The application relates to an HpLethal gene, dsRNA and a nano-carrier SPc / dsRNA complex in the prevention and treatment of Xylotrupes jucundus.

Abstract

The present application relates to the field of agricultural biotechnology, and particularly relates to a kind of HpLethal Gene, dsRNA and the application of nano-carrier SPc / dsRNA complex in preventing and treating Xylotrupes dichotomus (Hope).The present application delivers nano-carrier SPc / ds HpLethal RNA complex into the body of Xylotrupes dichotomus (Hope) by feeding method, can specifically silence the expression of Xylotrupes dichotomus (Hope) HpLethal Gene, plays the role of inhibiting the growth and development of Xylotrupes dichotomus (Hope) larvae, makes its development cycle extend or even completely stagnate, the body is significantly shorter than normal growth larvae, the mortality rate in early stage of larvae is significantly increased, achieves the purpose of biological control, has the advantages of specificity, high efficiency and environmental protection in preventing and treating pests, is a new type of green and pollution-free Xylotrupes dichotomus (Hope) prevention and control technology, and shows great application prospect in Xylotrupes dichotomus (Hope) prevention and control.

Description

Technical Field

[0001] This invention relates to the field of agricultural biotechnology, and in particular to a... HpLethal Application of genes, dsRNA, and the SPc / dsRNA nanocarrier complex in the control of teak moth. Background Technology

[0002] Teak camel moth Hyblaea puera Cramer, also known as teak skipper moth, teak skipper butterfly moth, and orange-banded skipper moth, belongs to the family Hyblaeidae in the order Lepidoptera and poses a serious threat to the ecological security of mangroves. Due to the unique function of mangrove ecosystems, serving as crucial habitats and stopover points for migratory birds, chemical control methods are unsuitable. Therefore, developing efficient and environmentally friendly new biological control technologies has become an urgent need to ensure the healthy development of mangroves.

[0003] RNA interference (RNAi) is a phenomenon in eukaryotes where double-stranded RNA (dsRNA) induces the specific degradation of homologous mRNA. dsRNA is widely present in organisms, and the RNAi process is highly conserved in eukaryotes. Currently, RNAi technology is applied to pest control, primarily by silencing the expression of key genes involved in vital life processes such as growth, development, metamorphosis, and reproduction, thereby hindering or even killing pests and achieving pest control. dsRNA is readily degraded in the environment; therefore, using dsRNA for pest control is a novel, non-toxic, and residue-free method with broad application prospects. Obtaining highly effective and safe lethal target genes is crucial for pest control using RNAi technology.

[0004] Furthermore, the low efficiency of RNAi in lepidopteran pests has become a key bottleneck restricting the large-scale application of this technology in pest control. Therefore, it is particularly necessary to develop an RNA interference control method for the teak moth. Summary of the Invention

[0005] The purpose of this invention is to provide a HpLethal The application of genes, dsRNA, and the SPc / dsRNA nanocarrier complex in the control of teak moth aims to address the problems existing in the above-mentioned technologies.

[0006] To achieve the above objectives, the present invention provides the following solution: This invention provides a eukaryotic translational lethal gene. HpLethal The eukaryotic translational lethal gene HpLethal The nucleotide sequence is shown in SEQ ID NO: 1.

[0007] This invention provides a method to suppress the aforementioned eukaryotic translational lethal genes. HpLethal The application of expression in the control of teak camel moth.

[0008] This invention provides a method to suppress the aforementioned eukaryotic translational lethal genes. HpLethal Application of its expression in increasing the mortality rate and / or inhibiting the development of the teak camel moth.

[0009] This invention provides a method for targeting the aforementioned eukaryotic translational lethal gene. HpLethal The dsRNA, the nucleotide sequence of which is shown in SEQ ID NO: 2.

[0010] The present invention provides a nanocarrier SPc / dsRNA complex, wherein the nanocarrier SPc / dsRNA complex comprises a nanocarrier SPc and the aforementioned dsRNA.

[0011] The present invention provides a method for preparing the above-mentioned nanocarrier SPc / dsRNA complex, including the step of mixing the nanocarrier SPc and dsRNA; The nucleotide sequence of the dsRNA is shown in SEQ ID NO: 2.

[0012] This invention provides the application of the above-mentioned dsRNA or the above-mentioned nanocarrier SPc / dsRNA complex in the preparation of formulations for controlling teak moth.

[0013] The present invention provides a formulation for controlling teak moth, the formulation comprising the above-mentioned dsRNA or the above-mentioned nanocarrier SPc / dsRNA complex.

