An rna interference fragment targeting eriocheir sinensis da1b receptor gene and application thereof

Abstract

The application discloses an RNA interference fragment targeting a DA1B receptor gene of Eriocheir sinensis and application thereof, and belongs to the technical field of molecular biology of aquaculture. The nucleotide sequence of the RNA interference fragment is shown as SEQ ID NO: 1 to 3; and the application of the RNA interference fragment in preparation of a medicine for regulating fighting behavior of Eriocheir sinensis is also provided. The RNA interference fragment is injected into the body of Eriocheir sinensis in an injection mode, the mRNA expression amount of the DA1B receptor gene of Eriocheir sinensis is interfered, and the fighting behavior of Eriocheir sinensis is regulated. The specific RNA interference fragment targeting the DA1B receptor gene is developed, the molecular precise regulation of the fighting behavior of Eriocheir sinensis is realized, the problem that the aquaculture yield is reduced due to the fighting behavior of Eriocheir sinensis in the aquaculture process is solved, and the application has important industrial value.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology in aquaculture, specifically relating to an RNA interference fragment targeting the DA1B receptor gene of the Chinese mitten crab and its application. Background Technology

[0002] The Chinese mitten crab (Eriocheir sinensis), also known as the river crab, is an important aquaculture species in my country. Fighting behavior is frequent in its pond cultivation, leading to limb mutilation and excessive energy consumption, which is detrimental to the growth and survival of farmed crustaceans. Furthermore, fighting not only causes limb loss affecting quality but also reduces immunity and survival, impacting feeding and reproductive behavior, altering feed input, or causing feed waste. It can also pollute the environment, reduce crab yield, and ultimately lead to economic loss. For example, patent document CN110934099A discloses a method for inhibiting fighting in river crabs using DA receptors. By injecting the crabs with an agonist [R(-)-TNPA], the function of DA protein in the crab's body can be promoted, thereby inhibiting fighting behavior, increasing crab yield, and reducing feed waste and environmental pollution from uneaten feed.

[0003] RNA interference (RNAi) technology is a highly efficient and specific gene silencing technique that uses double-stranded RNA to target and degrade the mRNA of target genes, inhibiting gene expression and precisely regulating physiological and behavioral traits. Current research has confirmed that serotonin and dopamine participate in the regulation of fighting behavior in Chinese mitten crabs through related receptors. Existing technologies, such as patent document CN119913154A, disclose an RNA interference fragment of a crustacean hyperglycemic hormone gene and its application. The provided RNA interference fragment is injected into the third peregrine leg of the Chinese mitten crab to interfere with the mRNA expression of the hyperglycemic hormone gene CHH, effectively controlling the fighting behavior of the Chinese mitten crab. This is beneficial for increasing yields in large-scale Chinese mitten crab farming and reducing economic losses caused by incomplete crabs due to fighting.

[0004] The DA1B receptor gene is an important functional regulatory gene in the Chinese mitten crab (Eriocheir sinensis), participating in physiological processes such as nerve signal transduction and behavioral regulation. It is a key target for regulating the fighting behavior of the Chinese mitten crab. Currently, there are no reports on highly efficient dsRNA interference fragments targeting the DA1B receptor gene of the Chinese mitten crab or related technologies for regulating its fighting behavior. Summary of the Invention

[0005] Based on this, the main objective of this invention is to provide an RNA interference fragment targeting the DA1B receptor gene of Chinese mitten crab, develop a specific RNA interference fragment targeting the DA1B receptor gene, and achieve precise molecular regulation of fighting behavior in Chinese mitten crabs. This has significant industrial value for solving the problem of cannibalism among crabs during aquaculture and improving aquaculture efficiency.

[0006] Another objective of this invention is to provide the application of the RNA interference fragment targeting the DA1B receptor gene of Chinese mitten crab in the preparation of a drug that regulates the fighting behavior of Chinese mitten crab, thereby solving the problem of reduced yield caused by fighting behavior in the breeding process of Chinese mitten crab.

