, nucleotide 19 is 2'-O-methyl substituted; Antisense strand 5'-3': nucleotide 1 2'-O-methyl substitution, nucleotide 2 2'-O-methyl substitution, nucleotide 3 2'-O-methyl substitution, nucleotide 4 2'-O-methyl substitution, nucleotide 5 2'-O-methyl substitution, nucleotide 6 2'-O-methyl substitution, nucleotide 7 2'-O-methyl substitution, nucleotide 8 2'-fluorinated, nucleotide 9 2'-O-methyl substitution, nucleotide 10 2'-O-methyl substitution, nucleotide 11 2'-O -Methyl substitution, 12th nucleotide 2'-O-methyl substitution, 13th nucleotide 2'-O-methyl substitution, 14th nucleotide 2'-O-methyl substitution, 15th nucleotide 2'-O-methyl substitution, 16th nucleotide 2'-O-methyl substitution, 17th nucleotide 2'-O-methyl substitution, 18th nucleotide 2'-O-methyl substitution, 19th nucleotide 2'-O-methyl substitution, 20th nucleotide 2'-O-methyl substitution, 21st nucleotide 2'-O-methyl substitution.
[0054] “m5” refers to the following dsRNA modification method: The positive chain 5'-3': nucleotide 1 2'-fluorinated, thiophosphate backbone, nucleotide 2 2'-O-methyl substituted, thiophosphate backbone, nucleotide 3 2'-fluorinated, nucleotide 4 2'-O-methyl substituted, nucleotide 5 2'-fluorinated, nucleotide 6 2'-O-methyl substituted, nucleotide 7 2'-fluorinated, nucleotide 8 2'-fluorinated, nucleotide 9 2'-fluorinated, nucleotide 10 2'-O-methyl substituted, nucleotide 11 2'-fluorinated, nucleotide 12 2'-O-methyl substituted, nucleotide 13 2'-fluorinated, nucleotide 14 2'-O-methyl substituted, nucleotide 15 2'-fluorinated, nucleotide 16 2'-O-methyl substituted, nucleotide 17 2'-fluorinated, nucleotide 18 2'-O-methyl substituted, nucleotide 19 2'-fluorinated; Antisense strand 5'-3': nucleotide 1: 2'-O-methyl substitution, phosphate thioester backbone; nucleotide 2: LNA modification, phosphate thioester backbone; nucleotide 3: 2'-O-methyl substitution; nucleotide 4: 2'-fluorination; nucleotide 5: LNA modification; nucleotide 6: 2'-fluorination; nucleotide 7: 2'-O-methyl substitution; nucleotide 8: 2'-fluorination; nucleotide 9: 2'-O-methyl substitution; nucleotide 10: 2'-fluorination; nucleotide 11: 2'-O-methyl substitution. The 12th nucleotide is 2'-O-methyl substituted, the 13th nucleotide is 2'-O-methyl substituted, the 14th nucleotide is 2'-fluorinated, the 15th nucleotide is 2'-O-methyl substituted, the 16th nucleotide is 2'-fluorinated, the 17th nucleotide is 2'-O-methyl substituted, the 18th nucleotide is 2'-fluorinated, the 19th nucleotide is 2'-O-methyl substituted, the thiophosphate backbone, the 20th nucleotide is 2'-O-methyl substituted, the thiophosphate backbone, and the 21st nucleotide is 2'-O-methyl substituted.
[0055] “m6” refers to the following dsRNA modification method: The positive chain 5'-3': nucleotide 1 2'-fluorinated, thiophosphate backbone, nucleotide 2 2'-O-methyl substituted, thiophosphate backbone, nucleotide 3 2'-fluorinated, nucleotide 4 2'-O-methyl substituted, nucleotide 5 2'-fluorinated, nucleotide 6 2'-O-methyl substituted, nucleotide 7 2'-fluorinated, nucleotide 8 2'-fluorinated, nucleotide 9 2'-fluorinated, nucleotide 10 2'-O-methyl substituted, nucleotide 11 2'-fluorinated, nucleotide 12 2'-O-methyl substituted, nucleotide 13 2'-fluorinated, nucleotide 14 2'-O-methyl substituted, nucleotide 15 2'-fluorinated, nucleotide 16 2'-O-methyl substituted, nucleotide 17 2'-fluorinated, nucleotide 18 2'-O-methyl substituted, nucleotide 19 2'-fluorinated; Antisense strand 5'-3': nucleotide 1: 2'-O-methyl substitution, thiophosphate backbone; nucleotide 2: GNA modification, thiophosphate backbone; nucleotide 3: 2'-O-methyl substitution; nucleotide 4: 2'-fluorination; nucleotide 5: GNA modification; nucleotide 6: 2'-fluorination; nucleotide 7: 2'-O-methyl substitution; nucleotide 8: 2'-fluorination; nucleotide 9: 2'-O-methyl substitution; nucleotide 10: 2'-fluorination; nucleotide 11: 2'-O-methyl substitution. The 12th nucleotide is 2'-O-methyl substituted, the 13th nucleotide is 2'-O-methyl substituted, the 14th nucleotide is 2'-fluorinated, the 15th nucleotide is 2'-O-methyl substituted, the 16th nucleotide is 2'-fluorinated, the 17th nucleotide is 2'-O-methyl substituted, the 18th nucleotide is 2'-fluorinated, the 19th nucleotide is 2'-O-methyl substituted, the thiophosphate backbone, the 20th nucleotide is 2'-O-methyl substituted, the thiophosphate backbone, and the 21st nucleotide is 2'-O-methyl substituted.
[0056] “m7” refers to the following dsRNA modification method: The positive chain 5'-3': nucleotide 1 2'-fluorinated, nucleotide 2 2'-O-methyl substituted, thiophosphate backbone, nucleotide 3 2'-fluorinated, nucleotide 4 2'-O-methyl substituted, nucleotide 5 2'-fluorinated, nucleotide 6 2'-O-methyl substituted, nucleotide 7 2'-O-methyl substituted, nucleotide 8 2'-O-methyl substituted, nucleotide 9 2'-O-methyl substituted, thiophosphate backbone, nucleotide 10 2'-O-methyl substituted, thiophosphate backbone, nucleotide 11 2'-fluorinated, thiophosphate backbone, nucleotide 12 2'-O-methyl substituted, nucleotide 13 2'-fluorinated, nucleotide 14 2'-O-methyl substituted, nucleotide 15 2'-fluorinated, nucleotide 16 2'-O-methyl substituted, nucleotide 17 2'-fluorinated, nucleotide 18 2'-O-methyl substituted, nucleotide 19 2'-fluorinated; Antisense strand 5'-3': 2'-O-methyl substitution of nucleotide 1, 2'-O-methyl substitution of nucleotide 2, 2'-O-methyl substitution of nucleotide 3, 2'-O-methyl substitution of nucleotide 4, 2'-O-methyl substitution of nucleotide 5, 2'-O-methyl substitution of nucleotide thiophosphate backbone, 2'-O-methyl substitution of nucleotide 6, 2'-O-methyl substitution of nucleotide thiophosphate backbone, 2'-O-methyl substitution of nucleotide 7, 2'-O-methyl substitution of nucleotide 8, 2'-O-methyl substitution of nucleotide 9, 2'-Fluoride of nucleotide 10 The substitutions are as follows: nucleotide 11, nucleotide 12, nucleotide 13, nucleotide 14, nucleotide 15, nucleotide 16, nucleotide 2'-fluorinated, nucleotide 17, nucleotide 18, nucleotide 19, nucleotide 20, and nucleotide 21.
