Nogo-b targeted whole rna-crispr gene editing system, construction method and application thereof
Patent Information
- Application Number
- CN202610812039.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-06-06
- Publication Date
- 2026-08-21
AI Technical Summary
[0009]尽管Nogo-B具有明确的生物学基础和治疗潜力,但目前针对Nogo-B的体内靶向干预手段仍较少,尤其缺乏一种兼具安全性、瞬时表达特点、肝脏递送能力和临床转化潜力的Nogo-B靶向基因编辑系统
[0021]本发明所述的Nogo-B靶向的全RNA-CRISPR基因编辑系统及其构建方法和应用的优点和积极效果是:
Smart Images

Figure CN122609576A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, and in particular to a Nogo-B-targeted whole RNA-CRISPR gene editing system, its construction method, and its applications. Background Technology
[0002] Atherosclerosis (AS) is a chronic, progressive disease characterized by lipid metabolism disorders, vascular endothelial dysfunction, chronic inflammation, and vascular wall remodeling. It is also the main pathological basis for cardiovascular and cerebrovascular events such as coronary heart disease and ischemic stroke. Current research indicates that atherosclerosis begins with the abnormal deposition and continuous accumulation of cholesterol, especially low-density lipoprotein cholesterol (LDL-C), in the vascular wall. Once inside the vascular intima, LDL-C can undergo oxidation and aggregation, forming pathogenic lipid particles such as oxidized LDL-C. These particles are then taken up in large quantities by macrophages via scavenger receptors, leading to foam cell formation and further promoting necrotic core formation, inflammation amplification, and plaque progression. As the disease progresses, cholesterol crystallization can activate the NLRP3 inflammasome, inducing the release of inflammatory factors such as IL-1β and IL-18, creating a vicious cycle of mutually reinforcing cholesterol deposition and inflammation activation. Ultimately, this leads to plaque instability, rupture, and thrombosis, inducing serious clinical events such as myocardial infarction and cerebral infarction.
[0003] Currently, lowering LDL-C levels remains the core strategy for treating atherosclerosis. Clinically, statins, ezetimibe, PCSK9 inhibitors, and small interfering RNA drugs targeting PCSK9 are mainly used for lipid-lowering interventions. While these treatments have achieved clear efficacy in lowering plasma LDL-C and reducing cardiovascular events, several limitations remain: First, atherosclerosis requires long-term, even lifelong, intervention, leading to insufficient patient adherence and impacting treatment effectiveness; second, even when LDL-C reaches guideline-recommended targets, a high residual cardiovascular risk persists, suggesting that simply reducing cholesterol synthesis or circulating levels is insufficient to comprehensively halt disease progression; third, existing treatments mostly focus on inhibiting cholesterol synthesis, with relatively insufficient intervention strategies to promote cholesterol efflux and complete metabolic transport. Therefore, there is an urgent need to develop new targets and strategies capable of regulating hepatic cholesterol metabolism.
[0004] In recent years, Nogo-B (Neurite outgrowth inhibitor-B), as one of the gene-encoded products of reticulin 4 (RTN4), has gradually attracted attention due to its dual role in vascular homeostasis regulation and cholesterol metabolism. The Nogo family includes three major subtypes: Nogo-A, Nogo-B, and Nogo-C. Among them, Nogo-B is widely expressed in peripheral tissues and can be detected in the blood circulation and liver. Studies have shown that in the vascular region, Nogo-B participates in the regulation of sphingolipid metabolism and can regulate endothelial barrier function and inflammatory status by affecting the balance between ceramide and sphingosine 1-phosphate. Its abnormal expression is closely related to endothelial dysfunction and the progression of atherosclerosis. On the other hand, in the liver, Nogo-B can bind to the key nuclear receptor for cholesterol metabolism, hepatic receptor X α (LXRα), and promote its ubiquitination and degradation, thereby inhibiting the expression of LXRα-mediated cholesterol efflux-related genes. When Nogo-B is knocked out or inhibited, LXRα stability increases, and the expression of its downstream ATP-binding cassette transporters (such as ABCA1 and ABCG1) and apolipoprotein E (ApoE) is upregulated, promoting hepatic cholesterol excretion. Simultaneously, due to the decrease in intracellular cholesterol levels in hepatocytes, the SREBP2-LDLR pathway is further activated, enhancing the liver's ability to uptake circulating LDL-C. Therefore, Nogo-B possesses the dual regulatory potential to simultaneously affect both cholesterol efflux and cholesterol uptake, making it a novel target with both systemic lipid regulation value and potential for intervention in atherosclerosis.
[0005] Compared to traditional small molecule or antibody drugs, gene editing technology can directly target the pathogenic gene itself, offering the potential advantage of "one-time intervention, long-term benefit." The CRISPR / Cas9 gene editing system, due to its simple design, high programmability, and high editing efficiency, has become one of the most promising precision intervention methods. This system typically consists of a Cas9 nuclease and guide RNA (sgRNA). The sgRNA guides Cas9 to recognize the target DNA sequence and generate double-strand breaks, subsequently achieving gene knockout or functional silencing through repair mechanisms such as non-homologous end joining. In recent years, CRISPR / Cas9 has gradually moved from basic research to clinical translation, particularly showing promising applications in liver-related diseases and lipid metabolism disorders.
[0006] In CRISPR / Cas9 delivery systems, the main delivery formats include plasmid DNA, ribonucleoprotein complexes (RNPs), and whole RNA (whole RNA) delivery of Cas9 mRNA and sgRNA. Compared to plasmid DNA or viral vectors, the whole RNA format does not rely on exogenous DNA for long-term intracellular presence, reducing the risk of genome integration and mitigating potential safety issues arising from long-term exposure to editing tools through transient expression. Furthermore, this format is more suitable for integration with non-viral delivery systems, aligning with the development logic of modern nucleic acid drugs and possessing greater potential for clinical translation. Therefore, constructing whole RNA-CRISPR gene editing systems with Cas9 mRNA and sgRNA as core editing components has become an important direction for in vivo gene editing.
[0007] However, the in vivo application of whole RNA-CRISPR systems still faces delivery challenges. Both Cas9 mRNA and sgRNA are susceptible to nuclease degradation and require multiple processes, including cyclic stabilization, target organ enrichment, cellular uptake, intracellular release, and endosome escape, to achieve effective editing within target cells. Therefore, an efficient, safe delivery platform with in vivo transformation potential is crucial for the application of this type of system. Lipid nanoparticles (LNPs) have become the most practical platform for in vivo whole RNA delivery due to their excellent nucleic acid encapsulation capabilities, in vivo stability, engineerable preparation capabilities, and relatively mature pharmaceutical development foundation. LNPs are typically composed of ionized lipids, cholesterol, cofactor phospholipids, and PEG-modified lipids. They can efficiently complex RNA under acidic conditions to form nanoparticles, maintain a relatively low charge state under physiological conditions to reduce toxicity, and promote payload release in the endosomal environment. Existing studies and clinical practice have shown that LNPs can effectively deliver Cas9 mRNA and sgRNA to the liver, achieving in vivo target gene editing, demonstrating their clear feasibility in liver-targeted whole RNA gene editing.
[0008] For atherosclerosis, the liver is the core organ for cholesterol synthesis, uptake, transport, and excretion, and a key entry point for systemic lipid metabolism remodeling. LNP delivery systems have a natural tendency to accumulate in the liver and can preferentially enter hepatocytes via plasma apolipoprotein E-mediated uptake, making them particularly suitable for intervention in lipid metabolism-related diseases targeting the liver. Based on this, if Nogo-B is used as an editing target, and a whole RNA-CRISPR system is constructed using Cas9 mRNA and sgRNA, combined with LNP for liver delivery, it is hoped that Nogo-B can be specifically edited in vivo, thereby relieving its negative regulation of LXRα, promoting cholesterol efflux and enhancing LDL-C uptake, thus reducing circulating cholesterol load and improving atherosclerosis-related pathological conditions.
[0009] Despite the well-defined biological basis and therapeutic potential of Nogo-B, current in vivo targeted interventions for Nogo-B are limited, particularly lacking a Nogo-B-targeted gene editing system that combines safety, transient expression, liver delivery capability, and clinical translational potential. Therefore, developing a whole-RNA-CRISPR gene editing system centered on Cas9 mRNA and Nogo-B-targeting sgRNA, and capable of efficient delivery via LNP, is of significant scientific importance and potential application value for validating the role of Nogo-B in atherosclerosis and cholesterol metabolism regulation, and for exploring novel precision treatment strategies. Summary of the Invention
[0010] The purpose of this invention is to provide a Nogo-B-targeted whole RNA-CRISPR gene editing system, its construction method, and its applications. This whole RNA-CRISPR gene editing system uses Cas9-mRNA and specific sgRNA as core components and LNP as the delivery vector, forming a whole RNA editing and delivery platform. This platform can operate safely and effectively in vivo, improving hepatic cholesterol metabolism, reducing circulating cholesterol levels, and further alleviating atherosclerosis-related lipid burden. Compared with existing intervention strategies, it avoids the risk of genome integration by plasmid vectors and has high biocompatibility.
