Application of tomato phospholipase d gene PLD alpha 1 and PLD alpha 3 and gene editing vector thereof

CN122609575APending Publication Date: 2026-08-21NANJING AGRICULTURAL UNIVERSITY
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202610760298.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-05-29
Publication Date
2026-08-21

AI Technical Summary

Technical Problem

[0004]然而,关于PLD基因在番茄中的功能研究仍然十分有限

Benefits of technology

[0016] Beneficial Effects: This invention utilizes CRISPR/Cas9 gene editing of the tomato phospholipase D genes PLDα1 and PLDα3. Based on the targeting sgRNA fragments of PLDα1 and PLDα3, a CRISPR/Cas9 gene editing vector 2300GN-Ubi-Cas9-PLDα1/α3 targeting both PLDα1 and PLDα3 was constructed. This vector was transfected into transgenic engineered bacteria and then transferred into tomatoes, yielding homozygous double mutant lines of PLDα1 and PLDα3. The gene editing vector 2300GN-Ubi-Cas9-PLDα1/α3 constructed using this invention produces tomato plants with smaller fruits. The homozygous double mutant lines of PLDα1 and PLDα3 have smaller fruits than wild-type (WT) tomatoes, which is of great significance for regulating tomato yield and optimizing planting management.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122609575A_ABST
    Figure CN122609575A_ABST
Patent Text Reader

Abstract

The application discloses tomato phospholipase D genes PLDalpha1 and PLDalpha3 and application of gene editing vectors thereof, the gene editing vector is 2300GN-Ubi-Cas9-PLDalpha1 / alpha3, sgRNA-1 targeting PLDalpha1, sgRNA-2 targeting PLDalpha3, AtU3d promoter, AtU3b promoter and sgRNA skeleton.Based on 2300GN-Ubi-Cas9-PLDalpha1 / alpha3, tomato plants with reduced fruits can be obtained, which has important significance for regulating tomato yield and optimizing planting management.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, and in particular to the application of tomato phospholipase D genes PLDα1 and PLDα3 and their gene editing vectors. Background Technology

[0002] Phospholipase D (PLD) is a key enzyme in plant phospholipid metabolism, belonging to the phospholipid hydrolase superfamily. It catalyzes the hydrolysis of phosphatidylcholine and other structural phospholipids to produce phosphatidic acid (PA) and its corresponding free head group. PLD and its product PA play important signal regulation roles in plant growth and development, abiotic stress response, and various physiological processes, participating in cell membrane remodeling, signal transduction, stomatal movement regulation, and programmed cell death.

[0003] Studies have shown that PLD activity is closely related to fruit ripening and postharvest quality in terms of fruit development. PLD activity dynamically changes during tomato fruit ripening, and its hydrolysis product, phosphatidic acid (PA), accumulates in the fruit's membrane lipid metabolism. During postharvest low-temperature storage, PLD activity is activated by membrane hardening, leading to membrane lipid degradation and cell structure damage, which is one of the important mechanisms of chilling injury in tomato fruits.

[0004] However, research on the function of the PLD gene in tomatoes remains very limited. Existing studies mainly focus on the regulation of tomato ripening and postharvest quality by PLD, while the mechanism of PLD's role in tomato growth and development remains unclear, and its involvement in the molecular mechanisms of tomato yield formation has not been explored in depth. Summary of the Invention

[0005] Objective: In order to overcome the shortcomings of the existing technology, this invention provides the application of tomato phospholipase D genes PLDα1 and PLDα3 and their gene editing vectors to obtain tomato plants with reduced fruit size.

[0006] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows:

[0007] In a first aspect, the present invention provides sgRNAs targeting the tomato phospholipase D genes PLDα1 and PLDα3, wherein the sgRNAs include sgRNA-1, which targets PLDα1 with a nucleotide sequence as shown in SEQ ID NO.1, and sgRNA-2, which targets PLDα3 with a nucleotide sequence as shown in SEQ ID NO.3.