[0007] To achieve the above-mentioned objectives, the present invention adopts the following technical solution:

[0008] In a first aspect, the present invention provides an RNA interference fragment targeting the DA1B receptor gene of the Chinese mitten crab, the nucleotide sequence of which is shown in SEQ ID NO: 1, specifically:

[0009] ACATCTGGATTGCCTTCGACGTCATGTGCTCCACGGCCTCCATCGTGAACCTGTGCGCCATTAGTCTGGACAGATACATCCACATCAAGGACCCGCTGAGGTATGGCCGATGGATGACCAAGCGCATCGTGACCCTGTCCATCGCGGGGATATGGCTCCT CAGCGCTCTCGTCTCCTTCCTACCCATCAGCCTCAAACTCCACAGACCCCCGGACAAGAAGGACGAAGAGCCGCGGCCGACCGGGGGAGAGGATGAGCAGTGCGCCCTCGAACTAAGCAAAATCTACGCCGCGGTCTCCTCCTGCATCAGCTTCTT (SEQ ID NO: 1).

[0010] In a second aspect, the present invention provides an RNA interference fragment targeting the DA1B receptor gene of the Chinese mitten crab, the nucleotide sequence of which is shown in SEQ ID NO: 2, specifically:

[0011] TACTGCGACATCTGGATTGCCTTCGACGTCATGTGCTCCACGGCCTCCATCGTGAACCTGTGCGCCATTAGTCTGGACAGATACATCCACATCAAGGACCCGCTGAGGTATGGCCGATGGATGACCAAGCGCATCGTGACCCTGTCCATC GCGGGGATATGGCTCCTCAGCGCTCCTCGTCTCCTTCCTACCCATCAGCCTCAAACTCCACAGACCCCCGGACAAGAAGGACGAAGAGCCGCGGCCGACCGGGGGAGAGGATGAGCAGTGCGCCCTCGAACTAAGCAAAATCTACGCCGC.

[0012] A third aspect of the present invention provides an RNA interference fragment targeting the DA1B receptor gene of the Chinese mitten crab, the nucleotide sequence of which is shown in SEQ ID NO: 3, specifically:

[0013] CTGATGTGGTGTTCAAGACGCTCACCTGGTTCGGCTACACCAACTCGTCCTTCAACCCGATCATCTATTCCATCTTCAACCAAGAGTTCCGCGACGCCTTCAAGAGAATCCTCACCTCACGCTGCCGCCCCTGCCCC GACTATTGCTGCTGCTGCTGCATCGTCGACCCCGCTGACATCCCCTACTCCTCACCCTCCCAGACGCCCTACCCCTGCGAGTGCTGCGCCTCCTCCTCTTCTCCTCCTCCTCGTGTTGTTGTTGCTGCT (SEQ ID NO: 3).

[0014] In a fourth aspect, the present invention provides the use of the RNA interference fragment targeting the DA1B receptor gene of the Chinese mitten crab in the preparation of a drug for regulating the fighting behavior of the Chinese mitten crab.

[0015] Preferably, the drug uses the RNA interference fragment targeting the DA1B receptor gene of the Chinese mitten crab as the active ingredient, and the drug dosage form is selected from at least one of the following formulations: tablets, capsules, granules, pills, powders, suspensions, or injections.

[0016] More preferably, the drug formulation is an injection, and the RNA interference fragment is injected into the Chinese mitten crab to interfere with the mRNA expression level of the DA1B receptor gene of the Chinese mitten crab.

[0017] More preferably, the RNA interference fragment regulates the fighting behavior of Chinese mitten crabs by inhibiting or reducing the mRNA expression level of the DA1B receptor gene.

[0018] Preferably, the dosage of the RNA interference fragment is 0.1-10 μg / g of the body weight of the Chinese mitten crab.