[0011] To achieve the above objectives, in a first aspect, the present invention provides an sgRNA, which is h-sgRNA2 or m-sgRNA2; h-sgRNA2: TGAAAGCAGCAGGAATAGGC (SEQ ID NO.4); m-sgRNA2: ATCACAGGCTCAGATGCAGC (SEQ ID NO. 5).
[0012] Secondly, this invention provides the application of the aforementioned sgRNA in constructing a Nogo-B-targeted whole RNA-CRISPR gene editing system.
[0013] Thirdly, the present invention provides a Nogo-B-targeted whole RNA-CRISPR gene editing system, comprising Cas9 mRNA and the aforementioned sgRNA; the molar ratio of Cas9 mRNA to sgRNA is 1:15 (mass ratio approximately 1:3).
[0014] Fourthly, this invention provides a method for constructing the aforementioned Nogo-B-targeted whole RNA-CRISPR gene editing system, comprising the following steps: Step 1, sgRNA design and screening: Suitable target sites were screened based on the Nogo-B gene, and sgRNA sequences were designed. Step 2, Cas9 mRNA expression template design and plasmid construction: Using wild-type SpCas9 plasmid as a template, the codons of the Cas9 open reading frame sequence were optimized. Optimized 5'-UTR and 3'-UTR sequences were ligated to the 5' and 3' ends of the optimized Cas9 coding sequence, respectively, to construct a complete Cas9 mRNA expression framework. After the design was completed, plasmids were synthesized, and the resulting recombinant plasmids were used for subsequent template preparation. Step 3, Recombinant plasmid amplification and extraction: Glycerol bacteria containing the target plasmid were inoculated into LB liquid medium containing kanamycin resistance and cultured overnight at 37°C with shaking. After the culture was completed, the bacterial cells were collected, plasmid DNA was extracted, and its concentration and purity were determined to obtain the Cas9 plasmid. Step 4, Linearization preparation of Cas9 in vitro transcription template: The extracted Cas9 plasmid was linearized by restriction endonuclease BspQI. After the reaction, the plasmid was confirmed to be completely linearized by agarose gel electrophoresis. The digestion product was then purified using a PCR product purification kit, and the DNA concentration and purity were measured to obtain linear DNA for in vitro transcription. Step 5, Cas9 mRNA in vitro transcription and purification: Using linear DNA as a template, Cas9 mRNA was synthesized using the T7 in vitro transcription system. CAP analogs and modified nucleosides were added to the transcription system. After transcription, DNase I was added to digest the residual template DNA. Then, column purification was used to remove enzymes, salt ions and unreacted substrates to obtain purified Cas9 mRNA. Step 6, Construction of the whole RNA-CRISPR gene editing system: The prepared qualified Cas9 mRNA was blended with sgRNA targeting the Nogo-B gene to obtain a whole RNA-CRISPR / Cas9 gene editing system.
[0015] Furthermore, in step 6, after Cas9 mRNA enters the cell, it is translated into Cas9 protein. sgRNA is responsible for guiding Cas9 protein to recognize the target DNA sequence, and the two work together to mediate the editing of the target gene.
[0016] Fifthly, the present invention provides the application of the above-described whole RNA-CRISPR gene editing system in the construction of whole RNA-CRISPR delivery formulations.
[0017] In a sixth aspect, the present invention provides a method for constructing a whole RNA-CRISPR delivery formulation, comprising the following steps: 1) Microfluidic chip fabrication: A microfluidic hybrid chip with a complete structure and clear channels was obtained using PDMS soft lithography. 2) Construction of whole RNA-CRISPR delivery formulation: The Cas9 mRNA and sgRNA samples from the Nogo-B-targeted whole RNA-CRISPR gene editing system were diluted with pH 4 citrate buffer. After the LNP lipid solution was brought to room temperature, it was loaded into a syringe and fixed to a microinjection pump. After connecting the microfluidic chip, the RNA phase and lipid phase were injected into the chip channel at a set flow rate ratio for rapid mixing, so that the Cas9 mRNA and sgRNA were encapsulated by LNP to obtain the whole RNA-CRISPR delivery formulation.
[0018] Furthermore, in 2), the flow rate ratio of the RNA phase to the lipid phase is 3:1; the ratio of positively charged amino groups in the cationic lipids to negatively charged phosphate groups in the mRNA is 6:1 (i.e., N / P molar ratio = 6).
[0019] In a seventh aspect, the present invention provides a whole RNA-CRISPR delivery formulation, which is constructed by the above-described construction method.
[0020] Eighthly, the present invention provides the application of the above-mentioned whole RNA-CRISPR delivery formulation in the preparation of an anti-atherosclerotic drug.
[0021] The advantages and positive effects of the Nogo-B-targeted whole RNA-CRISPR gene editing system, its construction method, and its applications described in this invention are as follows: 1. The whole RNA-CRISPR gene editing system of this invention uses Cas9-mRNA and specific sgRNA as core components and LNP as the delivery vector, forming a whole RNA editing and delivery platform. This platform can operate safely and effectively in vivo, improving liver cholesterol metabolism, reducing circulating cholesterol levels, and further alleviating atherosclerosis-related lipid burden. Compared with existing intervention strategies, it avoids the risk of genome integration of plasmid vectors and has high biosafety.
[0022] 2. The whole RNA-CRISPR gene editing system of this invention uses Cas9-mRNA and specific sgRNA as core components and LNP as delivery vector. LNP can not only protect Cas9-mRNA and sgRNA from degradation, but also improve in vivo delivery efficiency by taking advantage of the natural uptake of liver, making the system more suitable for the treatment of lipid metabolism-related diseases.
[0023] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Attached Figure Description
[0024] Figure 1 This is a transcription plasmid map in an embodiment of the present invention, where A is SpCas9 mRNA and B is SpCas9-EGFP mRNA; Figure 2 This is an example of mRNA purity detection in this invention, where A is SpCas9 mRNA and B is SpCas9-EGFP mRNA; Figure 3 This embodiment of the invention shows the flow cytometry results for detecting mRNA translation, where A represents the flow cytometry results and B represents the statistical results of the bar chart. Figure 4 In this embodiment of the invention, the activity of the automated electrophoresis detection system for whole RNA gene editing is described, wherein A represents the qualitative editing activity of mismatch fragments, B represents the quantitative editing efficiency of the mismatch peak area at the DNMT1 target, and C represents the quantitative editing efficiency of the mismatch peak area at the FANCF target. Figure 5 In this embodiment of the invention, qRT-PCR was used to detect the reduced level of Nogo-B-mRNA. Figure 6 The activity of the Nogo-B-targeted whole RNA gene editing system in HepG2 cells was detected by automated electrophoresis in this embodiment of the invention, wherein A represents the qualitative editing activity of mismatch fragments and B represents the quantitative editing efficiency of mismatch peak area; Figure 7 This embodiment of the invention uses qRT-PCR to detect the reduced level of Nogo-B-mRNA in HepG2 cells; Figure 8 In this embodiment of the invention, automated electrophoresis is used to screen for target mouse Nogo-B sgRNA, where A represents the qualitative editing activity of mismatch fragments and B represents the quantitative editing efficiency of mismatch peak area. Figure 9 In this embodiment of the invention, automated electrophoresis is used to detect the editing efficiency of m-sgRNA2 in various cells, where A represents the qualitative editing activity of mismatch fragments and B represents the quantitative editing efficiency of mismatch peak area. Figure 10 In this embodiment of the invention, qRT-PCR was used to detect the reduction level of m-sgRNA2 on mouse Nogo-B-mRNA. Figure 11 This invention provides an example of using agarose gel electrophoresis to detect off-target effects of m-sgRNA2. Figure 12In this embodiment of the invention, the detection of four lipid levels is used to evaluate the establishment of a disease mouse model, where A is the total cholesterol level, B is the total triglyceride level, C is the low-density lipoprotein cholesterol level, and D is the high-density lipoprotein cholesterol level. Figure 13 This invention provides an example of using mouse weight changes to evaluate the establishment of a disease mouse model. Figure 14 This embodiment of the invention evaluates the establishment of a mouse model for disease by assessing the level of atherosclerotic plaque deposition. Figure 15 This is a particle size distribution diagram of the LNP-mRNA formulation in an embodiment of the present invention; Figure 16 The automated electrophoresis detection method in this embodiment of the invention is used to determine the editing efficiency of the Nogo-B-targeted whole RNA gene editing system in mouse liver, where A represents the qualitative editing activity of mismatch fragments and B represents the quantitative editing efficiency of mismatch peak area. Figure 17 In this embodiment of the invention, the levels of four lipid parameters were detected to evaluate the therapeutic effect after liver Nogo-B knockdown. Among them, A is the total cholesterol level, B is the total triglyceride level, C is the low-density lipoprotein cholesterol level, and D is the high-density lipoprotein cholesterol level. Figure 18 In this embodiment of the invention, agarose gel electrophoresis is used to evaluate off-target effects in the heart, liver, spleen, lungs, and kidneys. In this case, A is predicted off-target site 1, B is predicted off-target site 2, and C is predicted off-target site 3. Figure 19 In this embodiment of the invention, the interference of knocking out the Nogo-B gene on four lipid levels under normal metabolic background is detected, where A is the total cholesterol level, B is the total triglyceride level, C is the low-density lipoprotein cholesterol level, and D is the high-density lipoprotein cholesterol level. Figure 20 In this embodiment of the invention, ELISA was used to detect the production of inflammatory factors at different time points after drug administration, wherein A is tumor necrosis factor α, B is interleukin-6, and C is interleukin-1β; Figure 21 HE staining was used in this embodiment of the invention to detect whether mouse organs were damaged. Detailed Implementation
[0025] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments. Unless otherwise defined, the technical or scientific terms used in this invention should have the ordinary meaning understood by those skilled in the art to which this invention pertains.