[0008] In a second aspect, the present invention provides a method for regulating tomato yield-related traits, wherein the tomato yield-related traits include tomato fruit size, fruit quantity, and plant height; the method includes: using CRISPR / Cas9 gene editing technology, knocking out tomato phospholipase D genes PLDα1 and PLDα3 using sgRNA as described in the first aspect, and screening to obtain tomato plants with smaller fruit size, fewer fruit quantity, and lower plant height.

[0009] In some embodiments, the method further includes: Construct a dual-target gene editing vector for the tomato phospholipase D gene PLDα1 and PLDα3; A dual-target gene editing vector was introduced into a host cell to obtain engineered host cell bacteria; The engineered bacteria in the host cell were transfected into tomato cotyledon explants, and the pldα1α3 tomato lines without transgenes and with homozygous mutations at both the PLDα1 and PLDα3 target sites were screened to obtain the pldα1α3 tomato lines. The pldα1α3 tomato line was placed in a plant growth chamber to cultivate tomato plants with smaller fruits, fewer fruits, and shorter plant height.

[0010] In some embodiments, the dual-target gene editing vector for the tomato phospholipase D genes PLDα1 and PLDα3 is 2300GN-Ubi-Cas9-PLDα1 / α3, and the method for constructing 2300GN-Ubi-Cas9-PLDα1 / α3 includes: The AtU3d promoter, the sgRNA-1 sequence shown in SEQ ID NO.1, and the sgRNA backbone sequence were sequentially linked to construct sgRNA-PLDα1 as shown in SEQ ID NO.2; The AtU3b promoter, the sgRNA-2 sequence shown in SEQ ID NO.3, and the sgRNA backbone sequence were sequentially linked to construct sgRNA-PLDα3 as shown in SEQ ID NO.4; sgRNA-PLDα1 and sgRNA-PLDα3 were inserted between the SbfI and SmaI restriction sites of the 2300GN-Ubi-Cas9 vector to obtain 2300GN-Ubi-Cas9-PLDα1 / α3.

[0011] The 2300GN-Ubi-Cas9 vector sequence has been disclosed in the Chinese patent "CRISPR / Cas9 vector with visual protein fusion antibiotic screening marker and its construction method and application" (publication number CN114807198A).

[0012] In some embodiments, the host cell is Agrobacterium tumefaciens EHA105.

[0013] In some embodiments, the method for introducing the dual-target gene editing vector into host cells is a freeze-thaw method.

[0014] Thirdly, the present invention provides the application of the method described in the second aspect in cultivating tomato plants with reduced fruit size, reduced fruit quantity, and reduced plant height.

[0015] Fourthly, the present invention provides the application of the dual-target gene editing vector 2300GN-Ubi-Cas9-PLDα1 / α3 constructed according to the construction method of 2300GN-Ubi-Cas9-PLDα1 / α3 as described in the second aspect in cultivating tomato plants with reduced fruit size, reduced fruit quantity, and reduced plant height.

[0016] Beneficial Effects: This invention utilizes CRISPR / Cas9 gene editing of the tomato phospholipase D genes PLDα1 and PLDα3. Based on the targeting sgRNA fragments of PLDα1 and PLDα3, a CRISPR / Cas9 gene editing vector 2300GN-Ubi-Cas9-PLDα1 / α3 targeting both PLDα1 and PLDα3 was constructed. This vector was transfected into transgenic engineered bacteria and then transferred into tomatoes, yielding homozygous double mutant lines of PLDα1 and PLDα3. The gene editing vector 2300GN-Ubi-Cas9-PLDα1 / α3 constructed using this invention produces tomato plants with smaller fruits. The homozygous double mutant lines of PLDα1 and PLDα3 have smaller fruits than wild-type (WT) tomatoes, which is of great significance for regulating tomato yield and optimizing planting management. Attached Figure Description

[0017] Figure 1 This is a map of the dual-target carrier constructed in Embodiment 2 of the present invention.