[0019] More preferably, the dosage of the RNA interference fragment is 1 μg / g of the body weight of the Chinese mitten crab.

[0020] Preferably, the regulation of fighting behavior in Chinese mitten crabs is manifested in a reduction in the number of fights and a decrease in the duration of fights.

[0021] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0022] This invention is the first to propose an RNA interference fragment targeting the DA1B receptor gene of Chinese mitten crab, and develops a specific RNA interference fragment targeting the DA1B receptor gene to achieve precise molecular regulation of fighting behavior in Chinese mitten crabs. This has important industrial value for solving the problem of cannibalism among crabs during aquaculture and improving aquaculture efficiency, and solves the problem of reduced aquaculture yield caused by fighting behavior in Chinese mitten crabs. Attached Figure Description

[0023] Figure 1 The following are the fluorescence signal results after co-culturing different RNA interference fragments with the recombinant vector pEGFP-N1-DA1B in the examples: (A) Blank group (NC group); (BD) pEGFP-N1-DA1B group (empty vector group); (EG) pEGFP-N1-DA1B co-transfected with dsDA1B-1 interference fragment; (HJ) pEGFP-N1-DA1B co-transfected with dsDA1B-2 interference fragment; (KM) pEGFP-N1-DA1B co-transfected with dsDA1B-3 interference fragment; (N) Quantification of the overall fluorescence signal, the value is the mean ± standard error (n = 6), "*" indicates a significant difference in expression compared with the dsEGFP group and the dsDA1B-3 group, p < 0.05.

[0024] Figure 2 The values ​​represent the relative expression levels of different RNA interference fragments and DA1B in the thoracic ganglia of Chinese mitten crabs after 16 hours of in vitro culture. The values ​​are mean ± SE (n = 6), and "*" indicates that the expression difference compared with the dsEGFP group and the dsDA1B-3 group is statistically significant (p < 0.05).

[0025] Figure 3The values ​​represent the relative expression levels of DA1B in the cerebral ganglia (A) and thoracic ganglia (B) of *Eriocheir sinensis* 24 h and 48 h after injection of RNA interference fragments dsDA1B-1, dsDA1B-2, dsDA1B-3 and the comparative RNA fragment dsEGFP into *Eriocheir sinensis* var. *mcg*, p < 0.05, and **, p < 0.01.

[0026] Figure 4 The following values ​​represent the fighting behavior of Chinese mitten crabs 48 h after RNA interference fragments interfered with DA1B in the examples: (A) number of approaching times; (B) number of contact times; (C) number of fights; (D) duration of fights; values ​​are mean ± standard error (n=24). "*" indicates a statistically significant difference in expression compared to the dsEGFP group and the dsDA1B-3 group (p< 0.05), "**" indicates a statistically significant difference in expression compared to the dsEGFP group and the dsDA1B-3 group (p< 0.01), and "ns" indicates no difference between the two groups. Detailed Implementation

[0027] To more fully understand and demonstrate the technical solutions, objectives, and advantages of the present invention, the technical effects produced by the present invention will be further described in detail and completely below with reference to the accompanying drawings and specific embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. It should be noted that other embodiments obtained by those skilled in the art without departing from the concept of the present invention are all within the protection scope of the present invention.

[0028] Example 1: Construction of the vector and dsRNA interference fragment

[0029] (1) Construction of pEGFP-N1-DA1B recombinant plasmid

[0030] The pEGFP-N1-DA1B recombinant plasmid was constructed by Sangon Biotech. The inserted fragment is the coding sequence of the DA1B receptor gene of the Chinese mitten crab. Specific primers were designed based on the multiple cloning site of the pEGFP-N1 expression vector, and corresponding restriction endonuclease sites were added to both ends of the primers. The double restriction sites were HindIII and EcoRI. After obtaining the DA1B gene fragment by PCR amplification, it was ligated into the pEGFP expression vector that had been double-digested with the same restriction endonucleases. The recombinant plasmid was transformed into E. coli TOP10 competent cells. Positive clones were obtained after antibiotic selection. The positive clones were identified by colony PCR, restriction endonuclease digestion, and sequencing. After confirming that the DA1B gene was correctly inserted and that there were no sequence mutations, the plasmid was extracted for subsequent experiments.