[0026] Experimental methods in the following examples, unless otherwise specified, are generally performed according to national standards. Experimental instruments, equipment, and reagents in the following examples, unless otherwise specified, are commercially available.
[0027] Example 1: Feasibility Verification of the Whole RNA-CRISPR Gene Editing System 1. Construction of a whole-RNA CRISPR / Cas9 gene editing system: (1) Plasmid design: Using the wild-type spCas9 plasmid as a template, its ORF region sequence was modified and optimized. Thermo Fisher Scientific codon optimization tools were used to optimize the wild-type spCas9 coding sequence to improve the expression efficiency of the target gene in mammalian cells. Subsequently, optimized 5′-UTR (SEQ ID NO.11) and 3′-UTR (SEQ ID NO.12) sequences were ligated to the 5′ and 3′ ends of the optimized coding sequence, respectively, to construct a complete expression framework. Finally, the designed recombinant sequence was submitted to GenScript Biotech for plasmid synthesis. The resulting plasmid was used for subsequent linearization, in vitro transcription, and related functional experiments.
[0028] (2) Plasmid extraction: The plasmid expression vectors used were extracted using the SanPrep column-based plasmid DNA mini-extraction kit. The specific procedure was as follows: First, 10 μL of bacterial culture containing the target plasmid was extracted from glycerol-containing bacteria and inoculated into 10 mL of LB broth containing kanamycin resistance. The culture was incubated overnight at 37 ℃ and 200 r / min with shaking, for a total incubation time of 12-16 h to obtain sufficiently proliferated cells. After incubation, the bacterial culture was centrifuged to collect the bacterial pellet, and plasmid extraction was performed according to the SanPrep column-based plasmid DNA mini-extraction kit instructions. After extraction, the concentration and purity of the plasmid DNA were measured using a NanoDrop 2000 micro-spectrophotometer to assess the extraction quality. Finally, the obtained plasmid samples were aliquoted into sterile centrifuge tubes, sealed, and stored at -20 ℃ for subsequent experiments.
[0029] (3) Preparation of linearized expression template for Cas9 plasmid: The plasmid samples were linearized using the restriction endonuclease BspQI. The reaction system was prepared according to Table 1.
[0030] Table 1 BspQI Enzyme Digestion Reaction System
[0031] After the system was prepared, the mixture was gently pipetted or briefly centrifuged to collect the reaction solution, which was then incubated at 50 °C for 2 h to ensure complete plasmid linearization. After the enzyme digestion reaction, an appropriate amount of the reaction product was subjected to 1% agarose gel electrophoresis to determine whether the plasmid had been completely digested by observing the band migration. Once it was confirmed that the sample had been fully linearized and that there was no obvious undigested plasmid residue, the digested product was purified using the SanPrep column PCR product purification kit. After purification, the concentration and purity of the DNA sample were measured using a NanoDrop2000 micro spectrophotometer. Finally, the purified linearized DNA sample was aliquoted into sterile centrifuge tubes, sealed, and stored at -20 °C for later use.
[0032] (4) Cas9-mRNA preparation: ① In vitro transcription of RNA: Prepare the following transcription system (Table 2): Table 2 Transcription System
[0033] After the transcription reaction system was prepared, the components were thoroughly mixed by gently tapping the tube wall with a finger, followed by brief centrifugation for a few seconds. The mixed reaction system was then incubated at 37 °C for 2 h. After the transcription reaction was completed, 2 U of DNase I was added to the system, and incubation was continued at 37 °C for 30 min. After DNase I treatment, the obtained RNA product was purified using a column membrane purification method.
[0034] ②RNA purification: For mRNA products obtained from in vitro transcription, the mature RNA purification kit FastPure was used. ® Purification was performed using the Cell / Tissue Total RNA Isolation Kit V2. After purification, the concentration of the obtained mRNA sample was determined using a NanoDrop2000 micro spectrophotometer to assess product recovery and provide a basis for subsequent experiments.
[0035] (5) Capillary electrophoresis: Prepare a 1× working solution using Separation Buffer and Dilution Buffer according to the reagent instructions. Then, dilute the RNA sample to be tested to a final concentration of 10-20 ng / μL using 1× Dilution Buffer. Before detection, correctly install the RNA Cartridge Kit into the corresponding slot of the Qsep100 automated nucleic acid and protein analysis system and complete system preparation according to the instrument operating procedures. Denature the diluted RNA sample by incubating it at 75 °C for 3 min; then immediately cool it on ice for 3 min. After treatment, analyze the sample as required using the Qsep100 automated nucleic acid and protein analysis system to assess RNA integrity and fragment distribution. 2. Construction of the CRISPR / Cas9-EGFP fluorescence characterization system: (1) Gibson seamless cloning: ① Preparation of cloning vector and target fragment: The target plasmid fragment was amplified by PCR, and the PCR products were analyzed by 1% agarose gel electrophoresis. After confirming the target band, the PCR products were purified using the SanPrep column-based DNA gel extraction kit.
[0036] ② Configure the Gibson cloning system according to Table 3: Table 3 Seamless Cloning System
[0037] In a 10 μL reaction system, the amounts of both the support and the insert are 0.01-0.25 pmols, and the recommended molar ratio of Backbone to Insert is 1:2.
[0038] Mix gently and incubate at 50 °C for 1 h. After the reaction is complete, place the centrifuge tube on ice to cool for a few seconds.
[0039] (2) Transformation: Add 2 μL of the product to 50 μL of cells, mix gently, and incubate on ice for 30 min. Heat shock at 42℃ for 45 s, then immediately cool on ice for 2 min. Add 450 μL of SOC and incubate at 37℃ for 1 h at 250 rpm in a shaker. Centrifuge at 5000 rpm for 1 min, and transfer 100 μL to a plate. Spread the mixture onto LB agar plates that have been brought to room temperature. Incubate overnight in a constant temperature incubator. Pick single colonies from the overnight culture plates and amplify them in liquid Kana medium for 12–16 h. Send 500 μL of the amplified liquid to Shanghai Sangon Biotech Co., Ltd. for sequencing. Screen for positive strains and perform plasmid extraction, linearization plasmid preparation, and mRNA synthesis (refer to the above procedures) to obtain Cas9-EGFP mRNA. The concentration of the obtained mRNA sample was determined using a NanoDrop2000 micro spectrophotometer.
[0040] 3. Preparation of RNA-LNP formulations: (1) Preparation of RNA samples and lipid nanoparticles (LNPs): All mRNA samples used in this embodiment were prepared according to the above method. The sgRNA used was synthesized by Genscript Biotech Inc. The lipid nanoparticle material used was the commercially available 1273-LNP formulation provided by Moderna.
[0041] (2) Fabrication of microfluidic chips: First, place the silicon wafer in a volatilization tank for later use. Simultaneously, add a small amount of trimethylchlorosilane to another sealed container and let it stand for 3 minutes for surface treatment to improve the hydrophobicity of the silicon wafer surface, thus facilitating subsequent PDMS demolding. Then, using centrifuge tubes as weighing containers, weigh the two components separately on an analytical balance according to a mass ratio of A:B glue = 10:1, and thoroughly mix them with a glass rod to prepare the PDMS prepolymer solution. After thorough mixing, place the solution in a centrifuge and centrifuge at 5000 rpm for 5-10 minutes. Next, place the silicon wafer mold in a square dish (another layer can be prepared directly in an empty dish to form a flat PDMS sheet), and slowly pour the degassed PDMS solution into the mold. Then, place the mold in a 4 ℃ environment and let it stand for 1-2 hours. After the air bubbles are mostly removed, transfer the mold to an 85 ℃ constant temperature drying oven for curing for 1 hour. After curing, allow it to cool slightly, then carefully separate the formed PDMS adhesive layer from the silicon wafer mold and completely peel off the PDMS sheet. Remove the PDMS sheet and use a punch to drill holes at the predetermined inlet and outlet positions. Then, observe the chip channel structure under a microscope to check if its size, morphology, and integrity meet the experimental requirements. If the chip channel inspection is satisfactory, perform plasma treatment on both PDMS sheets separately, and then quickly align and bond them after treatment to complete the encapsulation, thus preparing the final microfluidic chip.