[0018] Figure 2 The image shows actual plants of WT and homozygous double mutant lines in the reproductive growth stage in Example 5 of this invention.

[0019] Figure 3 This is a statistical result chart of the number of flowers during the reproductive growth period of tomatoes in Example 5 of the present invention.

[0020] Figure 4 This is a photograph of the size of a tomato fruit at the red ripening stage in Example 5 of the present invention.

[0021] Figure 5 This is a statistical diagram of the longitudinal diameter of the tomato fruit at different stages of growth and development in Example 5 of the present invention.

[0022] Figure 6 This is a statistical chart of the transverse diameter of tomatoes at different stages of growth and development in Example 5 of the present invention.

[0023] In the figure: WT is the wild-type tomato variety Micro-Tom, and pldα1α3-1 and pldα1α3-2 are two homozygous double mutant lines obtained by CRISPR / Cas9 gene editing. Detailed Implementation

[0024] The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. The following description of at least one exemplary embodiment is merely illustrative and is in no way intended to limit the present invention or its application or use.

[0025] Unless otherwise specifically stated, the relative arrangement, numerical expressions, and values ​​of the components and steps set forth in these embodiments do not limit the scope of the invention. It should also be understood that, for ease of description, the dimensions of the various parts shown in the drawings are not drawn to actual scale. Techniques, methods, and devices known to those skilled in the art may not be discussed in detail, but where appropriate, such techniques, methods, and devices should be considered part of the specification. In all examples shown and discussed herein, any specific values ​​should be interpreted as merely exemplary and not as limitations. Therefore, other examples of exemplary embodiments may include different values. It should be noted that similar reference numerals and letters in the following figures denote similar items; therefore, once an item is defined in one figure, it need not be further discussed in subsequent figures.

[0026] The present invention will be further described below with reference to the embodiments.

[0027] In the following examples, Agrobacterium tumefaciens EHA105 was purchased from Nanjing Enzyme Proly Biotechnology Co., Ltd.

[0028] Example 1: Obtaining the targeting sgRNA sequences of tomato phospholipase D genes PLDα1 and PLDα3

[0029] 1. Locating the tomato PLDα1 gene (gene number: Solyc06g068090.3.1) and PLDα3 gene (gene number: Solyc03g116620.3.1) in the NCBI database (https: / / www.ncbi.nlm.nih.gov / ) yielded the location information. The PLDα1 gene is located in the 39833679~39838185 bp region of tomato chromosome 6 (Genbank accession number NC_015449.3); the PLDα3 gene is located in the 60414826~60418303 bp region of tomato chromosome 3 (Genbank accession number NC_015446.3).

[0030] 2. Using the CRISPR-P 2.0 online tool (http: / / cbi.hzau.edu.cn / crispr / ), we designed the target sgRNA sequence for CRISPR / Cas9 gene editing of the tomato phospholipase D gene: For the PLDα1 gene, the sequence in the 1584~1603 bp region of the PLDα1 gene sequence was selected as the target sgRNA sequence, denoted as sgRNA-1, and the gene sequence of sgRNA-1 is shown in SEQ ID NO.1; For the PLDα3 gene, the sequence in the 833~852 bp region of the PLDα3 gene sequence was selected as the target sgRNA sequence, denoted as sgRNA-2, and the gene sequence of sgRNA-2 is shown in SEQ ID NO.3.