[0057] In the nomenclature of siRNA, L96 represents that the 3' end of the positive strand of the siRNA is coupled with L96, which is N-[tris(GalNAc-alkyl)-amide-decanoyl]-4-hydroxyprolyl.
[0058] Example 1: Screening for the effect of siRNA naked sequence knockdown 1) Human liver cancer cells HepG2 (cell bank of Kunming Institute of Cell Bank, Chinese Academy of Sciences) in logarithmic growth phase were digested with trypsin, and digestion was terminated with complete medium supplemented with 10% FBS. Cells were collected by centrifugation, resuspended in medium supplemented with 10% FBS, counted with a hemocytometer, and then 50,000 cells were added to each well of a 24-well cell culture plate for culture.
[0059] 2) Preparation of the LipoRNAiMAX (invitrogen) and siRNA (dsRNA) mixture: The sequences shown in Table 1 were used, with NC serving as the negative control. The remaining sequences were derived from human AGT mRNA (NM_001382817.3 in the NCBI database; see Table 1 for specific locations). 10 nM / well of siRNA and 1.5 μl of LipoRNAiMAX (invitrogen) were diluted separately in 25 μl of serum-free culture medium (Opti-MEM, purchased from Gibco). The siRNA solution was then mixed with the LipoRNAiMAX (invitrogen) solution and incubated at room temperature for 5 minutes.
[0060] Table 1. Description of siRNA sequences
[0061] Note: NA indicates that NC is a negative control and is not derived from NM_001382817.3.
[0062] 3) Add 50 μl of the corresponding group's siRNA and LipoRNAiMAX (invitrogen) mixed solution to each well.
[0063] 4) After culturing for 48 hours, discard the culture medium and extract the cell RNA.
[0064] 5) Prepare the qPCR system and perform it on ice. Add 1 μl One Step SYBR Green Mix (Novizan) and 10 μl 2... to each well. One-step SYBR Green Mix (Novizan), 0.4 μl hYJH-014 2PF (SEQ ID NO.104: ACAATGAGAGTACCTGTGAGCA), 0.4 μl hYJH-014 2PR (SEQ ID NO.209: TCTTGGCCTGAATTGGAGCAG), and 100 ng RNA diluted in 8.2 μl RNase ddH2O (Novizan) were added to the wells, mixed well, and placed in a qPCR instrument for reaction. PCR reaction conditions: 50℃, 15 min pre-denaturation, 95℃, 1 min, 95℃ annealing for 15 sec, 60℃ extension for 1 min, for 39 cycles. The results of screening for naked siRNA sequences are shown in Table 2.
[0065] Table 2. Effects of siRNA naked sequence knockdown
[0066] Example 2: Screening for the knockdown effect of GalNAc coupling modification sequences 2.1 GalNAc Coupling Next, we modified the siRNA to improve its stability in vivo and in vitro, enhance its activity against the target, and reduce its activity against non-target sites. Unless otherwise stated, L96 delivery was used for both in vivo and in vitro screening of single-target sequences to more accurately reflect the effects of liver-targeting siRNA. The siRNA was conjugated to L96 at the 3' end of the sense strand. The modified sequences of the sense and antisense strands of the siRNA are shown in Table 3, and the sequences after conjugation with L96 are shown in Table 4. L96 is N-[tris(GalNAc-alkyl)-amide-decanoyl]-4-hydroxyprolyl, and its structure after conjugation with siRNA is shown below: , where X is O.
[0067] Table 3. Description of modified siRNA sequences
[0068] Note: mA, mG, mC, and mU are 2'-O-methyl modified A, G, C, and U, respectively; fA, fG, fC, and fU are 2'-fluorine modified A, G, C, and U, respectively; s represents thiophosphate linkage.
[0069] Table 4. Description of GalNAc-modified siRNA sequences
[0070] 2.2 Knockdown Experiment 1) Human liver cancer cells HepG2 (cell bank of Kunming Institute of Cell Bank, Chinese Academy of Sciences) in logarithmic growth phase were digested with trypsin, and digestion was terminated with complete medium supplemented with 10% FBS. Cells were collected by centrifugation, resuspended in medium supplemented with 10% FBS, counted with a hemocytometer, and then 50,000 cells were added to each well of a 24-well cell culture plate for culture.
[0071] 2) Preparation of the LipoRNAiMAX (invitrogen) and siRNA mixture. The sense and antisense strand sequences of the siRNA are shown in Table 4. 10 nM / well of siRNA and 1.5 μl of LipoRNAiMAX (invitrogen) were diluted separately in 25 μl of serum-free culture medium (Opti-MEM, purchased from Gibco). The siRNA solution was then mixed with the LipoRNAiMAX (invitrogen) solution and incubated at room temperature for 5 minutes.
[0072] 3) Add 50 μl of the corresponding group's siRNA and LipoRNAiMAX (invitrogen) mixed solution to each well.
[0073] 4) After culturing for 48 hours, discard the culture medium and extract the cell RNA.
[0074] 5) Prepare the qPCR system and perform it on ice. Add 1 μl One Step SYBR Green Mix (Novizan) and 10 μl 2... to each well. One-Step SYBR Green Mix (Novizan), 0.4 μl hYJH-014 2PF (SEQ ID NO.104: ACAATGAGAGTACCTGTGAGCA), and 0.4 μl hYJH-014 2PR (SEQ ID NO.209: TCTTGGCCTGAATTGGAGCAG) were used. 100 ng of RNA was diluted in 8.2 μl RNase ddH2O (Novizan) and added to each well. The mixture was then placed in a qPCR instrument for reaction. PCR reaction conditions: 50℃ for 15 min pre-denaturation, 95℃ for 1 min, 95℃ for 15 sec annealing, and 60℃ for 1 min extension, for 39 cycles. The inhibition rates of each L96-conjugated siRNA against ATG mRNA are shown in Table 5.
[0075] Table 5. Inhibition results of GalNAc-modified siRNA
[0076] Example 3: IC50 of GalNAc-modified siRNA in HepG2 cells 50 filter The method of modifying siRNA with GalNAc in this embodiment is the same as that in Example 2.