[0014] This invention provides the application of the above-mentioned dsRNA, the above-mentioned nanocarrier SPc / dsRNA complex, or the above-mentioned formulation in the control of teak moth.

[0015] The present invention provides a method for controlling teak moth, comprising feeding teak moth with the above-mentioned dsRNA, the above-mentioned nanocarrier SPc / dsRNA complex, or the above-mentioned preparation.

[0016] The present invention discloses the following technical effects: The eukaryotic translational lethal gene of the teak moth provided by this invention HpLethal This is a newly discovered gene that seriously affects larval development. A specific embodiment of this invention uses the nanocarrier SPc to transport the teak moth... HpLethal The dsRNA of the gene, when delivered into the teak moth, can specifically silence the teak moth's... HpLethalThe gene expression inhibits the growth and development of teak moth larvae, prolonging their developmental cycle or even halting it completely. The larvae are significantly smaller than normally growing larvae, and the mortality rate in the early larval stages is significantly increased, achieving the goal of biological control. This method offers advantages such as specificity, high efficiency, and environmental friendliness, representing a novel, green, and pollution-free teak moth control technology with great application potential. This invention provides a new solution and approach for the green control of the teak moth. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 Feeding second-instar larvae of the teak camel moth with nanocarrier SPc / ds HpLethal Complex after 24, 48, and 72 h HpLethal The results of the silence efficiency test (A) and silence HpLethal The effect of genes on the mortality rate of teak moth larvae (B); the values ​​in the figure are mean ± standard error; different letters in the figure indicate significant differences between groups (Tukey, P<0.05).

[0019] Figure 2 for HpLethal Developmental status statistics of teak moth after gene silencing; where A is the control group and B is the treatment group. Detailed Implementation

[0020] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0021] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0022] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0023] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0024] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0025] Eukaryotic translation lethal genes HpLethal The nucleotide sequence is shown in SEQ ID NO: 1, specifically as follows: 5’- TTAATTTTAAAGGAAAATTTATTAAAGCTTAAAATCTAATATGTATTTGTAATAC AATAATCTTTTCAGTCTTTATCACATAAAAACAAGTAGGAAATTATAAATACACCAAGCACGAATAATCGGCACACATCTACTGCTGCTGGGGTCCGTTGGAGGCCTGGGAGGTCTGGTCCTTGATCTCCTTGCGCACAGGGCCGGTCTGCGAGATAGGGACTGATCGTTCGTTCTTCAATGCTGCAGCGACCCTAGGAGCGACCACGGTCAGCACACCATCAGATGATAACTTAGACTCGACTGTTTCAGGGTTGCAACCTTCGGGAAGGGCGTAGCGGCGGGTGAACTGCCTCGAGATGTATCCGTGCTCGTCTTTCTTCTCCTCGTGCTTGCCTTCGACGATGACGTACCCATCAGCGGTCTTCACACTGATTTCCTCTGGGGCGAAATGCTGCACATCCAGATTGACTTGGAACTTTTCCTTATCGGACTTGATAGTGGATCCGATGTCTCTCGCAGCAGCGGCCATCTGACGCCAGGGCCTGTAGTAGTCCCGGGACATCATCGGAGCCACGGCAGCGGTGAGCAAGTCGTCCGGAGTCAGCGCCAGACCGAAGTCCTGTTCCAACAGGCGATGGGGGTGTTCGTAGCCAACGATGAACGGTAGCAGAGACATCTTCCTTTTTCTTCTTAGCTTAATATTCGAGTTGTGAGATCGCAGTGCTCTCGCACCAATTGCTTTCGCTTGTATTGTTC - 3’。

[0026] The dsRNA targeting and silencing the gene HpLethal has the nucleotide sequence shown in SEQ ID NO: 2, specifically: 5’- TCGTTCGTTCTTCAATGCTGCAGCGACCCTAGGAGCGACCACGGTCAGCACACC ATCAGATGATAACTTAGACTCGACTGTTTCAGGGTTGCAACCTTCGGGAAGGGCGTAGCGGCGGGTGAACTGCCTCGAGATGTATCCGTGCTCGTCTTTCTTCTCCTCGTGCTTGCCTTCGACGATGACGTACCCATCAGCGGTCTTCACACTGATTTCCTCTGGGGCGAAATGCTGCACATCCAGATTGACTTGGAACTTTTCCTTATCGGACTTGATAGTGGATCCGATGTCTCTCGCAGCAGCGGCCATCTGACGCCAGGGCCTGTAGTAGTCCCGGGACATCATCGGAGCCACGGCAGCGGTGAGCAAGTCGTCCGGAGTCAGCGCCAGACCGAAGTCCTGTTCCAACAGGCGATGGGGGTGTTCGTAGCCAACGATGAACGGTAGCAGAGACATCTTCCTTTTTCTTCTTAGCTTAATATTCGAGTTGTGAGATCGCAG - 3’。