[0042] (3) RNA-LNP microfluidic hybrid encapsulation: Before the experiment, the LNP formulation was briefly vortexed and then equilibrated at room temperature for at least 30 minutes. Simultaneously, the RNA sample was diluted to a final concentration of 170 ng / μL using citrate buffer (pH=4) to meet the requirements for nucleic acid concentration and acidic environment during subsequent microfluidic assembly. Then, the pre-prepared LNP and mRNA solutions were drawn up using 2 mL syringes and fixed onto microinjection pumps. After connecting the microfluidic chip, the flow rates of the two pumps were set to a 3:1 ratio between the mRNA and LNP phases to ensure thorough mixing of the two phases within the chip channels and to promote the formation of the mRNA-LNP formulation. After mixing, the resulting mRNA-LNP formulation was collected at the chip outlet using a sterile, enzyme-free centrifuge tube. Finally, the collected formulation was temporarily stored at 4 °C for subsequent characterization and experimental use.
[0043] 4. Characterization and feasibility evaluation of the whole RNA CRISPR / Cas9 gene editing system: (1) Cell culture and transfection: HEK-293T cell line was purchased from the Cell Bank of the Chinese Academy of Sciences. After cell resuscitation, cells were seeded in pre-equilibrated medium and cultured in a cell culture incubator at 37 ℃, saturated humidity, and 5% CO2 to maintain stable cell growth. HEK-293T cells were seeded into six-well plates, 300,000 cells per well, and cultured in a 37 ℃ incubator supplemented with 5% CO2. When the cell density reached 70%-80%, RNA-LNP drug was added to each well at a dose of 5 μg, gently mixed, and incubated for 48 h.
[0044] (4) Flow cytometry: Forty-eight hours after transfection, the original culture medium was discarded, and 200 μL of trypsin was added to the culture dish. The dish was then incubated for 1 min. The trypsin was discarded, and 500 μL of 1×PBS was added and gently pipetted to resuspend the cells. The cell suspension was then transferred to a sterile centrifuge tube and centrifuged at 4 °C and 300 ×g for 5 min. After centrifugation, the supernatant was discarded, and the cell pellet was retained. The cells were then resuspended in 500 μL of 1×PBS and loaded onto a flow cytometer for analysis.
[0045] (5) Genome extraction: 48 h after transfection, the original culture medium was discarded, and 200 μL of trypsin was added to the culture dish. The dish was incubated for 1 min. The trypsin was then discarded, and an appropriate amount of fresh culture medium was added. The cells were gently pipetted to detach and resuspend thoroughly. The mixture was centrifuged at 300 ×g for 5 min, the supernatant was discarded, and the cell pellet was collected. 200 μL of PBS and 20 μL of Proteinase K were added to the cell pellet, and the mixture was vortexed to mix. Then, 200 μL of Buffer BCL was added, and the mixture was vortexed thoroughly. The mixture was incubated at 56 °C for 10 min. 150 μL of anhydrous ethanol was then added, and the mixture was vortexed to mix. If necessary, a brief centrifugation was performed to collect the liquid adhering to the cap and wall of the tube. A FastPure gDNA Mini Columns II adsorption column was placed in a 2 mL Collection Tube, and the entire mixture (including the flocculent precipitate) was transferred to the column. The column was centrifuged at 12000 rpm for 1 min. After discarding the filtrate, place the adsorption column back into the collection tube, add 500 μL of Buffer WA along the column wall, and centrifuge at 12000 rpm for 1 min. After discarding the filtrate, add 600 μL of Buffer WB along the column wall, centrifuge at 12000 rpm for 1 min, discard the filtrate, and repeat this washing step once. Then place the adsorption column in the collection tube and centrifuge the empty column at 12000 rpm for 2 min. After centrifugation, allow it to stand for 2-5 min to allow residual ethanol to evaporate completely. Finally, transfer the adsorption column to a new 1.5 mL centrifuge tube, add 50-200 μL of Elution Buffer to the center of the adsorption membrane, allow it to stand at room temperature for 2-5 min, centrifuge at 12000 rpm for 1 min, and collect the eluted genomic DNA. To improve DNA recovery, the Elution Buffer can be preheated to 55 °C before elution. The final DNA sample should be stored at -20 °C, and for long-term storage, it should be placed at -70 °C to avoid sample degradation.
[0046] (6) Obtain the target fragment by PCR: Genomic DNA was extracted and used as a template to amplify the target fragment via PCR. The PCR products were then detected by 1% agarose gel electrophoresis. After the electrophoresis results showed a clear target band without significant nonspecific amplification, the target PCR product was purified using a SanPrep column-based DNA gel extraction kit.
[0047] (7) T7E1 enzyme digestion detection of mismatched fragments (automated electrophoresis): The gene editing efficiency at the target site was detected using the T7 Endonuclease I enzyme digestion method.
[0048] ① The PCR amplification products were denatured and annealed to allow different allelic fragments to re-anneal and form heterozygous double strands. The annealing system and program configuration are as follows (Tables 4-5): Table 4 Annealing System
[0049] Table 5 Annealing Procedure
[0050] After annealing, 1 μL of T7 Endonuclease I was added to the annealing system, bringing the total reaction volume to 20 μL. The mixture was incubated at 37 °C for 15 min. After the reaction was complete, 1.5 μL of 0.25 M EDTA was added to terminate the reaction. Finally, the enzyme digestion products were analyzed using an Agilent automated electrophoresis system. The lysis area was calculated based on the lysis band signal to estimate the gene editing efficiency at the target site.
[0051] 4. Test Results and Discussion: (1) Construction of Cas9 mRNA and its expression verification in mammalian cells: To verify the basic feasibility of the whole RNA-CRISPR gene editing system, Cas9 mRNA was first constructed, transcribed in vitro, and characterized for quality. Its expression ability in mammalian cells was then further investigated.
[0052] First, glycerol-containing bacteria expressing spCas9 using PUC57 as a vector were obtained from Genewiz Biotechnology Co., Ltd. The bacterial culture was streaked onto a solid culture medium, and single colonies were picked and inoculated into LB broth containing kanamycin. Amplification was performed overnight at 37 °C with shaking. The amplified bacterial culture was collected and plasmid extracted to obtain the spCas9 (PUC57) expression plasmid (…). Figure 1 (A). To facilitate subsequent visualization and verification of spCas9 mRNA expression in cells, a spCas9-EGFP (PUC57) expression plasmid was further constructed based on the spCas9 (PUC57) expression plasmid using seamless cloning technology (Gibson Assembly). Figure 1 (B) The ligation product was transformed into competent cells and cultured on plates. Single clones were picked for sequencing identification, and positive plasmids with correct sequencing results were screened. Further amplification and extraction were performed to obtain the spCas9-EGFP (PUC57) expression vector required for subsequent experiments.
[0053] After obtaining the two plasmids, linearization and restriction enzyme digestion were performed. The digestion products were then used as templates for in vitro transcription experiments to prepare Cas9 mRNA and Cas9-EGFP mRNA. The purity and integrity of the transcription products were subsequently tested to ensure that the obtained mRNA met the requirements for subsequent cell experiments. The results showed that the prepared mRNA had good integrity and its purity met the standards for subsequent transfection experiments. Figure 2 The results indicate that a Cas9 mRNA expression element suitable for validation using a whole RNA-CRISPR system has been successfully constructed.
[0054] To further verify the expression capacity of Cas9 mRNA in mammalian cells, HEK-293T cells were selected as a model cell line, and EGFP was used as the characterizing protein to evaluate the intracellular expression of Cas9-EGFP mRNA. After passage, HEK-293T cells were seeded in six-well plates. When the cells adhered and reached approximately 70%–90% confluence, the medium was replaced with half-serum medium. Subsequently, Cas9-EGFP mRNA was transfected into the cells at a dose of 5 μg per well using LNP as the delivery vector, and the cells were incubated at 37 ℃ in a 5% CO2 incubator to promote the intracellular translation and expression of exogenous mRNA.
[0055] Forty-eight hours after transfection, the intensity of intracellular EGFP fluorescence signal was detected by flow cytometry to evaluate the expression of Cas9-EGFP mRNA. The results showed that, compared with the blank control group, the EGFP fluorescence intensity in the Cas9-EGFP mRNA transfected group was significantly increased, indicating that the constructed Cas9-EGFP mRNA could be effectively expressed in HEK-293T cells. Figure 3 This result demonstrates that Cas9 mRNA not only possesses excellent in vitro preparation quality but also can be successfully translated in mammalian cells under LNP-mediated delivery conditions, providing an important prerequisite for subsequent functional validation of the whole RNA-CRISPR gene editing system.