[0077] 1) Human liver cancer cells HepG2 (cell bank of Kunming Institute of Cell Bank, Chinese Academy of Sciences) in logarithmic growth phase were digested with trypsin, and digestion was terminated with complete medium supplemented with 10% FBS. Cells were collected by centrifugation, resuspended in medium supplemented with 10% FBS, counted with a hemocytometer, and then 50,000 cells were added to each well of a 24-well cell culture plate for culture.
[0078] 2) Preparation of the LipoRNAiMAX (invitrogen) and siRNA mixture. The siRNA sequences are shown in Table 6. The above siRNA solution was mixed with the LipoRNAiMAX (invitrogen) solution to prepare a stock solution, which was then incubated at room temperature for 5 minutes. Then, the stock solutions of each siRNA were serially diluted.
[0079] Table 6. Description of GalNAc-coupled modified siRNA sequences
[0080] 3) Add 50 μl of the corresponding siRNA mixture to each well, so that the incubation concentrations of each siRNA are 50 nM, 10 nM, 2 nM, 0.4 nM, 0.08 nM, and 0.016 nM, respectively.
[0081] 4) After culturing for 48 hours, discard the culture medium and extract the cell RNA.
[0082] 5) Prepare the qPCR system and perform it on ice. Add 1 μl One Step SYBR Green Mix (Novizan) and 10 μl 2... to each well. One-step SYBR Green Mix (Novizan), 0.4 μl hYJH-014 2PF (SEQ ID NO. 104), and 0.4 μl hYJH-014 2PR (SEQ ID NO. 209) were used to dilute 100 ng of RNA in 8.2 μl RNase ddH2O (Novizan) and added to each well. The mixture was then placed in a qPCR instrument for reaction. PCR reaction conditions: 50℃ for 15 min pre-denaturation, 95℃ for 1 min, 95℃ for 15 sec annealing, and 60℃ for 1 min extension, for 39 cycles. The IC50 values of each L96-coupled siRNA were determined. 50 See Table 7, and the inhibition rate curve is shown in Table 7. Figure 1 .
[0083] Table 7 IC50 of GalNAc-modified siRNA 50
[0084] Example 4: Inhibition rate of GalNAc-conjugated siRNA on HepG2 AGT synthesis The method of modifying siRNA with GalNAc in this embodiment is the same as that in Example 2.
[0085] 1) Human liver cancer cells HepG2 (cell bank of Kunming Institute of Cell Bank, Chinese Academy of Sciences) in logarithmic growth phase were digested with trypsin, and digestion was terminated with complete medium supplemented with 10% FBS. Cells were collected by centrifugation, resuspended in medium supplemented with 10% FBS, counted with a hemocytometer, and then 50,000 cells were added to each well of a 24-well cell culture plate for culture.
[0086] 2) Preparation of the LipoRNAiMAX (Invitrogen) and siRNA mixture. The siRNA sequences are shown in Table 8. Dilute 10 nM / well of siRNA and 1.5 μl of LipoRNAiMAX (Invitrogen) separately in 25 μl of serum-free culture medium (Opti-MEM, purchased from Gibco). Then mix the siRNA solution with the LipoRNAiMAX (Invitrogen) solution and incubate at room temperature for 5 minutes.
[0087] Table 8. Description of GalNAc-coupled modified siRNA sequences
[0088] 3) Add 50 μl of the corresponding group's siRNA and LipoRNAiMAX (invitrogen) mixed solution to each well.
[0089] 4) Replace with fresh complete culture medium 48 hours after transfection, and continue culturing for another 24 hours before collecting the culture medium from each well.
[0090] 5) The AGT protein in the cell culture medium of each group was detected using the human AGT ELISA kit and compared with the group corresponding to the NC sequence. The inhibition rate of each sequence was calculated. The inhibition rate of AGT expression in HepG2 cells by L96-coupled siRNA is shown in Table 9.
[0091] Table 9. Inhibition rate of GalNAc-coupled siRNA on AGT expression in HepG2 cells.
[0092] Example 5: mRNA knockdown and protein inhibition efficiency of GalNAc-coupled modification sequence in hAGT humanized mice The method for modifying siRNA with GalNAc in this implementation is the same as in Example 2.
[0093] In vivo evaluation of siRNAs screened from in vitro studies was performed in hAGT humanized mice. The selected sequences are shown in Table 10. The pharmacodynamic activity of the following GalNAc-conjugated siRNAs targeting AGT was analyzed in mice after subcutaneous injection of the siRNAs.
[0094] Table 10. Description of GalNAc-modified siRNA sequences
[0095] 1) Evaluation of protein inhibition efficiency Each GalNAc-conjugated siRNA was administered as a single subcutaneous dose (3 mg / kg) on the first day of the experiment. Whole blood samples from hAGT-humanized mice were collected on days 7 and 14 post-administration. After blood clotted, serum was collected by centrifugation at 3000 rpm for 10 minutes at 4°C. AGT protein levels in serum samples from each group were detected using a Human AGT ELISA kit (Lianke Biotechnology).
[0096] like Figure 2 and Figure 3 As shown, L96-conjugated siRNAs (YJH-014B-830 m1-L96, YJH-014B-896 m1-L96, YJH-014B-964 m1-L96, YJH-014B-1337 m1-L96, YJH-014B-1882 m2-L96, YJH-014B-ALN m1-L96) administered as a single subcutaneous injection at a dose of 3 mg / kg showed inhibitory effects on serum AGT protein in hAGT-humanized mice of 3.5%, 17.3%, 16.0%, 20.4%, 77.3%, and 83.5% respectively on day 7 post-administration. On day 14 post-administration, they showed inhibitory effects on serum AGT protein in hAGT-humanized mice of 3.5%, 17.3%, 16.0%, 20.4%, 77.3%, and 83.5% respectively. The proteins showed inhibitory effects of 5.4%, 3.0%, 5.0%, 0%, 71.6%, and 81.2%, respectively, with the Blank group being the no-drug group. The results indicate that subcutaneous injection of sequences YJH-014B-1882 m2-L96 and YJH-014B-ALN m1-L96 resulted in higher downregulation of serum hAGT protein in mice.
[0097] 2) Evaluation of AGT mRNA knockdown efficiency Liver samples from hAGT-humanized mice were collected on day 14 after drug administration, and the AGT mRNA level in all samples was analyzed by RT-qPCR. Liver tissue from hAGT-humanized mice was lysed using lysis buffer (BioFlux), and chloroform (MREDA) was added for extraction. After vortexing and incubation at room temperature for 2-3 minutes, centrifugation was performed. The supernatant was transferred to wells and bound with binding buffer. Using a nucleic acid extractor, following the kit instructions (MagaBio Plus Total RNA Purification Kit II, manufacturer: Borui, batch number C692307003), the wells were arranged in the correct order, and total RNA was extracted using the BSC69 program. PCR reaction conditions: 50℃ for 15 minutes pre-denaturation, 95℃ for 1 minute, 95℃ for 15 seconds annealing, 60℃ for 1 minute extension, for 39 cycles. The primers were the same as in Example 2, hYJH-014 2PF and hYJH-014 2PR.