[0027] The nucleotide sequence of the dsRNA for targeted silencing of the gene EGFP is shown in SEQ ID NO: 8, specifically: 5’-TGACCACCCTGACCTACGGCGTGCAGCGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAA-3’。

[0028] The primers used in the present invention are shown in Table 1 Table 1 ds HpLethal and ds EGFP Specific primers Example 1 HpLethal Acquisition of genes and their dsRNAs 1. Test insect source: The laboratory population of teak camel moth was collected from mangrove forests in Zhanjiang City, Guangdong Province in April 2024 and subsequently reared in the laboratory (temperature 27±1℃, humidity 70-80%, photoperiod 16L:8D) and fed with feed.

[0029] 2. Teak camel moth HpLethal Obtaining gene sequences An antibiotic mixture was prepared by mixing 1 mg / ml ciprofloxacin, 1 mg / ml levofloxacin, and 2 mg / ml metronidazole with pure water. Metronidazole, ciprofloxacin, and levofloxacin were all purchased from Sangon Biotech Co., Ltd. 1 ml of the above antibiotic mixture was added to every 200 mL of artificial feed for the teak moth (this artificial feed is disclosed in Chinese application No. 202511458243.4, which describes the artificial feed for teak moths in that application). After thorough mixing, the mixture was fed to the teak moths. Observations of biological indicators revealed a significant increase in the mortality rate of the teak moths. Transcriptome sequencing was performed on surviving teak moths. Bioinformatics methods were used to search the teak moth transcriptome database. After sequence analysis and alignment, downregulated expression was obtained. HpLethal The gene sequence, whose nucleotide sequence is shown in SEQ ID NO: 1.

[0030] 3. Total RNA extraction and first-strand cDNA synthesis RNA was extracted from the larvae of the teak camel moth using a kit method (Beijing Meijimei Biotechnology Co., Ltd., Beijing, China). RNA integrity was detected by 1% agarose gel electrophoresis, and the concentration was determined using a NanoDrop OneC spectrophotometer (ThermoFisher Scientific, Waltham, MA, United States). The OD values ​​of RNA from all samples were measured. 260 / OD 230 Between 1.8 and 2.2.

[0031] Following the standard procedure of the FastKing cDNA First-Strand Synthesis Kit (Genomic De-generated) (KR116) (Tiangen Biotech Co., Ltd., Beijing, China), reverse transcription was performed on the RNA sample to obtain cDNA.

[0032] 4. In vitro synthesis of dsRNA (1) Primer design: Targets were designed using the SnapDragon-dsRNA Design website (SnapDragon-dsRNA Design).HpLethal Specific primers for the dsRNA sequence of the gene (nucleotide sequence as shown in SEQ ID NO: 1) are used, and a T7 promoter sequence as shown in SEQ ID NO: 3 is added to the 5' end of each of the upstream and downstream primers.

[0033] SEQ ID NO: 3: 5'-taatacgactcactataggg-3'.

[0034] Use the same method to target EGFP Gene-designed primers specific to the dsRNA sequence were used as negative controls. HpLethal and ds EGFP The specific primers are shown in Table 1.

[0035] (2) Kit synthesis Lethal Genes and EGFP dsRNA of genes Use ds in Table 1 HpLethal and ds EGFP The specific primers were used to amplify the cDNA synthesized by reverse transcription in step 3 by PCR, and the amplification products were used as templates for the synthesis of... HpLethal Genes and EGFP dsRNA of genes.

[0036] The PCR amplification system is shown in Table 2.

[0037] Table 2 PCR amplification system PCR reaction conditions: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 65℃ annealing for 15 s, 72℃ extension for 15 s, 35 cycles; 72℃ extension for 5 min. After the PCR reaction, the two PCR products were detected by 1% agarose gel electrophoresis and recovered using a SanPrep column-based DNA gel extraction kit (Sangon Biotech Co., Ltd., Shanghai, China) as the synthetic DNA product. HpLethal Genes and EGFP The dsRNA template of the gene.

