Application of pepper CaDof33 gene in regulating response to cold stress and method for improving cold stress tolerance of pepper

CN122609585APending Publication Date: 2026-08-21INST OF ECONOMIC CROP HUBEI ACADEMY OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610792604.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-06-03
Publication Date
2026-08-21

AI Technical Summary

Technical Problem

辣椒中一共鉴定出33个潜在的CaDof基因,但目前为止对于CaDof家族在冷胁迫下的功能鲜有研究

Benefits of technology

[0011] This invention discloses for the first time the application of the CaDof33 gene in regulating the cold tolerance of chili peppers by modulating the expression levels of response genes in the core cold stress regulatory pathway, ROS scavenging enzyme activity, and malondialdehyde (MDA) content. Transient transgenic results using chili pepper as the recipient confirmed that downregulation of CaDof33 gene expression led to decreased ROS scavenging enzyme activity, downregulation of the expression level of response genes in the core cold stress regulatory pathway, and a significant increase in MDA and superoxide anion content. Experimental results from this invention show that the CaDof33 gene in the chili pepper Dof gene family has a high expression level and is significantly induced by both MeJA and low temperature. Decreased expression of this gene resulted in a significant increase in MDA and superoxide anion content in plants compared to the control group; decreased ROS scavenging enzyme activity; and a decrease in the expression level of response genes in the core cold stress regulatory pathway. Furthermore, it was found that the protein encoded by the CaDof33 gene is located in the cytoplasm and nucleus and possesses transcriptional activation activity. Therefore, this invention proposes that adjusting the expression level of CaDof33 in chili peppers can be used to regulate plant resistance to cold stress.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122609585A_ABST
    Figure CN122609585A_ABST
Patent Text Reader

Abstract

The application discloses application of a pepper CaDof33 gene in regulation of a cold stress regulation response of the pepper and a method for improving cold stress tolerance of the pepper. A full-length nucleotide sequence of the pepper CaDof33 gene is shown as SEQ ID NO:1, and an encoded protein thereof is shown as SEQ ID NO:2. It is found through expression analysis that the gene is significantly induced by low temperature and MeJA (methyl jasmonate), and it is found that down-regulation of expression of the gene in the pepper by using a silencing vector of the gene leads to significant reduction of ROS scavenging enzyme activity and expression amount of a cold stress gene in the pepper leaves, significant increase of contents of malondialdehyde and superoxide anion, and weaker cold resistance. In addition, the protein encoded by the gene is located in the cytoplasm and the nucleus, and has transcription activation activity. Therefore, the application lays a theoretical support for research on a cold resistance molecular mechanism of the pepper, and provides a new gene resource for creation of excellent new germplasm of the pepper with cold resistance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to the application of the pepper CaDof33 gene in regulating the cold stress response of pepper and methods for improving the cold stress tolerance of pepper. Background Technology

[0002] Chili pepper (Capsicum annuum L.) is an important economic crop in my country. Chili peppers thrive in warm temperatures and are intolerant of cold. In practical production, chili peppers are mostly grown in central my country, where they are frequently subjected to cold damage. Every year, low temperatures cause a significant reduction in chili pepper yields, resulting in substantial agricultural economic losses. However, the genes responsible for cold tolerance in chili peppers remain to be explored. Dof (DNA-binding with one finger) transcription factors are plant-specific DNA-binding zinc finger proteins that are widely involved in the regulation of abiotic stress responses in plants and represent a potential genetic resource for enhancing plant cold tolerance through genetic breeding. A total of 33 potential CaDof genes have been identified in chili peppers, but the function of the CaDof family under cold stress has been poorly studied to date. Therefore, the application of chili pepper CaDof33 genes in regulating the cold stress response and methods to improve the cold stress tolerance of chili peppers are urgently needed. Summary of the Invention

[0003] To address the shortcomings of existing technologies, this invention provides the application of the chili pepper CaDof33 gene in regulating the cold stress response of chili peppers and a method for improving the cold stress tolerance of chili peppers.