[0056] (2) Design of model target sgRNA and verification of the editing activity of the whole RNA-CRISPR system: After confirming the effective expression of Cas9 mRNA in mammalian cells, two model target sites were selected to design and validate the editing activity of sgRNAs in order to further evaluate the functional integrity of the whole RNA-CRISPR gene editing system. Candidate sgRNAs were designed and screened, and their editing effects were validated in two mammalian cell lines with high transfection efficiency to systematically assess the feasibility and stability of the constructed whole RNA-CRISPR system. DNMT1 and FANCF were selected as model target sites. DNMT1 is the most important maintenance DNA methyltransferase in mammalian cells. FANCF is an important component of the Fanconi anemia pathway.
[0057] Table 6. Pattern Target sgRNA
[0058] After identifying the target patterns, sgRNAs were designed targeting the DNMT1 and FANCF genes (Table 6). The editing activity of the whole RNA-CRISPR gene editing system was further evaluated in HEK-293T cells. Cas9 mRNA and sgRNA were premixed at a molar ratio of 1:15 (approximately a mass ratio of 1:3), then co-encapsulated with LNPs to form an LNP-RNA complex, which was used for transfection of HEK-293T cells.
[0059] Cells were collected at 36 h and 48 h post-transfection, genomic DNA was extracted, and the target region was amplified by PCR. Gene editing efficiency was analyzed by T7 Endonuclease I (T7E1) digestion combined with automated electrophoresis. Figure 4 The results showed that at 36 h post-transfection, significant editing signals were detected at both DNMT1 and FANCF target sites, with editing efficiencies exceeding 50%, and the DNMT1 site achieving an editing efficiency exceeding 60%. By 48 h, the editing efficiencies of both targets had further improved, approaching 70% (Table 7). These results demonstrate that the whole RNA-CRISPR gene editing system can achieve high levels of gene editing activity in HEK-293T cells, proving its good feasibility for in vitro application and providing a foundation for the subsequent construction and optimization of the Nogo-B targeting system.
[0060] Table 7. Editing efficiency of sgRNA at model target sites
[0061] Example 2: Construction and Optimization of the Nogo-B Targeted Whole RNA-CRISPR Gene Editing System 1. Construction of the Nogo-B-targeted whole RNA-CRISPR gene editing system: The procedure includes steps such as plasmid extraction, preparation of linearized plasmid templates, in vitro transcription, RNA purification, RNA capillary electrophoresis detection, and sgRNA ordering. For detailed procedures, please refer to Example 1.
[0062] 2. Preparation of Nogo-B-targeted RNA-LNP formulation: The process includes steps such as the preparation of RNA samples and lipid nanoparticles (LNPs), the preparation of microfluidic chips, and the microfluidic mixing and encapsulation of RNA-LNPs. For detailed procedures, please refer to Example 1.
[0063] 3. Evaluation of the editing efficiency of the Nogo-B targeted whole RNA-CRISPR gene editing system: (1) For detailed operation of cell culture and transfection, genomic DNA extraction, target fragment PCR amplification and T7E1 enzyme digestion mismatch detection, please refer to Example 1.
[0064] (2) qRT-PCR detection of the reduced level of Nogo-B mRNA: ①Total RNA Extraction: First, add 500 μL of Buffer RL to the extracted cell pellet and vortex thoroughly. Add an equal volume of anhydrous ethanol to the sample filtrate and vortex to mix, allowing RNA to bind to the purification column membrane under suitable conditions. Next, transfer the mixture to a FastPure RNA Columns III purification column and centrifuge at 12000 rpm for 30 seconds, discarding the filtrate in the collection tube. Add 700 μL of Buffer RW1 to the purification column and centrifuge at 12000 rpm for 30 seconds, discarding the filtrate. Then add 700 μL of Buffer RW2 and centrifuge at 12000 rpm for 30 seconds, discarding the filtrate. Continue adding 500 μL of Buffer RW2 to the purification column and centrifuge at 12000 rpm for 2 minutes. After centrifugation, carefully remove the adsorption column from the collection tube. Finally, the purification column was transferred to a new RNase-free centrifuge tube, and 40 μL of RNase-free ddH2O was added vertically along the center of the column membrane. After standing at room temperature for 2 min, the tube was centrifuged at 12000 rpm for 1 min to complete RNA elution. The concentration of the obtained RNA sample was determined using a NanoDrop2000.
[0065] ② Genomic DNA removal: Prepare the genomic DNA reaction solution on ice according to Table 8, gently mix, and incubate at 42 °C for 2 min to remove genomic DNA.
[0066] Table 8 Genomic DNA Removal System
[0067] ③ cDNA preparation: Prepare the reverse transcription system on ice according to Table 9, gently mix, incubate at 37 ℃ for 15 min, and terminate the reaction by incubating at 85 ℃ for 5 s. Place the obtained cDNA on ice for the subsequent qPCR steps.
[0068] Table 9 Reverse Transcription System
[0069] ④ qPCR: qPCR was performed using the SYBR method, with a total of 20 μL of reagents prepared. Three parallel reaction systems were designed for each sample, as shown in Table 10: Table 10 qPCR System
[0070] After configuring the above system, perform detection using a two-step qPCR method. The procedure is as follows (Table 11): Table 11 qPCR Procedure
[0071] Finally, the melting curves of the amplification products were analyzed using the accompanying instrument software to assess the specificity of the amplification reaction. After confirming that the melting curves were normal and that there was no significant non-specific amplification or primer dimer interference, the experimental data were further processed, and 2... -ΔΔCt The method calculates the relative expression change level of the target gene to evaluate the degree of upregulation or downregulation.
[0072] 4. Safety evaluation of the Nogo-B targeted whole RNA-CRISPR gene editing system: (1) For detailed operation of cell culture and transfection, genomic DNA extraction, target fragment PCR amplification and T7E1 enzyme digestion mismatch detection, please refer to Example 1.
[0073] (2) Detection of off-target bands by agarose gel electrophoresis: PCR amplification products from off-target sites were detected by electrophoresis using 2% agarose gel.
[0074] 5. Experimental Results: (1) Design and editing efficiency evaluation of human Nogo-B candidate sgRNAs: To construct a whole-RNA CRISPR gene editing system targeting human Nogo-B, candidate sgRNAs were first designed and screened around the Nogo-B gene (Table 12). The human RTN4 gene contains 17 exons at the gene locus level, located on the short arm of chromosome 2 at 2p16.1, with coordinates chr2: 54,972,189–55,137,831 on the reference genome GRCh38.p14. A validated human Nogo-B targeting sequence with editing activity was selected as a positive reference and named h-sgRNA1, targeting the first exon of RTN4 (Exon1). Based on this, and considering the exon distribution characteristics of the Nogo-B gene, another candidate sequence, h-sgRNA2, was further designed and obtained, targeting the ninth exon of RTN4 (Exon9).
[0075] Table 12 Targeting human Nogo-B sgRNA sequences
[0076] To compare the actual editing performance of the two candidate sgRNAs, preliminary screening and validation were first performed in HEK-293T and A549 cells with good transfection performance. Cell samples were collected 48 h after transfection, and gene editing efficiency was detected by automated electrophoresis. The results showed (Table 13) that the overall editing efficiency of h-sgRNA2 was higher than that of h-sgRNA1 in both cell types. Table 13 Editing efficiency of Nogo-B-targeted h-sgRNA in model cells
[0077] Nogo-B mRNA expression changes were evaluated using qRT-PCR. qRT-PCR results ( Figure 5 The results showed that the downregulation of Nogo-B mRNA mediated by h-sgRNA2 was also more significant. These results suggest that h-sgRNA2 exhibits superior targeting ability in in vitro cell models and can serve as a human sgRNA candidate for further validation and optimization.
[0078] (2) Validation of human Nogo-B candidate sgRNA in HepG2 cells: The editing efficiency of h-sgRNA1 and h-sgRNA2 in HepG2 cells was further screened and validated. Cell samples were collected 48 h after transfection, and the editing efficiency of the target sites was detected by automated electrophoresis. The expression changes of Nogo-B mRNA were analyzed by qRT-PCR.
[0079] Table 14 Editing efficiency of Nogo-B-targeted h-sgRNA in HepG2 cells
[0080] The results showed that, Figure 6 (and Table 14) The editing efficiency of h-sgRNA1 was higher than that of h-sgRNA2 in automated electrophoresis detection; however, qRT-PCR results showed that the downregulation of Nogo-B mRNA mediated by h-sgRNA2 was more significant. Figure 7 ).