[0031] Example 2: Construction of a dual-target gene editing vector 2300GN-Ubi-Cas9-PLDα1 / α3 for the tomato phospholipase D genes PLDα1 and PLDα3

[0032] The AtU3d promoter, the sgRNA-1 sequence (as shown in SEQ ID NO.1), and the sgRNA backbone sequence were sequentially ligated to construct the sgRNA-PLDα1 gene sequence (as shown in SEQ ID NO.2). The AtU3b promoter, the sgRNA-2 sequence (as shown in SEQ ID NO.3), and the sgRNA backbone sequence were sequentially ligated to construct the sgRNA-PLDα3 gene sequence (as shown in SEQ ID NO.4). Finally, a dual-target CRISPR / Cas9 gene editing vector was constructed using sgRNA-PLDα1 and sgRNA-PLDα3. The gene sequences were synthesized by Nanjing GenScript and inserted between the SbfI and SmaI restriction sites of the 2300GN-Ubi-Cas9 universal vector, resulting in the CRISPR / Cas9 gene editing vector named 2300GN-Ubi-Cas9-PLDα1 / α3. The vector map is shown below. Figure 1 As shown.

[0033] Example 3: Genetic transformation of tomatoes

[0034] The above-mentioned 2300GN-Ubi-Cas9-PLDα1 / α3 vector was introduced into the tomato variety Micro-Tom using Agrobacterium-mediated transformation. The main procedures are as follows:

[0035] (1) Preparation of Agrobacterium: Using the 2300GN-Ubi-Cas9-PLDα1 / α3 gene editing vector as a template sequence, specific primers were designed for PCR validation. For the PLDα1 target: primers sgRNA-F1: 5'-GAAAGCAGGGAGGGAAGGAT-3' (SEQ ID No. 5) and sgRNA-R1: 5'-CTCCGCTCTTCTTCACCTCT-3' (SEQ ID No. 6) were designed to amplify a 615 bp sequence (SEQ ID No. 7). For the PLDα3 target: primers sgRNA-F2: 5'-GACTGGCAGAGGAGGACAAT-3' (SEQ ID No. 8) and sgRNA-R2: 5'-TGCCCAATGGAGAGTCAGAG-3' (SEQ ID No. 9) were used to amplify a 550 bp sequence (SEQ ID No. 10).

[0036] The 2300GN-Ubi-Cas9-PLDα1 / α3 gene editing vector was introduced into Agrobacterium EHA105 via a freeze-thaw method. Agrobacterium colony PCR was performed using primers as shown in SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 8, and SEQ ID No. 9 (Table 1 shows the PCR reaction system). The PCR product bands were observed by 1% agarose gel electrophoresis. Successful plasmid transformation was considered to have occurred if the bands matched the 615 bp sequence shown in SEQ ID No. 7 and the 550 bp sequence shown in SEQ ID No. 10. 10 μL of successfully transformed Agrobacterium was cultured in 800 μL LLB liquid medium containing 50 mg / L Kana and 50 mg / L Rif at 200 rpm and 28°C for 16 h, followed by storage at -80°C with 50% glycerol.

[0037] Table 1 Colony PCR Reaction System sgRNA-F 1 μL (0.2-0.3 μM) sgRNA-R 1 μL (0.2-0.3 μM) colonies - Taq enzyme 12.5 μL (1.25 U)

[0038] (2) Explant treatment: Seed sterilization: Select 100 intact and plump Micro-Tom tomato seeds and place them in a 10 mL sterile centrifuge tube. Sterilize the seeds stepwise with 3 mL of 75% anhydrous ethanol solution (1 min) and 3 mL of 10% sodium hypochlorite solution (7 min), and then quickly rinse 6-8 times with sterile water. Place a sterile filter paper in a sterile square petri dish (10×10 cm) containing 5 mL of sterile water using sterile forceps. Place the sterilized Micro-Tom tomato seeds on the moistened filter paper using sterile forceps. Seal the square dish with sealing film and incubate at 28℃ in the dark for 2-3 days. When the radicle elongates to about 1 cm, transfer the seeds to a tissue culture flask containing MS solid medium and continue incubating at 28℃ in the dark. When the hypocotyl elongates to about 3 cm, transfer the seeds to a tissue culture room for culture under light.