[0031] (2) Construction of DA1B dsRNA interference system

[0032] Three pairs of dsDA1B interference primers were designed based on the DA1B gene sequence. The dsDA1B-1, dsDA1B-2 and dsDA1B-3 interference fragments were synthesized using the Novizan T7 RNAi Transcription Kit (TR102) (Vazyme, Nanjing). The control group was the dsEGFP interference fragment, as shown in Table 1.

[0033] Table 1: Primers used for dsRNA interference fragments

[0034]

[0035] Example 2: Validation of effective interference fragments from dsRNA

[0036] (1) Co-transfection of dsRNA interference fragments

[0037] After resuscitating HEK293T cells, they were cultured in a 37°C, 5% CO2 incubator until the cell density reached approximately 90%, then passaged. One day before transfection, HEK293T cells were transferred to 96-well plates and cultured in antibiotic-free DMEM medium. When the cell density reached 2 × 10⁶ cells / well... 5Transfection was performed at cell / well ratio. Cell transfection was performed according to the Lipofectamine 2000 instructions. In this example, the ratio of pEGFP-N1-DA1B to Lip2000 was 1:2. A blank control group, an empty vector group, and an RNA interference group were set up. The blank control group was not transfected, the empty vector group was transfected only with pEGFP-N1-DA1B, and the RNA interference group was co-transfected with pEGFP-N1-DA1B and 1 μg of dsRNA interference fragment. Subsequently, the transfected cells were placed in a 37°C, 5% CO2 incubator for 6 hours. After incubation, the medium was replaced with fresh DMEM containing 10% FBS, and the cells were incubated at 37°C, 5% CO2 for another 48 hours. Fluorescence was observed under a fluorescence microscope, and fluorescence expression was analyzed using ImageJ.

[0038] The effectiveness of the dsDA1B interference fragment was verified by cell transfection experiments. Results showed that the blank group (NC group) had no fluorescence signal; the recombinant vector group showed a clear green fluorescence signal. After co-transfection with the dsDA1B interference fragment, compared with the pEGFP-N1-DA1B group, the fluorescence signals of the pEGFP-N1-DA1B + dsDA1B-1 group and the pEGFP-N1-DA1B + dsDA1B-3 group were significantly reduced (p < 0.01); the fluorescence signal of the pEGFP-N1-DA1B + dsDA1B-2 group was also reduced compared with the recombinant vector group, but not significantly. Figure 1 AN).

[0039] (2) Take a 24-well sterile culture plate and add 200 μL of M199 medium containing 1% penicillin antibiotics to each well. Then add different interfering fragments (dsEGFP, dsDA1B-1, dsDA1B-2, dsDA1B-3), with dsEGFP as the control group. Set up 6 replicate wells for each group, add 1 μg of interfering fragment to each well and mix gently. Use forceps to put the cleaned thoracic ganglia into each well and incubate in a constant temperature incubator at 28 ℃ for 16 h. Finally, take thoracic ganglion samples to analyze the expression level of DA1B mRNA.

[0040] The thoracic ganglion was co-cultured with a dsDA1B interference fragment. After 16 h of in vitro culture, the expression of DA1B mRNA in the thoracic ganglion of *Eriocheir sinensis* was as follows: Figure 2 As shown in the figure. The results showed that the dsDA1B-3 interference fragment significantly reduced the expression of DA1B mRNA (p<0.05); while the dsDA1B-1 and dsDA1B-2 interference fragments reduced the expression of DA1B mRNA, but the difference was not statistically significant compared with the dsEGFP group.