[0081] The results suggest that different sgRNAs may not be entirely consistent in their DNA cleavage efficiency and transcript repression effects. Automated electrophoresis mainly reflects the overall level of insertion / deletion mutations at the target site, while qRT-PCR focuses more on evaluating the actual intervention effect on the target transcript after gene editing. Although h-sgRNA1 showed a high editing rate at the genomic level, h-sgRNA2's target region covers more exons, theoretically giving it a broader intervention capability for different transcripts. Simultaneously, the mutation types it induces may be more likely to lead to frameshift mutations and premature stop codon formation, thereby triggering nonsense-mediated mRNA degradation and enhancing transcript clearance. Therefore, combining the results of automated electrophoresis and qPCR, h-sgRNA2 performs better in functionally inhibiting Nogo-B expression and is more suitable as a candidate sequence for subsequent optimization of the human Nogo-B-targeting whole RNA-CRISPR system.
[0082] (3) Design and screening of mouse-derived Nogo-B candidate sgRNAs: Candidate sgRNAs were designed and screened around the mouse Nogo-B gene. The mouse RTN4 gene is located on chromosome 11 of GRCm39 mice, with a gene interval of approximately chr11:29,642,898-29,694,414. It contains 11 exons at the gene locus level, of which the major transcript contains 9 exons.
[0083] The target regions were selected as exons 2, 4, and 9, and m-sgRNA2, m-sgRNA4, and m-sgRNA9 were designed respectively (Table 15), and comparisons were made in Hepa1-6 cells. Cell samples were collected 48 h after transfection to test the editing efficiency. Automated electrophoresis results showed that the editing efficiency of m-sgRNA2 reached approximately 40% ( Figure 8 (and Table 16), which is superior to the other two candidate sequences.
[0084] Table 15 Design information for targeting murine Nogo-B sgRNA
[0085] Table 16 Editing efficiency of Nogo-B-targeted murine sgRNA
[0086] Based on the combined results, m-sgRNA2 was ultimately selected as the mouse-derived candidate sgRNA for subsequent experiments.
[0087] (4) Verification of the editing efficiency of m-sgRNA2 in different mouse hepatocytes: To further confirm the editing stability of m-sgRNA2 and its applicability in different mouse hepatocyte backgrounds, it was further validated in normal mouse hepatocytes (AML12), mouse embryonic hepatocytes (BNLCL.2), and Hepa1-6 cells. Cells were cultured for 48 h after transfection, and genomic DNA was extracted. The editing efficiency at the target site was detected by automated electrophoresis. The results showed that m-sgRNA2 produced a relatively stable editing effect in all three mouse hepatocyte types, with editing efficiencies exceeding 40%. Figure 9 (and Table 17), indicating that the candidate sequence has good genome editing activity in different cellular backgrounds.
[0088] Table 17 m-sgRNA2 editing efficiency
[0089] Based on this, qRT-PCR was used to detect changes in Nogo-B mRNA expression to evaluate the functional repressive effect of m-sgRNA2 at the transcript level. The results showed that in BNL CL.2 and Hepa1-6 cells, Nogo-B mRNA levels significantly decreased 48 h after transfection. Figure 10 This indicates that m-sgRNA2 can not only induce effective editing at the DNA level, but also achieve significant functional silencing in some mouse hepatocytes. Ultimately, m-sgRNA2 was determined to be a viable mouse-derived sgRNA for subsequent in vivo experiments.
[0090] (5) Off-target prediction and preliminary safety evaluation of m-sgRNA2: Off-target prediction of m-sgRNA2 was performed using CRISPOR, and three potential off-target sites with high scores were selected as key targets for detection from the prediction results, namely TB-1, TB-2 and TB-3 (Table 18).
[0091] Table 18 Analysis of m-sgRNA2 off-target effects
[0092] Subsequently, PCR amplification was performed on the aforementioned sites, and the corresponding products were detected by agarose gel electrophoresis to observe whether there were obvious non-specific editing signals. The results showed that no obvious abnormal bands or identifiable off-target phenomena were found in any of the three high-risk potential off-target sites detected, suggesting that m-sgRNA2 did not exhibit a significant off-target risk. Figure 11 ).
[0093] Example 3: In vivo pharmacodynamic evaluation of the Nogo-B targeted LNP / CRISPR delivery system 1. Establishment of an atherosclerosis model: Eight-week-old male C57BL / 6J mice (healthy male C57BL / 6J mice, 18-20 g, purchased from Liaoning Changsheng Biotechnology Co., Ltd.) were selected as experimental animals. An atherosclerosis model was established by continuously feeding the mice with a high-cholesterol diet for 16 weeks. The experimental diet used was the purified high-cholesterol diet of Synergistic Biotechnology XT109C. After 16 weeks of induction with the high-cholesterol diet, the mice generally gained weight to over 35 g, and serum total cholesterol and low-density lipoprotein cholesterol levels were significantly elevated. Simultaneously, obvious atherosclerotic plaque formation was observed in the aorta, indicating that the atherosclerosis model was successfully established.
[0094] 2. Preparation and characterization of LNP / CRISPR drug formulations: (1) Preparation of LNP / CRISPR drug formulations: ①The preparation of RNA samples and lipid nanoparticles (LNPs), microfluidic chip preparation, and RNA-LNP microfluidic mixing and encapsulation are detailed in Example 1.
[0095] ②mRNA-LNP dialysis to remove ethanol: The mRNA-LNP formulation was purified using a regenerated cellulose membrane dialysis unit (Φ22 mm × 23 μm, MWCO 14 kDa). The nano-formulation was added to a pretreated dialysis unit, double-sealed, and dialyzed in pre-cooled DPBS buffer at 4 ℃ for 16 h. Magnetic stirring at 200 rpm was maintained during dialysis, and the buffer was changed every 3-4 h to ensure purification efficiency.
[0096] (2) Characterization of LNP / CRISPR drug formulations: ① mRNA-LNP particle size measurement after dialysis: Take 4 μL of the dialyzed mRNA-LNP preparation, dilute it with sterile PBS and mix thoroughly, then use a laser particle size analyzer to determine its particle size and dispersion. The average particle size of a qualified mRNA-LNP preparation should be controlled within the range of 100-150 nm.
[0097] ② mRNA-LNP encapsulation efficiency measurement after dialysis: The RNA concentration in the dialyzed mRNA-LNP formulation was measured using the Quant-iT™ RiboGreen RNA quantification kit, and its encapsulation efficiency was calculated. Simultaneously, based on the actual encapsulated mRNA concentration, the required drug volume for subsequent animal experiments was calculated.
[0098] 3. Evaluation of the effect of liver Nogo-B gene knockout: (1) Mouse grouping: After establishing the atherosclerosis model, C57BL / 6J mice were randomly divided into 6 groups of 4 mice each. The specific groups were as follows: normal diet control group (ND-PBS group), short-term observation group of normal diet treatment (ND-S-Cas9-Nogo-B group), long-term observation group of normal diet treatment (ND-L-Cas9-Nogo-B group), high-cholesterol diet control group (HCD-PBS group), short-term observation group of high-cholesterol diet treatment (HCD-S-Cas9-Nogo-B group), and long-term observation group of high-cholesterol diet treatment (HCD-L-Cas9-Nogo-B group).
[0099] (2) Drug administration and sample collection in mice: After grouping, the treatment group mice were administered RNA / LNP preparations via tail vein injection at a dose of 2 mg / kg. The general condition of the mice was continuously observed after administration. Samples were collected from the short-term observation group 48 hours after administration. Whole blood was collected from the mice, followed by euthanasia. The heart, liver, spleen, lungs, and kidneys were immediately dissected and separated. The obtained blood and tissue samples were used for subsequent related indicator detection, histopathological analysis, and evaluation of gene editing effects. The entire administration and sample collection process was strictly performed according to laboratory animal operating procedures to ensure the reliability and reproducibility of the experimental results.
[0100] (3) Extraction of the genome of the five internal organs of mice: Take a sample of minced tissue (less than 25 mg) or tissue that has been ground in liquid nitrogen and place it in a 1.5 mL centrifuge tube. The sample size for spleen and kidney tissue should be controlled to be less than 10 mg. Add 200 μL of Buffer ACL and 20 μL of Proteinase K to the sample sequentially, vortex to mix, and then digest in a 56 °C water bath until the tissue is completely lysed. Then add 200 μL of Buffer BCL, vortex to mix, and then add 150 μL of anhydrous ethanol. After vortexing to mix, a flocculent precipitate will form. Briefly centrifuge to collect the liquid adhering to the tube cap and wall. Place a FastPure gDNA Mini Columns II adsorption column in a 2 mL CollectionTube. Transfer the above mixture, along with the flocculent precipitate, to the adsorption column. Centrifuge at 12000 rpm for 1 min, discard the filtrate, and place the adsorption column back into the collection tube. Add 500 μL of Buffer WA (confirm anhydrous ethanol has been added before use) along the wall of the adsorption column, centrifuge at 12,000 rpm for 1 min, and discard the filtrate. Then add 600 μL of Buffer WB (confirm anhydrous ethanol has been added before use) along the wall of the column, centrifuge at 12,000 rpm for 1 min, discard the filtrate, and repeat this washing step once. After washing, place the adsorption column in a collection tube and centrifuge the empty column at 12,000 rpm for 2 min to remove residual wash solution. If necessary, open the cap and let it stand for 2–5 min to allow residual ethanol to evaporate completely. Finally, transfer the adsorption column to a new 1.5 mL centrifuge tube, add 50–200 μL of Elution Buffer to the center of the adsorption membrane, incubate at room temperature for 2–5 min, and then centrifuge at 12,000 rpm for 1 min to elute. Discard the adsorption column, collect the obtained genomic DNA, and store at -20℃. For long-term storage, store at -70℃ to prevent DNA degradation.