[0039] Material selection: When the first true leaf of the tomato seedling is about to emerge (7-10 days of growth under light), the seedling is cut off from the stem under sterile conditions and placed on sterile filter paper with tweezers. The tip of the tomato cotyledon is removed, and the cotyledon is cut off near the petiole. It is then divided into two small squares along the direction perpendicular to the leaf veins and placed face up in the pre-culture medium for 2 days.

[0040] (3) Activation of the strain: Agrobacterium tumefaciens EHA105 containing the gene-editing vector 2300GN-Ubi-Cas9-PLDα1 / α3 was streaked onto LB solid medium containing 50 mg / L Kan and 50 mg / L Rif. The plates were inverted and incubated in the dark at 28°C for 2 days until single colonies appeared. Appropriately sized and plump single colonies were picked and inoculated into 800 μL of LB liquid medium containing the same concentration of antibiotics. The culture was then incubated at 28°C and 200 rpm with shaking for 16 h. 100 μL of the bacterial culture was transferred to a fresh 100 mL LB medium and incubated at 28°C and 200 rpm with shaking for approximately 15 h to allow OD to develop. 600 The OD value reached 0.6~0.8. The bacterial suspension was centrifuged at 4℃ and 5000 rpm for 5 min to obtain a bacterial pellet. The precipitated bacterial cells were adjusted to OD using resuspension buffer (MS + 100 μM AS). 600 The value was adjusted to 0.47~0.5, and the mixture was suspended and shaken for 1 hour at 28℃ and 100 rpm for later use.

[0041] (4) Agrobacterium infection: Take out the tomato cotyledons that have been pre-cultured for 2 days and immerse them in the activated bacterial solution obtained in (3). Shake at 28℃ and 100 rpm for 20 min. After infection, use sterile forceps to remove the explants and place them on sterile filter paper to remove the residual bacterial solution on the surface.

[0042] (5) Co-cultivation: The infected explants were placed face up and evenly spread on the surface of the co-culture medium, and then placed in a dark incubator for 3 days.

[0043] (6) Screening and cultivation: After co-culture, the explants were transferred to selection medium and cultured under light conditions, with the medium being changed every 15 days. During this period, the explants gradually formed callus tissue and further differentiated into buds.

[0044] (7) Sprouting culture: Explants with clearly formed buds are transferred to a budding medium to promote the growth of adventitious buds. When the adventitious buds grow to a large size, they are transferred to a tissue culture bottle containing a budding medium.

[0045] (8) Rooting culture: When the regenerated shoots grow to 3-4 true leaves, they are separated from the callus tissue with a scalpel and inserted into the rooting culture medium to induce and develop the root system.

[0046] (9) Seedling hardening: After the plants have developed a well-developed root system in the rooting medium, wash off the culture medium adhering to the roots, remove old leaves, add water to the seedling root-stem transition zone in the tissue culture bottle, and culture under light for 4-5 days to harden off the seedlings. Change the water once a day.

[0047] (10) Transplanting and planting: After hardening off, the seedlings are transplanted into the cultivation substrate and placed in the plant growth chamber for further cultivation.

[0048] The culture medium formula used is as follows:

[0049] 1. Pre-culture medium: MS medium + ZT (2 mg / L) + AS (20 mg / L).

[0050] 2. Co-culture medium: MS medium + ZT (2 mg / L) + AS (20 mg / L).

[0051] 3. Screening medium: MS medium + ZT (3 mg / L) + Kan (80 mg / L) + Ti (300 mg / L).

[0052] 4. Germination medium: MS medium + ZT (1 mg / L) + Kan (80 mg / L) + Ti (300 mg / L).

[0053] 5. Rooting medium: MS medium + IBA (0.2 mg / L) + Kan (20 mg / L) + Ti (300 mg / L).

[0054] Make up to volume with distilled water, dispense into Erlenmeyer flasks of the required size, seal and sterilize using standard methods (e.g., sterilize at 121°C for 25 minutes).

[0055] 6. LB liquid medium: 10 g / L tryptone + 5 g / L yeast extract + 10 g / L NaCl powder.