[0098] like Figure 4As shown, L96-conjugated siRNAs (YJH-014B-830 m1-L96, YJH-014B-896 m1-L96, YJH-014B-964 m1-L96, YJH-014B-1337 m1-L96, YJH-014B-1882 m2-L96, YJH-014B-ALNm1-L96) administered as a single subcutaneous injection at a dose of 3 mg / kg showed inhibitory effects on hAGT humanized mouse AGT mRNA of 2%, 6%, 0%, 3.5%, 13%, 83%, and 93% respectively on day 14 after administration. The Blank group was the untreated group. The results showed that, after subcutaneous injection, the knockdown of liver mRNA on day 14 of each sequence was consistent with the downregulation efficiency of serum AGT protein. Sequences YJH-014B-1882 m2-L96 and YJH-014B-ALN m1-L96 had better knockdown efficiency for AGT mRNA.
[0099] Example 6: Comparison of knockdown effects of m1 and m2 modified sequences in the livers of hAGT humanized mice The method for modifying siRNA with GalNAc in this implementation is the same as in Example 2.
[0100] The m1 and m2 modified sequences in Table 11 were evaluated in hAGT humanized mice.
[0101] Table 11 Description of GalNAc-modified siRNA sequences
[0102] Liver samples from hAGT-humanized mice were collected on day 7 after drug administration, and the AGT mRNA level in all samples was analyzed by RT-qPCR. Liver tissue from hAGT-humanized mice was lysed using lysis buffer (BioFlux), and chloroform (purchased from MREDA) was added for extraction. After vortexing and incubation at room temperature for 2-3 minutes, the mixture was centrifuged. The supernatant was transferred to wells and bound with binding buffer. Using a nucleic acid extractor, following the kit instructions (MagaBio Plus Total RNA Purification Kit II, manufacturer: Borui, batch number C692307003), the wells were arranged in order, and total RNA was extracted using the BSC69 program.
[0103] PCR reaction conditions: 50℃ for 15 minutes pre-denaturation, 95℃ for 1 minute, 95℃ for 15 seconds annealing, 60℃ for 1 minute extension, for 39 cycles. The reaction primers were the same as in Example 2, namely hYJH-014 2PF and hYJH-014 2PR.
[0104] like Figure 5As shown, L96-conjugated siRNAs (YJH-014B-964 m1-L96, YJH-014B-964 m2-L96, YJH-014B-1882 m1-L96, YJH-014B-1882 m2-L96), administered as a single subcutaneous injection at a dose of 3 mg / kg, exhibited inhibitory effects on AGT mRNA in hAGT humanized mice on day 7 of 14.5%, 50.5%, 41.25%, and 80.5%, respectively. The Blank group was the untreated group. These results indicate that sequences modified using the m2 method have better in vivo efficacy than those modified using the m1 method.
[0105] Example 7: Knockdown effect of GalNAc-coupled modification sequence in the liver of hAGT humanized mice The method for modifying siRNA with GalNAc in this implementation is the same as in Example 2.
[0106] In vivo evaluation of siRNAs screened from in vitro studies was performed in hAGT humanized mice. The selected sequences are shown in Table 12. The pharmacodynamic activities of the following GalNAc-conjugated siRNAs targeting AGT were analyzed in mice after subcutaneous injection of the siRNAs.
[0107] Table 12 Description of GalNAc-modified siRNA sequences
[0108] Each GalNAc-conjugated siRNA was administered as a single subcutaneous dose (3 mg / kg) on day 1 of the experiment. Liver samples from hAGT-humanized mice were collected on day 7 after administration, and AGT mRNA levels in all samples were analyzed by RT-qPCR. Liver tissue from hAGT-humanized mice was lysed using lysis buffer (BioFlux), and extracted with chloroform (MREDA). After vortexing and incubation at room temperature for 2–3 minutes, the mixture was centrifuged. The supernatant was transferred to wells and bound with binding buffer. Using a nucleic acid extractor, following the kit instructions (MagaBio Plus Total RNA Purification Kit II, manufacturer: Borui, batch number C692307003), the wells were arranged in the correct order, and total RNA was extracted using the BSC69 program.
[0109] PCR reaction conditions: 50℃ for 15 minutes pre-denaturation, 95℃ for 1 minute, 95℃ for 15 seconds annealing, 60℃ for 1 minute extension, for 39 cycles. The reaction primers were the same as in Example 2, namely hYJH-014 2PF and hYJH-014 2PR.
[0110] like Figure 6As shown, L96-conjugated siRNAs (YJH-014B-896m2-L96, YJH-014B-1337m2-L96, YJH-014B-1861m2-L96, YJH-014B-1867m2-L96, YJH-014B-1882m2-L96, YJH-014B-ALNm1-L96) administered as a single subcutaneous injection at a dose of 3 mg / kg showed inhibitory effects on AGT mRNA in hAGT humanized mice of 54%, 48%, 78%, 81%, 86%, and 94%, respectively, after 7 days of administration. The Blank group was the untreated group. The results indicate that subcutaneous injection of GalNAc-conjugated siRNA can downregulate AGT mRNA expression.
[0111] Example 8: Protein inhibitory effect of GalNAc-coupled modification sequence in the serum of hAGT humanized mice The method for modifying siRNA with GalNAc in this implementation is the same as in Example 2.
[0112] In vivo evaluation of siRNAs screened from in vitro studies was performed in hAGT humanized mice. The selected sequences are shown in Table 13. The pharmacodynamic activities of the following GalNAc-conjugated siRNAs targeting AGT were analyzed in mice after subcutaneous injection of the siRNAs.
[0113] Table 13. Description of GalNAc-modified siRNA sequences
[0114] Each GalNAc-conjugated siRNA was administered as a single subcutaneous dose (3 mg / kg) on day 1 of the experiment. Whole blood samples were collected from mice on day 7 after administration. After blood clotted, serum was collected by centrifugation at 3000 rpm for 10 minutes at 4°C. AGT protein levels in serum samples from each group were detected using a human AGT ELISA kit.
[0115] like Figure 7As shown, L96-conjugated siRNAs (YJH-014B-896m2-L96, YJH-014B-1337m2-L96, YJH-014B-1861m2-L96, YJH-014B-1867m2-L96, YJH-014B-1882m2-L96, YJH-014B-ALNm1-L96) administered as a single subcutaneous injection at a dose of 3 mg / kg showed inhibitory effects on serum AGT protein in humanized hAGT mice of 37%, 41%, 70%, 71%, 74%, and 82%, respectively, after 7 days of administration. The Blank group was the untreated group. The results indicate that subcutaneous injection of GalNAc-conjugated siRNA can downregulate serum hAGT protein in mice.
[0116] Example 9: Knockdown effect of GalNAc-coupled modification sequence in primary monkey hepatocytes The method for modifying siRNA with GalNAc in this implementation is the same as in Example 2.