[0101] (4) Experimental steps such as PCR amplification of the target fragment and T7E1 enzyme digestion mismatch detection are detailed in Example 1.
[0102] 4. In vivo pharmacodynamic evaluation: (1) Preparation of fresh serum: After collecting fresh whole blood from mice, the blood was allowed to stand at room temperature for 2 hours to allow for complete coagulation. Then, it was centrifuged at 3000 rpm for 10 minutes at 4 °C, and the supernatant serum was collected. The obtained serum was aliquoted according to experimental requirements and stored at -80 °C for later use.
[0103] (2) Four blood lipid tests: The four lipid assay kits provided by Nanjing Jiancheng Bioengineering Research Institute Co., Ltd. were used to measure the levels of total cholesterol (TC), triglycerides (TG), high-density lipoprotein cholesterol (HDL-C), and low-density lipoprotein cholesterol (LDL-C) in mouse serum, strictly following the kit instructions.
[0104] (3) Detection of aortic atherosclerotic plaques: For Oil Red O staining of the mouse aorta, mice were first euthanized, and the thoracic and peritoneal cavities were fully exposed. PBS was perfused into the heart to remove blood. The aortic root was then carefully separated, removing surrounding fat and connective tissue as completely as possible. The separated aorta was fixed in fixative for 15 min, then the fixative was discarded, and the aorta was washed 3-4 times with ultrapure water. Subsequently, the aorta was treated with 60% isopropanol to remove residual water. Oil Red O working solution was prepared in advance before use. Saturated Oil Red O staining solution was thoroughly mixed with distilled water in a specific ratio, allowed to stand, and filtered before use. The treated aortic tissue was completely immersed in the Oil Red O working solution and stained in the dark for 30 min. After staining, the aortic tissue was removed and rapidly differentiated in 60% isopropanol for a few seconds to remove non-specific background staining, followed immediately by several rinses with distilled water. If necessary, a light counterstaining with hematoxylin could be performed to reveal the tissue structure, followed by rinsing again with running water and re-blue staining. Finally, the aorta is carefully cut longitudinally and laid flat on a black wax plate or glass slide, keeping the intima side facing up, spreading it out as much as possible and avoiding tissue shrinkage, and then photographed for record-keeping.
[0105] 5. In vivo safety evaluation: (1) Off-target detection: For detailed procedures such as PCR amplification of the target fragment and T7E1 restriction enzyme digestion mismatch detection, please refer to Example 1.
[0106] (2) Four blood lipid tests: The four lipid assay kits provided by Nanjing Jiancheng Bioengineering Research Institute Co., Ltd. were used to measure the levels of total cholesterol (TC), triglycerides (TG), high-density lipoprotein cholesterol (HDL-C), and low-density lipoprotein cholesterol (LDL-C) in mouse serum, strictly following the kit instructions.
[0107] (3) ELISA staining: The content of target molecules in the sample was detected by enzyme-linked immunosorbent assay (ELISA).
[0108] (4) HE staining: Bake paraffin-embedded tissue sections at 60 °C for 30-60 min. Then dewax them sequentially in xylene I and xylene II for 10 min each, followed by immersion in anhydrous ethanol I, anhydrous ethanol II, 95% ethanol, 85% ethanol, and 75% ethanol for 3-5 min each. Finally, rinse with distilled water for 2-3 min to ensure complete hydration. Stain the sections in hematoxylin solution for 3-8 min, then rinse with tap water. Differentiate in 1% hydrochloric acid ethanol for 3-10 s, then immediately rinse with tap water. Afterward, gently run in tap water for 5-10 min until the cell nuclei turn blue, then rinse briefly with distilled water. Counterstain the sections in eosin solution for 30 s-3 min. Rinse quickly with distilled water. Then dehydrate sequentially in 75% ethanol, 85% ethanol, 95% ethanol, anhydrous ethanol I, and anhydrous ethanol II for 1-3 min each; then clear in xylene I and xylene II for 5 min each. Finally, add neutral resin to seal the slide, let it dry, and then observe and collect images under a microscope.
[0109] 6. Experimental Results and Discussion: (1) Establishment and evaluation of a mouse model of atherosclerosis: The experimental results showed that, compared with the normal diet group, the high-cholesterol diet group mice showed a more significant trend of weight gain after feeding. Figure 13 Meanwhile, the results of the four lipid tests indicated significantly elevated levels of total cholesterol and low-density lipoprotein cholesterol. Figure 12 This indicates that the mice have developed a relatively obvious state of hypercholesterolemia.
[0110] Further results of aortic oil red O staining showed that ( Figure 14 In the high-cholesterol diet group, significant lipid deposition was observed on the surface of the aorta, with a marked increase in the area of positive staining, indicating the formation of a typical lipid accumulation phenotype within the aorta. Considering the changes in body weight, abnormal blood lipids, and the results of Oil Red O staining of the aorta, the mouse model established in this study has effectively simulated the pathological features associated with atherosclerosis. Therefore, a high-cholesterol diet successfully induced and established a stable mouse model of atherosclerosis.
[0111] (2) Physicochemical characterization of Nogo-B-targeted LNP / CRISPR drug formulation: The prepared LNP-mRNA formulation was characterized by its physicochemical properties. The results showed that the average particle size of the LNP-mRNA formulation was 116.74 nm ± 5.33 nm (Table 15), indicating that the formulation possesses suitable nanoscale characteristics. Meanwhile, the polydispersity index (PDI) of the formulation was 0.186 ± 3.01% (Table 19), suggesting a relatively concentrated particle distribution. Figure 15The good uniformity indicates that the preparation process effectively controls particle size and reduces the instability risk caused by excessively wide particle size distribution. Further testing showed that the formulation encapsulates 94.61% of mRNA, demonstrating that the LNP system can efficiently encapsulate mRNA molecules and effectively reduce the proportion of free mRNA. This high encapsulation efficiency not only helps improve the stability of mRNA in both in vivo and in vitro environments and reduces the risk of nuclease degradation, but also provides a fundamental guarantee for subsequent cellular uptake and intracellular release.
[0112] Table 19 Quality Characterization of RNA / LNP Formulations
[0113] (3) Evaluation of the gene editing effect of Nogo-B targeting the LNP / CRISPR system in mice: First, the editing of the target gene in mouse liver was examined. Normal diet (ND) and high-cholesterol diet (HCD) groups were established, and each group was further divided into a PBS control group, a short-term administration group, and a long-term administration group to systematically investigate the in vivo editing performance of the system under different physiological and pathological conditions. After the experiment, mouse liver tissue was collected, genomic DNA was extracted, and the target region was amplified by PCR. Automated electrophoresis was then used to detect the editing efficiency of the Nogo-B target site. By comparing the changes in the editing bands among the groups, it was determined whether the LNP / CRISPR system could successfully deliver and effectively cleave the Nogo-B gene in vivo. The results showed ( Figure 16 Significant Nogo-B target site editing signals were detected in the livers of mice in all treatment groups, indicating that the constructed Nogo-B-targeted LNP / CRISPR delivery system can achieve effective gene cleavage in vivo. Quantitative analysis further showed that the in vivo editing effect of this system was time-dependent: in both the high-cholesterol diet group and the normal diet group, the editing efficiency of the long-term group (L) was higher than that of the corresponding short-term group (S). Among them, the L-HCD group had the highest editing level, while the short-term group was generally lower than that of the corresponding long-term group. These results suggest that the editing activity of the LNP-delivered whole RNA-CRISPR system in the liver is further enhanced with prolonged treatment time.
[0114] Comparative results from different dietary backgrounds and dosing cycles showed that the Nogo-B targeted LNP / CRISPR system maintained relatively stable editing levels in mice on both normal and high-cholesterol diets, indicating its applicability under various physiological and pathological conditions. Therefore, the Nogo-B targeted LNP / CRISPR delivery system achieved gene editing efficiency exceeding 40% in mouse liver, demonstrating its good in vivo editing capability and its suitability for subsequent pharmacodynamic studies.