[0056] 7. MS solid medium: 20 g / L sucrose + 1.8 g / L MS medium powder + 7 g / L agar.

[0057] 8. MS liquid medium: 20 g / L sucrose + 1.8 g / L MS medium powder.

[0058] Culture media 6-8 were adjusted to pH 5.80 with 1 M sodium hydroxide, diluted to volume with distilled water, dispensed into Erlenmeyer flasks of the required size and sealed, and sterilized using conventional methods (e.g., sterilized at 121°C for 25 min).

[0059] The main solution formulation is as follows:

[0060] 1. ZT hormone (10 mg / mL): Weigh 90 mg ZT, add 600 μL of 1 M sodium hydroxide to aid dissolution, and dilute to 9 mL with distilled water.

[0061] 2. IBA hormone (1 mg / mL): Weigh 6 mg of IBA, dilute with distilled water to 6 mL, and store at -20℃ for later use.

[0062] 3. Ti Termetine solution (300 mg / mL): Weigh 1.8 g Ti, dilute with distilled water to 6 mL, and store at -20℃ for later use.

[0063] 4. Kanamycin solution (100 mg / mL): Weigh 600 mg Kan, dilute to 6 mL with distilled water, and store at -20℃ for later use.

[0064] 5. AS acetylsuccinone solution (20 mg / mL): Weigh 0.1 g AS, dilute to 5 mL with DMSO, and store at -20℃ for later use.

[0065] 6.1 M Sodium hydroxide: Weigh 4g of sodium hydroxide, dissolve it in distilled water and bring the volume to 100 mL.

[0066] Solutions 1-5 should be stored at -20℃ for later use, and solution 6 should be stored at room temperature for later use.

[0067] Example 4: Identification of tomato PLD gene-edited lines

[0068] (1) Take young leaf samples from T0 generation transgenic tomato plants and extract DNA using the CTAB method. The specific steps are as follows: The CTAB extract was preheated in a 65°C water bath and 1% by volume of β-mercaptoethanol was added. Weigh 0.5 g of young tomato leaves, quickly freeze them in liquid nitrogen, and then place them in a small mortar that has been pre-cooled with liquid nitrogen. Grind them thoroughly in liquid nitrogen into a fine powder. Transfer the powder obtained from grinding to a PE tube containing 2 mL of preheated CTAB extract, mix thoroughly, and heat in a 65°C water bath for 1 h, inverting and mixing 3 to 5 times during the process. Remove the PE tube, cool it to room temperature, add an equal volume of chloroform / isoamyl alcohol (24:1), mix gently, and centrifuge (8000 rpm, 16℃, 15 min). Transfer the supernatant to a new PE tube. Repeat the previous step to extract again, add an equal volume of chloroform / isoamyl alcohol (24:1), mix gently and centrifuge (8000 rpm, 16℃, 15 min), and transfer the supernatant to a new PE tube; Add an equal volume of anhydrous ethanol and mix gently until a filamentous or flocculent precipitate appears to obtain the crude extract, which is the DNA clump. Pick out DNA clumps and transfer them to 1.5 mL PE tubes. Add 75% ethanol and incubate on ice for 2-3 hours, changing the 75% ethanol 2-3 times during this period. After air drying, add 600 μL ddH2O to completely dissolve the DNA. Add 6 μL of RNase, incubate in a 37°C water bath for 30 min, detect DNA by 1% agarose gel electrophoresis, and store at -80°C for later use.

[0069] (2) Using the DNA obtained in (1) as a template, PCR amplification was performed according to the system in Table 2 using primers as shown in SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 8, and SEQ ID No. 9. The PCR product bands were observed by 1% agarose gel electrophoresis. If a 615 bp band matching SEQ ID No. 7 and a 550 bp band matching SEQ ID No. 10 appeared, it was preliminarily determined that the plant to which the template DNA belonged was transgenic positive.