[0041] Example 3: RNA interference fragment of the DA1B receptor gene

[0042] The nucleotide sequence of the RNA interference fragment dsDA1B-1 is shown in SEQ ID NO: 1, and is as follows:

[0043] ACATCTGGATTGCCTTCGACGTCATGTGCTCCACGGCCTCCATCGTGAACCTGTGCGCCATTAGTCTGGACAGATACATCCACATCAAGGACCCGCTGAGGTATGGCCGATGGATGACCAAGCCGCATCGTGACCCTGTCCATCGCGGGGATATGGCTC CTCAGCGCTCTCGTCTCCTTCCTACCCATCAGCCTCAAACTCCACAGACCCCCGGACAAGAAGGACGAAGAGCCGCGGCCGACCGGGGGAGAGGATGAGCAGTGCGCCCTCGAACTAAGCAAAATCTACGCCGCGGTCTCCTCCTGCATCAGCTTCTT.

[0044] The nucleotide sequence of the RNA interference fragment dsDA1B-2 is shown in SEQ ID NO: 2, as follows:

[0045] TACTGCGACATCTGGATTGCCTTCGACGTCATGTGCTCCACGGCCTCCATCGTGAACCTGTGCGCCATTAGTCTGGACAGATACATCCACATCAAGGACCCGCTGAGGTATGGCCGATGGATGACCAAGCGCATCGTGACCCTGTCCATC GCGGGGATATGGCTCCTCAGCGCTCCTCGTCTCCTTCCTACCCATCAGCCTCAAACTCCACAGACCCCCGGACAAGAAGGACGAAGAGCCGCGGCCGACCGGGGGAGAGGATGAGCAGTGCGCCCTCGAACTAAGCAAAATCTACGCCGC.

[0046] The nucleotide sequence of the RNA interference fragment dsDA1B-3 is shown in SEQ ID NO: 3, as follows:

[0047] CTGATGTGGTGTTCAAGACGCTCACCTGGTTCGGCTACACCAACTCGTCCTTCAACCCGATCATCTATTCCATCTTCAACCAAGAGTTCCGCGACGCCTTCAAGAGAATCCTCACCTCACGCTGCCGCCCCTGCCCCGACTATTGCTGCTGCTGCTGCATCGTCGACCCCGCTGACATCCCCTACTCCTCACCCTCCCAGACGCCCTACCCCTGCGAGTGCTGCGCCTCCTCCTCTTCTTCCTCCTCCTCCTCGTGTTGTTGTTGCTGCT。

[0048] Comparative example: Double-stranded RNA of dsEGFP enhanced green fluorescent protein was used as a comparative example, and its nucleotide sequence is shown in SEQ ID NO: 4, which is specifically as follows:

[0049] ACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGC。

[0050] Example 4

[0051] Forty-eight healthy and intact Chinese mitten crabs were collected and divided into four groups: a control group (dsEGFP), a dsDA1B-1 injection group (dsDA1B-1), a dsDA1B-2 injection group (dsDA1B-2), and a dsDA1B-3 injection group (dsDA1B-3), with a dosage of 1 μg / g. After injection, the Chinese mitten crabs were returned to a recirculating aquaculture system. Thoracic ganglia and cerebral ganglia were harvested at 24 h and 48 h, respectively, and were rapidly frozen in liquid nitrogen and stored at -80℃ for later use. The expression level of DA1B mRNA in each group was analyzed by qRT-PCR.

[0052] To further determine the effective duration of DA1B dsRNA in *Eriocheir sinensis*, in vivo experiments were conducted at 24 h and 48 h after DA1B dsRNA injection. The results showed that at 24 h post-injection, compared with the dsEGFP group, the three interfering fragments had no significant effect on DA1B mRNA expression in the cerebral and thoracic ganglia. At 48 h post-injection, DA1B mRNA expression levels in the cerebral ganglia of *Eriocheir sinensis* in the dsDA1B-1, dsDA1B-2, and dsDA1B-3 groups decreased, but only the dsDA1B-3 group showed a significant decrease (p < 0.05). In the thoracic ganglia, DA1B mRNA expression levels decreased in all three interfering fragment groups, with only the dsDA1B-3 group showing a significant decrease (p < 0.01). Figure 3 Therefore, the dsDA1B-3 interference fragment was selected as the optimal interference fragment for subsequent behavioral experiments.