[0115] (4) Evaluation of the lipid-lowering and anti-atherosclerotic effects of Nogo-B targeting the LNP / CRISPR system: To evaluate the lipid-lowering effect of the Nogo-B-targeted LNP / CRISPR delivery system in vivo, serum levels of total cholesterol (TC), triglycerides (TG), low-density lipoprotein cholesterol (LDL-C), and high-density lipoprotein cholesterol (HDL-C) were measured in mice of each group. The results showed ( Figure 17 Compared with the ND-PBS group, the serum TC and LDL-C levels in the HCD-PBS group mice were significantly increased, indicating that a high-cholesterol diet successfully induced a significant dyslipidemia. After treatment with the Nogo-B-targeted LNP / CRISPR system, the serum TC and LDL-C levels in the HCD-Cas9-Nogo-B group mice were significantly decreased compared with the HCD-PBS group, indicating that this gene-editing system has a good intervention effect on cholesterol elevation induced by a high-cholesterol diet.
[0116] In summary, the Nogo-B-targeted LNP / CRISPR delivery system can significantly improve dyslipidemia caused by a high-cholesterol diet in vivo and inhibit the formation of atherosclerotic plaques to a certain extent, especially its effect on reducing TC and LDL-C is more obvious.
[0117] (5) Preliminary in vivo safety evaluation of the Nogo-B-targeted LNP / CRISPR system: The in vivo safety of the Nogo-B-targeted LNP / CRISPR system was preliminarily evaluated from four aspects: detection of potential off-target sites, observation of blood lipid homeostasis under normal dietary background, detection of inflammatory factors, and pathological analysis of major organs.
[0118] First, for the three high-scoring potential off-target sites predicted using CRISPOR, genome extraction, PCR amplification, and agarose gel electrophoresis were performed on the heart, liver, spleen, lung, and kidney tissues of mice in both short-term and long-term drug administration groups. Figure 18 The results showed that, among the three potential off-target sites detected, the amplified bands in each tissue were of consistent size, and no obvious abnormal bands or additional cleavage signals were observed, suggesting that m-sgRNA2 did not exhibit a clear high-risk off-target effect. These results indicate that the selected m-sgRNA2 maintains good in vivo editing efficiency while possessing good preliminary targeting specificity.
[0119] Secondly, to assess the impact of this delivery system on basal lipid metabolic homeostasis, the levels of four lipid parameters were compared between the PBS group and the Nogo-B targeted drug administration group under normal dietary conditions. Figure 19The results showed no significant differences in total cholesterol, triglycerides, low-density lipoprotein cholesterol, and high-density lipoprotein cholesterol between the ND-PBS group and the ND-Cas9-Nogo-B group, suggesting that this gene editing system does not significantly disturb lipid homeostasis under normal metabolic conditions.
[0120] Furthermore, the ELISA results for inflammatory factors showed ( Figure 20 A high-cholesterol diet can lead to increased inflammation levels, with TNF-α and IL-6 levels significantly higher in the HCD-PBS group compared to the normal diet group. After treatment with the Nogo-B-targeted LNP / CRISPR system, some inflammatory markers fluctuated in the short-term treatment group, particularly IL-6 levels, which increased during the short-term observation period. However, in the long-term treatment group, TNF-α and IL-6 levels significantly decreased, approaching the levels of the normal diet control. Meanwhile, IL-1β showed relatively small fluctuations overall, with no sustained abnormal increases observed. These results suggest that the overall inflammatory response tends to recover with prolonged observation after administration, indicating that the overall inflammatory risk in vivo is controllable.
[0121] Finally, the HE staining results showed ( Figure 21 The overall tissue structure of major organs such as the heart, liver, spleen, lungs, and kidneys of mice in each group remained intact, with no obvious necrosis, hemorrhage, extensive infiltration of inflammatory cells, or significant tissue damage. Combined with the aforementioned off-target site detection and inflammatory factor analysis results, it can be concluded that the Nogo-B-targeting LNP / CRISPR system did not induce significant tissue toxicity or persistent inflammatory responses under the administration conditions used in this application, demonstrating good preliminary in vivo safety. In summary, the Nogo-B-targeting LNP / CRISPR delivery system constructed in this application exhibits good safety in mice, providing experimental evidence for its further application in animal pharmacodynamic studies and subsequent translational applications.
[0122] Therefore, the whole RNA-CRISPR gene editing system of this invention uses Cas9-mRNA and specific sgRNA as core components and LNP as the delivery vector, forming a whole RNA editing and delivery platform. This platform can operate safely and effectively in vivo, improving hepatic cholesterol metabolism, reducing circulating cholesterol levels, and further alleviating atherosclerosis-related lipid burden. Compared with existing intervention strategies, it avoids the risk of genome integration of plasmid vectors and has high biosafety.
[0123] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the technical solutions of the present invention, and these modifications or equivalent substitutions cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.
Claims
1. An sgRNA, characterized in that, It is h-sgRNA2 or m-sgRNA2; The h-sgRNA2 sequence is shown in SEQ ID NO.4; The m-sgRNA2 sequence is shown in SEQ ID NO.
5.
2. The application of the sgRNA described in claim 1 in constructing a Nogo-B-targeted whole RNA-CRISPR gene editing system.
3. The Nogo-B-targeted whole RNA-CRISPR gene editing system, characterized by: It includes Cas9 mRNA and the sgRNA as described in claim 1; the molar ratio of Cas9 mRNA to sgRNA is 1:
15.
4. The method for constructing the Nogo-B-targeted whole RNA-CRISPR gene editing system according to claim 3, characterized in that, Includes the following steps: Step 1, sgRNA design and screening: Suitable target sites were screened based on the Nogo-B gene, and sgRNA sequences were designed. Step 2, Cas9 mRNA expression template design and plasmid construction: Using wild-type SpCas9 plasmid as a template, the codons of the Cas9 open reading frame sequence were optimized. Optimized 5'-UTR and 3'-UTR sequences were ligated to the 5' and 3' ends of the optimized Cas9 coding sequence, respectively, to construct a complete Cas9 mRNA expression framework. After the design was completed, plasmids were synthesized, and the resulting recombinant plasmids were used for subsequent template preparation. Step 3, Recombinant plasmid amplification and extraction: Glycerol bacteria containing the target plasmid were inoculated into LB liquid medium containing kanamycin resistance and cultured overnight at 37°C with shaking. After the culture was completed, the bacterial cells were collected, plasmid DNA was extracted, and its concentration and purity were determined to obtain the Cas9 plasmid. Step 4, Linearization preparation of Cas9 in vitro transcription template: The extracted Cas9 plasmid was linearized by restriction endonuclease BspQI. After the reaction, the plasmid was confirmed to be completely linearized by agarose gel electrophoresis. The digestion product was then purified using a PCR product purification kit, and the DNA concentration and purity were measured to obtain linear DNA for in vitro transcription. Step 5, Cas9 mRNA in vitro transcription and purification: Using linear DNA as a template, Cas9 mRNA was synthesized using the T7 in vitro transcription system. CAP analogs and modified nucleosides were added to the transcription system. After transcription, DNase I was added to digest the residual template DNA. Then, column purification was used to remove enzymes, salt ions and unreacted substrates to obtain purified Cas9 mRNA. Step 6, Construction of the whole RNA-CRISPR gene editing system: The prepared qualified Cas9 mRNA was blended with sgRNA targeting the Nogo-B gene to obtain a whole RNA-CRISPR / Cas9 gene editing system.
5. The construction method according to claim 4, characterized in that: In step 6, after Cas9 mRNA enters the cell, it is translated into Cas9 protein. sgRNA is responsible for guiding Cas9 protein to recognize the target DNA sequence, and the two work together to mediate the editing of the target gene.
6. The use of the whole RNA-CRISPR gene editing system of claim 3 in the construction of whole RNA-CRISPR delivery formulations.
7. A method for constructing a whole RNA-CRISPR delivery formulation, characterized in that, Includes the following steps: 1) Microfluidic chip fabrication: A microfluidic hybrid chip with a complete structure and clear channels was obtained using PDMS soft lithography. 2) Construction of whole RNA-CRISPR delivery formulation: The Cas9 mRNA and sgRNA samples from the Nogo-B-targeted whole RNA-CRISPR gene editing system described in claim 3 were diluted with pH 4 citrate buffer. After the LNP lipid solution was brought to room temperature, it was loaded into a syringe and fixed to a microinjection pump. After connecting the microfluidic chip, the RNA phase and lipid phase were injected into the chip channel at a set flow rate ratio for rapid mixing, so that the Cas9 mRNA and sgRNA were encapsulated by LNP to obtain the whole RNA-CRISPR delivery formulation.
8. The construction method according to claim 7, characterized in that: In step 2), the flow rate ratio of the RNA phase to the lipid phase is 3:1; the ratio of positively charged amino groups in the cationic lipids to negatively charged phosphate groups in the mRNA phase is 6:
1.
9. A whole RNA-CRISPR delivery formulation, characterized in that: It is constructed by the construction method described in any one of claims 7-9.
10. The use of the whole RNA-CRISPR delivery formulation of claim 9 in the preparation of an anti-atherosclerotic drug.