[0070] Table 2. Standard PCR reaction system upper primer 1 μL (0.2-0.3 μM) lower primer 1 μL (0.2-0.3 μM) DNA template 2 μL (0-500 ng) Taq enzyme 12.5 μL (1.25 U)

[0071] (3) Collect self-pollinated seeds from T0 generation transgenic plants and sow them to cultivate T1 generation lines. Culture conditions: daytime temperature 25℃, light 10000 Lux for 14 h; nighttime temperature 18℃, darkness for 10 h; air humidity 60%, other routine management.

[0072] (4) Select young leaves of T1 generation plants and extract DNA using the CTAB method, the same as (1).

[0073] (5) Transgenic identification: Using the DNA extracted in (4) as a template, and the sequences shown in SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 8, and SEQ ID No. 9 as primers, PCR amplification was performed (reaction system shown in Table 2). The PCR products were detected by 1% agarose gel electrophoresis. If the reaction was normal but the expected band was not amplified, it indicates that the transgenic fragment has been removed through self-pollination.

[0074] (6) Using the upstream and downstream sequences of the sgRNA-1 sequence shown in SEQ ID No. 1 and the sgRNA-2 sequence shown in SEQ ID No. 3 in the wild-type tomato PLD gene as templates, specific primers were designed respectively: PLDα1F: 5'- TAATTCCACCATCCCCGGTG -3' (SEQ ID No. 11); PLDα1R: 5'- TCAAATAATTCCTTGGATCTTC -3' (SEQ ID No. 12); PLDα3F: 5'-GAACAGGATGTCGCGTTTCT-3' (SEQ ID No. 13); PLDα3R: 5'-AGTATCGTATCTCCCATCAC-3' (SEQ ID No. 14).

[0075] Using the DNA extracted in (4) as a template, PCR amplification was performed using the sequences shown in SEQ ID No. 11 and SEQ ID No. 12, and SEQ ID No. 13 and SEQ ID No. 14 as primers (reaction system shown in Table 2). The PCR products were detected by 1% agarose gel electrophoresis. The band sizes were approximately 520 bp and 575 bp, respectively. The samples were then submitted to General Biotech for Sanger sequencing. The sequencing results were compared with the wild-type sequences to analyze the mutation status of the PLDα1 and PLDα3 target sites in the T1 generation plants.

[0076] (7) Based on the above identification and analysis, a line without transgenes and with homozygous mutations at both the PLDα1 and PLDα3 target sites was obtained and named pldα1α3.

[0077] Example 5: Measurement of longitudinal and transverse diameters of tomato fruits

[0078] Select several plump seeds of wild-type (WT) and the pldα1α3-1 and pldα1α3-2 mutants, place them in petri dishes, add an appropriate amount of water, and germinate them in a dark incubator at 28℃ for 3-5 days. When the radicle elongates to about 3 cm, transplant them into flowerpots (10 cm long, 10 cm wide, and 8.8 cm high) filled with nutrient soil and place them in a plant growth chamber for cultivation. The cultivation conditions are set as follows: daytime temperature 25℃, light intensity 14 h, nighttime temperature 18℃ for 10 h, relative humidity 60%, and light intensity 200 μmol / m². -2 ·s -1 Ten days after transplanting, several seedlings of WT, pldα1α3-1 mutant and pldα1α3-2 mutant with consistent growth status were selected and replanted in flowerpots filled with nutrient soil and placed in a plant growth chamber for continued cultivation.

[0079] Observe the WT and pldα1α3 mutant lines in the reproductive growth stage, such as Figure 2 As shown, the mutant's plant height was significantly lower than that of the WT, such as Figure 3 As shown, the number of flowers was also reduced compared to WT. Fruits from WT, pldα1α3-1 mutant, and pldα1α3-2 mutant lines at the red-ripe stage were observed, and the longitudinal and transverse diameters of the fruits were measured. Fruit longitudinal and transverse diameters and other yield-related traits were measured using vernier calipers. Figure 4 , Figure 5 , Figure 6 As shown, the red-ripe fruits of both the pldα1α3-1 mutant and the pldα1α3-2 mutant lines were significantly smaller than WT, indicating that the knockout of the PLD gene by CRISPR / Cas9 gene editing guided by sgRNA-1 (as shown in SEQ ID NO.1) and sgRNA-2 (as shown in SEQ ID NO.3) can reduce the size of tomato fruits.