[0053] Example 5

[0054] Forty-eight healthy male crabs with intact limbs were randomly selected and paired, with a weight difference of no more than 4% between each pair. To eliminate experimental error, the crabs used in the behavioral experiment were first placed in a monoculture system and raised separately for 7 days. After 7 days, based on the above experimental results, dsEGFP and dsDA1B-3 interference fragments were injected into the crabs at a dose of 1 μg / g of the crab's body weight. A second injection was given 48 hours later, and the fighting behavior of the crabs was observed and recorded within 1 hour. Twelve pairs of crabs were injected into both the control and experimental groups. The paired crabs were placed in a circular tank with a water depth of 12 cm, with an opaque partition separating the crabs. After 10 minutes of acclimatization, the partition was removed, and the fighting behavior within 1 hour was filmed using a high-definition camera, including the number of times they approached each other, the number of times they came into contact with each other, and the number and duration of fights.

[0055] The fighting behavior of Chinese mitten crabs was observed 48 h after injection of the dsDA1B-3 interfering fragment. The results showed a significant increase in the number of approaching encounters and fights, but no significant difference in the number of direct contact encounters. The total duration of fighting increased, but not significantly. Figure 4 ).

[0056] All data are expressed as mean ± standard error (SE). Data analysis was performed using SPSS 29.0 software after homogeneity of variance testing. One-way ANOVA and Duncan's multiple range test were used for comparisons among multiple groups. The t-test was used for comparisons between two groups. p < 0.05 was considered statistically significant.

[0057] The above are merely preferred embodiments of the present invention and are not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. An RNA interference fragment targeting the DA1B receptor gene of the Chinese mitten crab, the nucleotide sequence of which is shown in SEQ ID NO:

1.

2. An RNA interference fragment targeting the DA1B receptor gene of the Chinese mitten crab, the nucleotide sequence of which is shown in SEQ ID NO:

2.

3. An RNA interference fragment targeting the DA1B receptor gene of the Chinese mitten crab, the nucleotide sequence of which is shown in SEQ ID NO:

3.

4. The use of the RNA interference fragment targeting the DA1B receptor gene of the Chinese mitten crab as described in any one of claims 1 to 3 in the preparation of a drug for regulating the fighting behavior of the Chinese mitten crab.

5. The application according to claim 4, characterized in that, The drug uses the RNA interference fragment targeting the DA1B receptor gene of the Chinese mitten crab as its active ingredient, and the drug dosage form is selected from at least one of the following formulations: tablets, capsules, granules, pills, powders, suspensions, or injections.

6. The application according to claim 5, characterized in that, The drug is an injectable formulation, and the RNA interference fragment is injected into the Chinese mitten crab to interfere with the mRNA expression level of the DA1B receptor gene in the Chinese mitten crab.

7. The application according to claim 6, characterized in that, The RNA interference fragment regulates the fighting behavior of Chinese mitten crabs by inhibiting or reducing the mRNA expression level of the DA1B receptor gene.

8. The application according to claim 4, characterized in that, The dosage of the RNA interference fragment is 0.1-10 μg / g of the body weight of the Chinese mitten crab.

9. The application according to claim 8, characterized in that, The dosage of the RNA interference fragment was 1 μg / g of the body weight of the Chinese mitten crab.

10. The application according to claim 4, characterized in that, The regulation of fighting behavior in Chinese mitten crabs was manifested by a reduction in the number of fights and a decrease in the duration of fights.

Images