[0038] dsRNA was synthesized according to the standard procedure of the TranscriptAid T7 High Yield Transcription Kit (Thermo Fisher Scientific, Waltham, MA United States).

[0039] The dsRNA synthesis system consisted of 4 μL of 5×TranscriptAid Reaction Buffer, 8 μL of NTP Mix, 1 μg of PCR-recovered product, and 2 μL of TranscriptAid Enzyme Mix, which was then brought to a final volume of 20 μL with RNase-Free Water.

[0040] After the above system is mixed, it is placed in a 37°C water bath for 8 hours.

[0041] After the above mixture has cooled naturally, immediately add 15 μL of 3M sodium acetate solution (pH 5.2) and 115 μL of Decc-Treated Water, and gently mix. Add an equal volume of phenol (pH=4.7) / chloroform for extraction, place in a pre-chilled centrifuge, and centrifuge at 10000 g, 4℃ for 5 min. After centrifugation, carefully remove the reaction system, aspirate the upper aqueous phase with a pipette tip, add an equal volume of chloroform for extraction twice, and collect the upper aqueous phase. Add 2 volumes of anhydrous ethanol, mix well to precipitate RNA, incubate at -20℃ for 30 min, centrifuge at 13000 g, 4℃ for 15 min, and discard the supernatant. Add 500 μL of ice-cold 70% ethanol, wash the precipitate thoroughly, and centrifuge at 13000 g, 4℃ for 10 min.

[0042] After centrifugation, discard all liquid, place the centrifuge tubes in a clean bench to dry at room temperature, add 36 µL of RNase-free H2O to the reaction system to dissolve completely; use 2% agarose gel electrophoresis to detect dsRNA quality and use NanoDropOneC spectrophotometer to determine dsRNA concentration, record the data, aliquot and label, and store in an ultra-low temperature freezer at -80℃.

[0043] Designed targeted silencing genes HpLethal dsRNA (ds HpLethal The sequence is as shown in SEQ ID NO: 2; however, due to the addition of a T7 promoter sequence at the 5' end of each of the specific upstream and downstream primers, the final ds HpLethal Based on the sequence shown in SEQ ID No: 2, it has a T7 promoter sequence at both the 5' and 3' ends. Specifically, the 5' end is the sequence shown in SEQ ID No: 4, which was added by the upstream primer, and the 3' end is the reverse complementary sequence of the sequence shown in SEQ ID No: 5, which was added by the downstream primer.

[0044] Silent genes EGFP dsRNA (ds EGFP The result is shown in SEQ ID NO: 8; however, due to the addition of a T7 promoter sequence at the 5' end of each of the specific upstream and downstream primers, the final dsEGFP Based on the sequence shown in SEQ ID No: 8, it has a T7 promoter sequence at both the 5' and 3' ends. Specifically, the 5' end is the sequence shown in SEQ ID NO: 6, which was added by the upstream primer, and the 3' end is the reverse complementary sequence of the sequence shown in SEQ ID No: 7, which was added by the downstream primer.

[0045] Example 2: Preparation of the SPc / dsRNA nanocarrier complex The nanocarrier SPc (the material and preparation method are disclosed in the literature "A Facile-Synthesized StarPolycation is Constructed as A Highly Efficient Gene Vector in PestManagement"; the nanocarrier SPc used in this invention was kindly provided by Professor Yan Shuo's team at China Agricultural University) and dsRNA (dsEGFP or dsHpLethal) were mixed at a mass ratio of 1:1 and reacted at 25°C for 15 min to obtain the nanocarrier SPc / ds EGFP Composites and nanocarriers SPc / ds HpLethal Complex.

[0046] The prepared nanocarrier SPc / ds EGFP Composites and nanocarriers SPc / ds HpLethal The complex was used in subsequent experiments.

[0047] Example 3 HpLethal Effects of gene dsRNA on the growth and development of the teak moth 1. Teak camel moth HpLethal Feeding of gene dsRNA In this embodiment, RNA interference was performed on early second instar larvae of the teak moth using a feeding method. Three biological replicates were performed, with 20 larvae per replicate. Each second instar larva was fed 0.5 μg of the nanocarrier SPc / ds. [[ID= Composites (denoted as treatment group) or nanocarriers SPc / ds ​ Complex (designated as the control group). Samples were taken for testing at 24, 48, and 72 hours after feeding.