[0117] 1) Resuscitate primary monkey hepatocytes (purchased from Miaoshun Biotechnology Co., Ltd.), collect cells by centrifugation, resuspend cells in plating medium, count cells using a hemocytometer, and then add 500,000 cells to each well of a 24-well cell culture plate for culture.
[0118] 2) Transfect with GalNAc coupling modification sequences, using the sequences shown in Table 14.
[0119] Table 14. Description of GalNAc-coupled modified siRNA sequences
[0120] 3) Add 500 nM of the corresponding group's siRNA solution to each well.
[0121] 4) After culturing for 72 hours, discard the culture medium and extract the cell RNA.
[0122] 5) Prepare the qPCR system and perform it on ice. Add 1 μl One Step SYBR Green Mix (Novizan) and 10 μl 2... to each well. One-Step SYBR Green Mix (Novizan), 0.4 μl hYJH-014 2PF (SEQ ID NO. 104), and 0.4 μl hYJH-014 2PR (SEQ ID NO. 209) were used. 100 ng of RNA was diluted in 8.2 μl RNase ddH2O (Novizan) and added to each well. The mixture was then placed in a qPCR instrument for reaction. PCR reaction conditions: 50℃ for 15 min pre-denaturation, 95℃ for 1 min, 95℃ for 15 sec annealing, and 60℃ for 1 min extension, for 39 cycles.
[0123] like Figure 8 As shown, among the L96-conjugated siRNAs, YJH-014B-1861 m2-L96, YJH-014B-1867 m2-L96, YJH-014B-1882 m2-L96, and YJH-014B-ALN m1-L96 exhibited inhibitory effects of 79%, 87%, 56%, and 89% respectively in primary monkey hepatocytes, with the Blank group being the untreated group. The results indicate that each siRNA had a significant inhibitory effect in primary monkey hepatocytes.
[0124] Example 10: Knockdown effect of GalNAc-coupled modification sequence in human primary hepatocytes The method for modifying siRNA with GalNAc in this implementation is the same as in Example 2.
[0125] 1) Resuscitate human primary hepatocytes (purchased from Livo Biotechnology (Shenzhen) Co., Ltd.), collect cells by centrifugation, resuspend cells in plating medium, count cells using a hemocytometer, and then add 500,000 cells to each well of a 12-well cell culture plate for culture.
[0126] 2) Transfect with GalNAc coupling modification sequences, using the sequences shown in Table 14.
[0127] 3) Add 500 nM of the corresponding group's siRNA solution to each well.
[0128] 4) After culturing for 72 hours, discard the culture medium and extract the cell RNA.
[0129] 5) Prepare the qPCR system and perform it on ice. Add 1 μl One Step SYBR Green Mix (Novizan) and 10 μl 2... to each well. One-Step SYBR Green Mix (Novizan), 0.4 μl hYJH-014 2PF (SEQ ID NO. 104), and 0.4 μl hYJH-014 2PR (SEQ ID NO. 209) were used. 100 ng of RNA was diluted in 8.2 μl RNase ddH2O (Novizan) and added to each well. The mixture was then placed in a qPCR instrument for reaction. PCR reaction conditions: 50℃ for 15 min pre-denaturation, 95℃ for 1 min, 95℃ for 15 sec annealing, and 60℃ for 1 min extension, for 39 cycles.
[0130] like Figure 9 As shown, among the L96-conjugated siRNAs, YJH-014B-1861 m2-L96, YJH-014B-1867 m2-L96, YJH-014B-1882 m2-L96, and YJH-014B-ALN m1-L96 exhibited inhibitory effects of 57%, 65%, 61%, and 67% respectively in human primary hepatocytes, with the Blank group being the untreated group. The results indicate that each siRNA demonstrated a significant inhibitory effect in human primary hepatocytes.
[0131] Example 11: Duration of efficacy of GalNAc-coupled sequences in a humanized hAGT mouse model of hypertension The method for modifying siRNA with GalNAc in this implementation is the same as in Example 2.
[0132] The durability of siRNA efficacy was evaluated in a humanized hAGT mouse model of hypertension, using sequences from Table 15. Following subcutaneous injection of siRNA, the pharmacodynamic activity of the following GalNAc-conjugated siRNAs targeting AGT was analyzed in mice.
[0133] Table 15. Description of GalNAc-modified siRNA sequences
[0134] 1) Modeling was performed 14 days before administration. Mice were intravenously injected with AAV-hRENIN to induce hypertension, while the control group was given blank AAV vector. Each GalNAc-conjugated siRNA was administered at one dose concentration (20 mg / kg) via a single subcutaneous injection on the first day of the experiment.
[0135] 2) Systolic blood pressure, diastolic blood pressure, and mean arterial pressure of mice in each group were measured on days -15, -1, 7, 14, 21, and 28 after the start of the experiment.
[0136] like Figure 10As shown, subcutaneous injection of 20 mg / kg of L96-conjugated siRNAs (YJH-014B-1861 m2-L96, YJH-014B-1867 m2-L96, YJH-014B-1882 m2-L96, YJH-014B-ALN m1-L96) can maintain a long-term reduction in blood pressure levels in hAGT humanized hypertensive model mice for 28 days. The Blank group (blank group) consisted of healthy mice, while the Model group consisted of hypertensive model mice that did not receive the drug.
[0137] Example 12: Pharmacodynamic evaluation of multiple-dose administration of GalNAc-coupled sequences in a humanized hAGT mouse model of hypertension. The method for modifying siRNA with GalNAc in this implementation is the same as in Example 2.
[0138] The efficacy of siRNA was evaluated through multiple-dose administration in a humanized hAGT mouse model of hypertension, using sequences from Table 16. Following subcutaneous injection of siRNA, the pharmacodynamic activity of the following GalNAc-conjugated siRNAs targeting AGT was analyzed in mice.
[0139] Table 16. Description of GalNAc-modified siRNA sequences
[0140] 1) Modeling was performed 21 days before administration. Mice were intravenously injected with AAV-hRENIN to induce hypertension, while the control group was given blank AAV vector. GalNAc-conjugated siRNA was administered at three concentrations (5 mg / kg, 10 mg / kg, and 20 mg / kg) via single subcutaneous injection on day 1 of the experiment.
[0141] 2) On days D-2, D7, D14, D21 and D28 after the start of the experiment, the systolic blood pressure, diastolic blood pressure and mean arterial pressure of each group of mice were measured.
[0142] like Figure 11 As shown, different doses of YJH-014-1882-m2 can effectively lower blood pressure, with 20 mpk showing the best effect. YJH-014-1882-m2 at 10 mpk can achieve the same blood pressure lowering effect as 20 mpk after 28 days of administration. There is a dose-dependent relationship between YJH-014 and the blood pressure lowering effect. The Blank group (blank group) consists of healthy mice, and the Model group consists of hypertensive model mice that are not given any medication.