[0080] The sgRNA fragment of the tomato phospholipase D (PLD) gene designed in this invention was successfully used to construct the tomato PLD gene dual-target editing vector 2300GN-Ubi-Cas9-PLDα1 / α3, and tomato lines with homozygous mutations of pldα1α3 were obtained by genetic transformation and gene editing technology, providing an effective way to regulate the yield-related traits of tomatoes.

[0081] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the technical principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. sgRNAs targeting the tomato phospholipase D genes PLDαl and PLDα3, characterized in that, The sgRNA includes sgRNA-1, which targets PLDα1, as shown in SEQ ID NO.1, and sgRNA-2, which targets PLDα3, as shown in SEQ ID NO.

3.

2. A method of modulating yield-related traits in tomato, characterized in that, The tomato yield-related traits include fruit size, fruit quantity, and plant height. The method includes: using CRISPR / Cas9 gene editing technology, knocking out the tomato phospholipase D gene PLDα1 and PLDα3 with sgRNA as described in claim 1, and screening to obtain tomato plants with smaller fruit size, fewer fruit, and lower plant height.

3. The method according to claim 2, characterized in that, include: Construct a dual-target gene editing vector for the tomato phospholipase D genes PLDα1 and PLDα3; A dual-target gene editing vector was introduced into a host cell to obtain engineered bacteria in the host cell. The engineered bacteria in the host cell were transfected into tomato cotyledon explants, and the pldα1α3 tomato lines without transgenes and with homozygous mutations at both the PLDα1 and PLDα3 target sites were screened to obtain the pldα1α3 tomato lines. The pldα1α3 tomato line was placed in a plant growth chamber to cultivate tomato plants with smaller fruits, fewer fruits, and shorter plant height.

4. The method according to claim 3, characterized in that, The dual-target gene editing vector for the tomato phospholipase D genes PLDα1 and PLDα3 is 2300GN-Ubi-Cas9-PLDα1 / α3, and the construction method of 2300GN-Ubi-Cas9-PLDα1 / α3 includes: The AtU3d promoter, the sgRNA-1 sequence shown in SEQ ID NO.1, and the sgRNA backbone sequence were sequentially linked to construct sgRNA-PLDα1 as shown in SEQ ID NO.2; The AtU3b promoter, the sgRNA-2 sequence shown in SEQ ID NO.3, and the sgRNA backbone sequence were sequentially linked to construct sgRNA-PLDα3 as shown in SEQ ID NO.4; sgRNA-PLDα1 and sgRNA-PLDα3 were inserted between the SbfI and SmaI restriction sites of the 2300GN-Ubi-Cas9 vector to obtain 2300GN-Ubi-Cas9-PLDα1 / α3.

5. The method according to claim 3 or 4, characterized in that, The host cell was Agrobacterium tumefaciens EHA105.

6. The method according to claim 3 or 4, characterized in that, The method for introducing the dual-target gene editing vector into host cells is the freeze-thaw method.

7. The application of the method as described in any one of claims 2-6 in cultivating tomato plants with reduced fruit size, reduced fruit quantity, and reduced plant height.

8. The application of the dual-target gene editing vector 2300GN-Ubi-Cas9-PLDα1 / α3 constructed according to the method described in claim 4 in the cultivation of tomato plants with reduced fruit size, reduced fruit quantity, and reduced plant height.

Citation Information

Patent Citations

  • CRISPR / Cas9 vector with visual protein fusion antibiotic selection marker as well as construction method and application of CRISPR / Cas9 vector

    CN114807198A