[0004] To solve the above-mentioned technical problems, the present invention provides the following technical solution:

[0005] The first objective of this invention is to provide the application of the chili pepper CaDof33 gene in regulating the chili pepper's cold stress response, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0006] Preferably, the amino acid sequence of the chili CaDof33 gene is shown in SEQ ID NO.2.

[0007] A second objective of this invention is to provide the application of a gene having a specific nucleotide sequence for silencing the CaDof33 gene, as shown in SEQ ID NO.3, in regulating the cold stress response in peppers.

[0008] A third objective of this invention is to provide a method for improving the cold stress tolerance of chili peppers, the method comprising the step of overexpressing the chili pepper CaDof33 gene in chili peppers, wherein the nucleotide sequence of the chili pepper CaDof33 gene is shown in SEQ ID NO. 1.

[0009] Preferably, the method further includes constructing an overexpression vector of the pepper CaDof33 gene and introducing it into peppers.

[0010] Compared with the prior art, the present invention has the following beneficial effects:

[0011] This invention discloses for the first time the application of the CaDof33 gene in regulating the cold tolerance of chili peppers by modulating the expression levels of response genes in the core cold stress regulatory pathway, ROS scavenging enzyme activity, and malondialdehyde (MDA) content. Transient transgenic results using chili pepper as the recipient confirmed that downregulation of CaDof33 gene expression led to decreased ROS scavenging enzyme activity, downregulation of the expression level of response genes in the core cold stress regulatory pathway, and a significant increase in MDA and superoxide anion content. Experimental results from this invention show that the CaDof33 gene in the chili pepper Dof gene family has a high expression level and is significantly induced by both MeJA and low temperature. Decreased expression of this gene resulted in a significant increase in MDA and superoxide anion content in plants compared to the control group; decreased ROS scavenging enzyme activity; and a decrease in the expression level of response genes in the core cold stress regulatory pathway. Furthermore, it was found that the protein encoded by the CaDof33 gene is located in the cytoplasm and nucleus and possesses transcriptional activation activity. Therefore, this invention proposes that adjusting the expression level of CaDof33 in chili peppers can be used to regulate plant resistance to cold stress. Attached Figure Description

[0012] Figure 1 Figure showing the effect of MeJA treatment on the expression of CaDof gene family members.

[0013] Figure 2 A diagram illustrating the low-temperature expression patterns of CaDof gene family members.

[0014] Figure 3 GUS staining analysis of tobacco CaDof33 promoter activity map.

[0015] Figure 4 Phenotypic diagrams of pepper plants with CaDof33 silencing vector and control plants cultured under low temperature and normal conditions.

[0016] Figure 5 This is a schematic diagram illustrating the detection of gene expression levels in pepper leaves transformed with the CaDof33 silencing vector.

[0017] Figure 6 A is a schematic diagram showing the detection of MDA content in pepper leaves transformed with CaDof33 silencing vector.

[0018] Figure 6 B is a schematic diagram showing the detection of SOD content in pepper leaves transformed with the CaDof33 silencing vector.

[0019] Figure 6C is a schematic diagram showing the detection of POD content in pepper leaves transformed with the CaDof33 silencing vector.

[0020] Figure 6 D is a schematic diagram illustrating the detection of CAT content in chili pepper leaves transformed with the CaDof33 silencing vector.

[0021] Figure 7 A is a schematic diagram of NBT staining results in pepper leaves transformed with the CaDof33 silencing vector.

[0022] Figure 7 B is a schematic diagram of the DAB staining results in pepper leaves transformed with the CaDof33 silencing vector.

[0023] Figure 8 A is a schematic diagram showing the expression level of the cold response-related gene CaCBF1a in pepper leaves transformed with the CaDof33 silencing vector.

[0024] Figure 8 B is a schematic diagram showing the expression level of the cold response-related gene CaCBF1b in pepper leaves transformed with the CaDof33 silencing vector.