[0143] 3) On day 29 after drug administration, liver samples from hAGT humanized mice were collected, and the AGT mRNA level in all samples was analyzed by RT-qPCR. The hAGT humanized mouse liver tissue was lysed using lysis buffer (BioFlux), and chloroform (MREDA) was added for extraction. After vortexing and mixing, the mixture was incubated at room temperature for 2-3 minutes, centrifuged, and the supernatant was transferred to a well plate and bound with binding buffer. Using a nucleic acid extractor, following the kit instructions (MagaBio Plus Total RNA Purification Kit II, manufacturer: Borui, batch number C692307003), the well plates were arranged in order, and total RNA was extracted using the BSC69 program.
[0144] PCR reaction conditions: 50℃ for 15 minutes pre-denaturation, 95℃ for 1 minute, 95℃ for 15 seconds annealing, 60℃ for 1 minute extension, for 39 cycles. The reaction primers were the same as in Example 2, namely hYJH-014 2PF and hYJH-014 2PR.
[0145] like Figure 12 As shown, YJH-014B-1882 m2-L96, administered via single subcutaneous injection at doses of 5 mg / kg, 10 mg / kg, and 20 mg / kg, respectively, showed a dose-dependent inhibitory effect on AGT mRNA in humanized hypertensive model mice after 28 days of administration, with inhibition rates of 73%, 82%, and 89%, respectively. The Blank group (blank group) consisted of healthy mice, while the Model group consisted of hypertensive model mice that did not receive the drug. These results indicate that subcutaneous injection of GalNAc-conjugated siRNA can dose-dependently downregulate AGT mRNA expression.
[0146] 4) Whole blood samples were collected from hAGT-humanized mice on day 29 after drug administration. After the blood clotted, serum was collected by centrifugation at 3000 rpm for 10 minutes at 4°C. The hAGT protein level in the serum samples of each group was detected using a human AGT ELISA kit (Lianke Biotechnology).
[0147] like Figure 13 As shown, YJH-014B-1882 m2-L96, administered via single subcutaneous injection at doses of 5 mg / kg, 10 mg / kg, and 20 mg / kg, respectively, showed a dose-dependent inhibitory effect on hAGT protein in humanized hypertensive model mice after 28 days of administration, with inhibition rates of 73%, 79%, and 82%, respectively. The Blank group (blank group) consisted of healthy mice, while the Model group consisted of hypertensive model mice that did not receive the drug. These results indicate that subcutaneous injection of GalNAc-conjugated siRNA can dose-dependently downregulate hAGT protein expression.
[0148] Example 13: Comparison of knockdown effects of GalNAc coupled with different modified sequences The method for modifying siRNA with GalNAc in this implementation is the same as in Example 2.
[0149] 1) Human liver cancer cells HepG2 (cell bank of Kunming Institute of Cell Bank, Chinese Academy of Sciences) in logarithmic growth phase were digested with trypsin, and digestion was terminated with complete medium supplemented with 10% FBS. Cells were collected by centrifugation, resuspended in medium supplemented with 10% FBS, counted with a hemocytometer, and then 50,000 cells were added to each well of a 24-well cell culture plate for culture.
[0150] 2) Preparation of the LipoRNAiMAX (invitrogen) and siRNA mixture. The sense and antisense strand sequences of the siRNA are shown in Table 17. 10 nM / well of siRNA and 1.5 μl of LipoRNAiMAX (invitrogen) were diluted separately in 25 μl of serum-free culture medium (Opti-MEM, purchased from Gibco). The siRNA solution was then mixed with the LipoRNAiMAX (invitrogen) solution and incubated at room temperature for 5 minutes.
[0151] Table 17 Description of GalNAc-modified siRNA sequences
[0152] 3) Add 50 μl of the corresponding group's siRNA and LipoRNAiMAX (invitrogen) mixed solution to each well.
[0153] 4) After culturing for 48 hours, discard the culture medium and extract the cell RNA.
[0154] 5) Prepare the qPCR system and perform it on ice. Add 1 μl One Step SYBR Green Mix (Novizan) and 10 μl 2... to each well. One-Step SYBR Green Mix (Novizan), 0.4 μl hYJH-014 2PF (SEQ ID NO.104: ACAATGAGAGTACCTGTGAGCA), and 0.4 μl hYJH-014 2PR (SEQ ID NO.209: TCTTGGCCTGAATTGGAGCAG) were used. 100 ng of RNA was diluted in 8.2 μl RNase ddH2O (Novizan) and added to each well. The mixture was then placed in a qPCR instrument for reaction. PCR reaction conditions: 50℃ for 15 min pre-denaturation, 95℃ for 1 min, 95℃ for 15 sec annealing, and 60℃ for 1 min extension, for 39 cycles. The inhibition rates of each L96-conjugated siRNA against ATG mRNA are shown in Table 18.
[0155] Table 18 Inhibition results of GalNAc coupled with different modified siRNAs
[0156] As shown in Table 18 and Figure 14 As shown, L96 conjugated with different modified siRNAs, YJH-014B-1882 m2-L96, YJH-014B-1882 m4-L96, YJH-014B-1882 m5-L96, YJH-014B-1882 m6-L96, and YJH-014B-1882 m7-L96, exhibited inhibitory effects of 93%, 66%, 89%, 29%, and 65%, respectively. The Blank group was the untreated group. The results indicate that the m2 modification method performed best.
[0157] Example 14: Comparison of knockdown effects of GalNAc-modified siRNA and different concentrations of *Gynostemma pentaphyllum* The method for modifying siRNA with GalNAc in this implementation is the same as in Example 2.
[0158] 1) Human liver cancer cells HepG2 (cell bank of Kunming Institute of Cell Bank, Chinese Academy of Sciences) in logarithmic growth phase were digested with trypsin, and digestion was terminated with complete medium supplemented with 10% FBS. Cells were collected by centrifugation, resuspended in medium supplemented with 10% FBS, counted with a hemocytometer, and then 50,000 cells were added to each well of a 24-well cell culture plate for culture.
[0159] 2) Preparation of the LipoRNAiMAX (invitrogen) and siRNA mixture. The sense and antisense strand sequences of the siRNA are shown in Table 19. Dilute 10 nM or 1 nM of siRNA and 1.5 μl of LipoRNAiMAX (invitrogen) in 25 μl of serum-free culture medium (Opti-MEM, purchased from Gibco) respectively. Then mix the above siRNA solution with the LipoRNAiMAX (invitrogen) solution and incubate at room temperature for 5 minutes.
[0160] Table 19. Description of GalNAc-modified siRNA sequences
[0161] 3) Add 50 μl of the corresponding group's siRNA and LipoRNAiMAX (invitrogen) mixed solution to each well.
[0162] 4) After culturing for 48 hours, discard the culture medium and extract the cell RNA.