[0048] 2. Teak camel moth ​ Gene silencing efficiency test Collect feeding nanocarrier SPc / ds ​ Composites and nanocarriers SPc / ds ​Second-instar larvae were observed at 24, 48, and 72 h post-conjugation. Total RNA was extracted from the larvae of the teak camel moth using a kit-based method (Beijing Meijimei Biotechnology Co., Ltd., Guangzhou, China). CDNA was synthesized using an in vitro reverse transcription kit, following the FastKing one-step method for genomic cDNA removal (Tiangen Biotech Co., Ltd., Beijing, China). Real-time PCR was used to detect the target gene. ​ and internal reference genes ​ (The primers used for Real-time PCR are shown in Table 1) The relative expression levels were determined using a 2... -△△Ct The silencing efficiency was calculated using the method (Ct represents the cycle number). One-way ANOVA was used to test the difference in silencing efficiency between the control and treatment groups after dsRNA feeding. Different letters in the figure indicate significant differences between groups (Tukey, P < 0.05). The results are shown below. ​ As shown in A. The results indicate that, compared with the control group, feeding the nanocarrier SPc / ds ​ Complex at 24, 48, and 72 h, treatment group ​ Gene expression was significantly reduced, with silencing efficiencies of 41.50%, 56.33%, and 69.68%, respectively.

[0049] 3. Feeding ds ​ Mortality statistics of teak moth larvae Compared with the normally developing larvae in the control group, ​ Teak camel moths exhibit abnormal development after gene silencing; feeding them with the nanocarrier SPc / ds ​ complex ( ​ In the B group, the mortality rates at 24, 48, and 72 hours were 18.55%, 54.28%, and 77.56%, respectively. (SPc / ds nanocarrier) ​ All larvae treated with the complex showed developmental arrest, even after being fed with the nanocarrier SPc / ds ​ A large number of patients died after 72 h following the administration of the complex. One-way ANOVA was used to examine the difference in survival rates between the control and treatment groups after feeding with dsRNA. Different letters in the figure indicate significant differences between the groups (Tukey, P<0.05).

[0050] 4. Feeding ds ​ Observation of the phenotype of the teak camel moth Compared with the control group with normal growth and development ( ​ (A) Feeding nanocarriers SPc / ds ​ Complex (silence) ​ Afterwards, the teak moth developed abnormally, and after ds ​ All larvae were rendered stunted and deformed, unable to pupate normally, and eventually died. ​ (B in the middle).

[0051] Based on the above experiments, it can be seen that the present invention provides the following as shown in SEQ ID NO: 1: ​ Genes can influence the growth and development of the teak moth, and can be silenced using the SPc nanocarrier delivery system. ​ The gene can efficiently kill the teak moth, ultimately achieving the control of the teak moth.

[0052] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A eukaryotic translation-lethal gene HpLethal Its characteristics are, The eukaryotic translational lethal gene HpLethal The nucleotide sequence is shown in SEQ ID NO:

1.

2. Suppressing the eukaryotic translational lethal gene as described in claim 1 HpLethal The application of expression in the control of teak camel moth.

3. Suppressing the eukaryotic translational lethal gene as described in claim 1 HpLethal Application of its expression in increasing the mortality rate and / or inhibiting the development of the teak camel moth.

4. A method for targeting the eukaryotic translational lethal gene of claim 1. HpLethal The dsRNA is characterized by, The nucleotide sequence of the dsRNA is shown in SEQ ID NO:

2.

5. A nanocarrier SPc / dsRNA complex, characterized in that, The nanocarrier SPc / dsRNA complex comprises the nanocarrier SPc and the dsRNA as described in claim 4.

6. The method for preparing the SPc / dsRNA nanocarrier complex according to claim 5, characterized in that, This includes the step of mixing the nanocarrier SPc and dsRNA; The nucleotide sequence of the dsRNA is shown in SEQ ID NO:

2.

7. The use of the dsRNA of claim 4 or the nanocarrier SPc / dsRNA complex of claim 5 in the preparation of formulations for controlling teak moth.

8. A formulation for controlling the teak moth, characterized in that, The formulation comprises the dsRNA of claim 4 or the nanocarrier SPc / dsRNA complex of claim 5.

9. The application of the dsRNA of claim 4, the nanocarrier SPc / dsRNA complex of claim 5, or the formulation of claim 8 in the control of teak moth.

10. A method for controlling the teak moth, characterized in that, The method includes feeding teak moths with the dsRNA of claim 4, the SPc / dsRNA nanocarrier complex of claim 5, or the formulation of claim 8.

Images