[0163] 5) Prepare the qPCR system and perform it on ice. Add 1 μl One Step SYBR Green Mix (Novizan) and 10 μl 2... to each well. One-step SYBR Green Mix (Novizan), 0.4 μl hYJH-014 2PF (SEQ ID NO.104: ACAATGAGAGTACCTGTGAGCA), 0.4 μl hYJH-014 2PR (SEQ ID NO.209: TCTTGGCCTGAATTGGAGCAG), and 100 ng RNA diluted in 8.2 μl RNase ddH2O (Novizan) were added to the wells, mixed well, and placed in a qPCR instrument for reaction. PCR reaction conditions: 50℃, 15 min pre-denaturation, 95℃, 1 min, 95℃ annealing for 15 sec, 60℃ extension for 1 min, for 39 cycles. The inhibition rate of each L96-coupled siRNA against ATG mRNA is shown in Table 20.
[0164] Table 20 Inhibition results of GalNAc-modified siRNA at different concentrations
[0165] As shown in Table 20 and Figure 15As shown, the L96-conjugated siRNA YJH-014B-1882 m2-L96 exhibited 91% and 94% inhibitory effects at 1 nM and 10 nM, respectively. At 1 nM, it was superior to Yangshen YJH-014B-ALN m1-L96, with the Blank group being the untreated group. The results indicate that YJH-014B-1882 m2-L96 performed better.
[0166] Example 15: Evaluation of GalNAc-coupled sequence knockdown in a cynomolgus monkey model of hypertension The method for modifying siRNA with GalNAc in this implementation is the same as in Example 2.
[0167] Single-dose knockdown of siRNA was evaluated in a cynomolgus monkey hypertension model, using sequences listed in Table 21. Following subcutaneous injection of siRNA, the blood pressure pharmacodynamic activity of the following GalNAc-conjugated siRNAs targeting AGT was analyzed in cynomolgus monkeys.
[0168] Table 21 Description of GalNAc-modified siRNA sequences
[0169] 1) Whole blood samples were collected on day 14 (14 days before administration), and liver tissue samples were obtained by liver biopsy. The expression levels of AGT protein and mRNA were measured and used as baseline data. Each GalNAc-conjugated siRNA test substance was administered as a single subcutaneous dose (3 mg / kg) on day 0.
[0170] 2) Whole blood samples were collected from cynomolgus monkeys on days 14, 21, 28, 35, 42, 60, 75, and 90 after drug administration. After the blood clotted, serum was collected by centrifugation at 3000 rpm for 10 minutes at 4°C. The AGT protein level in the serum samples of each group was detected using a human AGT ELISA kit.
[0171] like Figure 16As shown in Table 22, L96-conjugated siRNAs (YJH-014B-1861 m2-L96, YJH-014B-1867 m2-L96, and YJH-014B-1882 m2-L96) were administered via a single subcutaneous injection at a dose of 3 mg / kg. After administration, compared to their respective baselines on D-14, the YJH-014B-1861 m2-L96 group showed inhibition of AGT protein in monkey serum starting from D14, reaching a maximum inhibition rate (50.32%) on D21, and stabilizing at approximately 33% on D60; the YJH-014B-1867 m2-L96 group showed similar inhibition. The m2-L96 group inhibited AGT protein in monkey serum starting from day 14, reaching a maximum inhibition rate of 37.64% on day 35, and stabilizing at around 25% on day 60. Similarly, the YJH-014B-1882 m2-L96 group also inhibited AGT protein in monkey serum starting from day 14, reaching a maximum inhibition rate of 72.81% on day 28, and stabilizing at around 34% on day 75. These results indicate that subcutaneous injection of GalNAc-conjugated siRNA can downregulate AGT protein in cynomolgus monkey serum, with the YJH-014B-1882 m2-L96 group showing the best performance.
[0172] Table 22. Inhibition rate of AGT protein in monkey liver at different time points using GalNAc-conjugated siRNAs.
[0173] 3) Cynomolgus monkey liver samples were collected on days 21, 42, and 90 after drug administration. AGT mRNA levels in all samples were analyzed by RT-qPCR. Cynomolgus monkey liver tissue was lysed using lysis buffer (BioFlux), and chloroform (MREDA) was added for extraction. After vortexing and incubation at room temperature for 2-3 minutes, the mixture was centrifuged. The supernatant was transferred to wells and bound with binding buffer. Using a nucleic acid extractor, following the kit instructions (MagaBio Plus Total RNA Purification Kit II, manufacturer: Borui, batch number C692307003), the wells were arranged in order, and total RNA was extracted using the BSC69 program.
[0174] Prepare the qPCR system and perform it on ice. Add 1 μl One Step SYBR Green Mix (Novizan) and 10 μl 2... to each well. One-Step SYBR Green Mix (Novizan), 0.4 μl mkYJH-014 2PF (SEQ ID NO. 104: ACAATGAGAGTACCTGTGAGCA), 0.4 μl mkYJH-014 2PR (SEQ ID NO. 267: GTGCCAAAGACAGCCGTTGG), 100 ng RNA diluted in 8.2 μl RNase ddH2O (Novizan) was added to the wells, mixed well, and placed in a qPCR instrument for reaction. PCR reaction conditions: 50℃, 15 min pre-denaturation, 95℃, 1 min, 95℃ annealing for 15 sec, 60℃ extension for 1 min, for 39 cycles.
[0175] like Figure 17 As shown in Table 23, compared with their respective baselines on D-14, the YJH-014B-1861 m2-L96 group showed inhibition of AGT mRNA in monkey liver tissue from D21, reaching a maximum inhibition rate of 45.59% on D42, and returning to baseline levels on D90. Due to significant differences between groups, there was no significant inhibition compared to D-14. The YJH-014B-1867 m2-L96 group showed no significant inhibition from administration to D90. The YJH-014B-1882 m2-L96 group showed inhibition of AGT mRNA in monkey liver tissue from D21, reaching a maximum of 38.83% and maintaining this level until D42. By D90, AGT mRNA levels in monkey liver tissue had essentially returned to baseline levels. These results indicate that subcutaneous injection of GalNAc-conjugated siRNA can dose-dependently downregulate AGT mRNA expression.
[0176] Table 23 Inhibition rate of AGT mRNA in monkey liver at different time points using GalNAc-coupled siRNA
[0177] Example 16: Duration of Blood Pressure Efficacy of GalNAc Coupled Sequence in a Cynomolgus Monkey Hypertension Model The method for modifying siRNA with GalNAc in this implementation is the same as in Example 2.
[0178] The blood pressure efficacy of single-dose siRNA administration was evaluated in a cynomolgus monkey hypertension model, using sequences from Table 24. Following subcutaneous injection of siRNA, the blood pressure pharmacodynamic activity of the following GalNAc-conjugated siRNAs targeting AGT was analyzed in cynomolgus monkeys.
[0179] Table 24. Description of GalNAc-modified siRNA sequences
[0180] 1) The GalNAc-conjugated siRNA was administered at a dose concentration of 3 mg / kg via a single subcutaneous injection on day D0 of the experiment.
[0181] 2) After the start of the experiment, the systolic blood pressure, diastolic blood pressure, and mean arterial pressure of each group of cynomolgus monkeys were measured on day 1 before drug administration (D-1), and on days 2, 7, 21, 42, and 60 after drug administration.
[0182] like Figure 18 As shown, after a single subcutaneous injection of L96-conjugated siRNAs (YJH-014B-1882 m2-L96 and YJH-014B-ALN m1-L96) at a dose of 3 mg / kg, compared with D-1, the blood pressure of cynomolgus monkeys decreased over time after a single dose. Among them, YJH-014B-1882 m2-L96 was superior to YJH-014B-ALN m1-L96, indicating that YJH-014B-1882 m2-L96 had the best antihypertensive effect.
[0183] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, and is not intended to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions made by those skilled in the art to the technical solution of the present invention do not depart from the essence and scope of the technical solution of the present invention.
Claims
1. A double-stranded ribonucleic acid (dsRNA) agent or a salt thereof for inhibiting angiotensinogen (AGT) expression, characterized in that, The dsRNA agent comprises a sense strand and an antisense strand that form a double-stranded region through base pairing. The sense strand is selected from SEQ ID NO. 1-102 or its modified sequence, and the antisense strand is selected from SEQ ID NO. 106-207 or its modified sequence.
2. The dsRNA agent or its salt according to claim 1, characterized in that, At least one nucleotide in the sense strand or the antisense strand is a modified nucleotide.
3. The dsRNA agent or its salt according to claim 2, characterized in that, At least one nucleotide in the sense strand or the antisense strand is a nucleotide analog or a nucleotide with a hydroxyl group modified at the 2' position of the ribosyl group; the nucleotide analog includes isonucleotides, LNA, ENA, cEt-BNA, UNA, or GNA; the nucleotide with a hydroxyl group modified at the 2' position of the ribosyl group includes nucleotides modified with 2'-O-methyl, 2'-O-methoxyethyl, 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl, 2'-O-dimethylaminoethyl, 2'-O-dimethylaminopropyl, T0-dimethylaminoethoxyethyl, or 2'-ON-methylacetamide.
4. The dsRNA agent or its salt according to claim 2, characterized in that, At least one phosphate group in the sense chain or the antisense chain is a phosphate group with a modifying group.
5. The dsRNA agent or its salt according to claim 3 or 4, characterized in that, The sense chain is selected from the modification sequences shown in SEQ ID NO. 211-233, and the antisense chain is selected from the modification sequences shown in SEQ ID NO. 235-257; wherein m represents 2'-O-methyl substitution modification, f represents 2'-fluorination modification, and s represents thiosclerosis modification.
6. The dsRNA agent or its salt according to claim 5, characterized in that, The dsRNA sequence is selected from one of the following dsRNA sequences: A) YJH-014B-1861 m2, whose sense strand nucleotide sequence is shown in SEQ ID NO.229: fU-s-mG-s-fU-mG-fA-mA-fA-fC-fA-mA-fA-mA-fA-mA-fG-mU-fG-mU-fG-mU-fU, and whose antisense strand nucleotide sequence is shown in SEQ ID NO.253: mA-s-fA-s-mC-fA-mC-fU-mU-mU-fU-mU-mU-mG-mU-fU-mU-fC-mA-fC-mA-s-mA-s-mA; B) YJH-014B-1867 m2, whose sense strand nucleotide sequence is shown in SEQ ID NO.231: fA-s-mC-s-fA-mA-fA-mA-fA-fA-fG-mU-fG-mU-fU-mC-fC-mC-fU-mU-fU, and whose antisense strand nucleotide sequence is shown in SEQ ID NO.255: mA-s-fA-s-mA-fG-mG-fG-mA-mC-fA-mC-mU-mU-fU-mU-fU-mU-fG-mU-s-mU-s-mU; C) YJH-014B-1882 m2, whose sense strand nucleotide sequence is shown in SEQ ID NO.233: fC-s-mU-s-fU-mU-fU-mC-fA-fA-fG-mU-fU-mG-fA-mG-fA-mA-fC-mA-fA, and whose antisense strand nucleotide sequence is shown in SEQ ID NO.257: mU-s-fU-s-mG-fU-mU-fC-mU-fC-mA-fA-mC-mU-mU-fG-mA-fA-mA-mG-s-mG-s-mG-s-mG; Where mA, mG, mC, and mU are 2'-O-methyl modified A, G, C, and U, respectively; fA, fG, fC, and fU are 2'-fluorine modified A, G, C, and U, respectively; and s represents thiophosphate linkage.
7. The dsRNA agent or its salt according to claim 1, characterized in that, The dsRNA agent or its salt also includes a ligand.
8. The dsRNA agent or its salt according to claim 7, characterized in that, The ligand is conjugated to the 3' end of the positive strand of the dsRNA agent or its salt.
9. The dsRNA agent or a salt thereof according to claim 7 or 8, characterized in that, The ligands include monoclonal antibodies, biclonal antibodies, monosaccharides, polysaccharides, and cationic polymers.
10. The dsRNA agent or a salt thereof according to claim 9, characterized in that, The ligand is N-acetylgalactosamine (GalNAc) or a derivative thereof.
11. The dsRNA agent or a salt thereof according to claim 10, characterized in that, The ligand is one or more GalNAc derivatives attached via monovalent, divalent, or trivalent branching junctions.
12. The dsRNA agent or a salt thereof according to claim 11, characterized in that, The ligand has the following structural formula: 。 13. The dsRNA agent or a salt thereof according to claim 12, characterized in that, The ligand is L96, and L96 is N-[tris(GalNAc-alkyl)-amide-decanoyl]-4-hydroxyprolyl.
14. The dsRNA agent or a salt thereof according to claim 13, characterized in that, The dsRNA agent or its salt is conjugated to the ligand as shown in the following formula: , where X is O or S.
15. The dsRNA agent or a salt thereof according to claim 14, characterized in that, X is O.
16. A cell, characterized in that, The cell contains the dsRNA agent or a salt thereof as described in any one of claims 1-15.
17. A pharmaceutical composition for inhibiting the expression of a gene encoding AGT, characterized in that, The pharmaceutical composition comprises the dsRNA agent as described in any one of claims 1-15 or a salt thereof.
18. A reagent kit, characterized in that, The kit contains the dsRNA agent or a salt thereof as described in any one of claims 1-15, or the pharmaceutical composition as described in claim 17.
19. The use of the dsRNA agent or salt thereof according to any one of claims 1-15, or the pharmaceutical composition according to claim 17, or the kit according to claim 18 in the preparation of a medicament for inhibiting AGT expression in cells or in the preparation of a medicament for treating hypertension.
Citation Information
Patent Citations
SiRNA for simultaneously inhibiting expression of two target genes, medicine and application of siRNA and medicine
CN119040325A