[0025] Figure 8 C is a schematic diagram showing the expression level of the cold response-related gene CaERD15 in pepper leaves transformed with the CaDof33 silencing vector.

[0026] Figure 8 D is a schematic diagram showing the expression level of the cold response-related gene CaCAT in pepper leaves transformed with the CaDof33 silencing vector.

[0027] Figure 8 E is a schematic diagram illustrating the detection of the expression level of the cold response-related gene CaPOD in pepper leaves transformed with the CaDof33 silencing vector.

[0028] Figure 8 F is a schematic diagram illustrating the detection of the expression level of the cold response-related gene CaSOD in pepper leaves transformed with the CaDof33 silencing vector.

[0029] Figure 9 This is a subcellular localization analysis diagram of CaDof33.

[0030] Figure 10 This is a graph showing the transcriptional activation activity analysis of CaDof33. Detailed Implementation

[0031] The preferred embodiments of the present invention will be described below with reference to the accompanying drawings. It should be understood that the preferred embodiments described herein are for illustration and explanation only and are not intended to limit the present invention.

[0032] Example 1: Heatmap analysis of the expression of CaDof gene members in chili peppers under low temperature and MeJA treatment.

[0033] Using published transcriptome data (RNA-seq), the expression levels of pepper Dof gene family members in leaves and roots under low-temperature treatment were downloaded from the PepperHub website. After normalizing the collected data using log2, heatmaps were generated using MeV software. Figure 1 As shown, among the 33 members of the CaDof gene family, the expression level of CaDof33 in leaves significantly increased after 3 h of MeJA treatment, and surged at the following 3 h and 6 h, significantly higher than other members of the Dof family. This indicates that the expression of CaDof33 is significantly induced by MeJA. Figure 2 As shown, the expression level of CaDof33 in leaves significantly increased after 3 h of treatment at 4℃, and then surged at 6 h and 12 h, significantly higher than that of other members of the Dof family. This indicates that the expression of CaDof33 is significantly induced by cold stress.

[0034] Example 2: Cloning of the full-length CaDof33 gene in chili pepper.

[0035] Using an online gene analysis website, the CaDof33 sequence was searched. Analysis within the full 933 bp length revealed the corresponding specific region, from which a 300 bp segment was selected for vector construction. The CaDof33 forward primer F1 was 5'-CTAGATGAGGAGAAGAGCCCGGAGGCTAAGGCCAAACAATCATC-3' (sequence shown in SEQ ID NO. 15), and the reverse primer R1 was 5'-TGTGCTCGACGACAAGACCCCTCTGCAACTTCAGCAACAGCGTTG-3' (sequence shown in SEQ ID NO. 16). The final result was a nucleotide sequence containing the nucleotide sequence shown in SEQ ID NO: 3.

[0036] In the above scheme, in order to achieve the connection with the vector, the 5' end of the forward and reverse primers contains the Sma I restriction site (5'-CCCGGG-3') and the corresponding protective bases.

[0037] Example 3: Construction of recombinant vector.

[0038] The PCR product of the specific fragment of the cloned pepper CaDof33 gene was recovered and double-digested with the gene-silencing VIGS vector. The reaction volume was: Sma I: 2 μL, 10*cut smart buffer: 5 μL, DNA: 25 μL, sterile water: 18 μL; total 50 μL. The reaction was carried out at 37 ℃ for 2 h. The digested plasmid and PCR product were purified and recovered separately using the kit according to the manufacturer's instructions. The concentration of the recovered products was determined using 1% agarose gel electrophoresis.

[0039] The specific steps for recombination and transformation of the target gene and expression plasmid vector are as follows:

[0040] Prepare the recombinant reaction system (10 μL): 10×T4 DNA ligase buffer: 1 μL; T4 DNA ligase: 1 μL; DNA fragment (the molar number of the DNA fragment should be controlled at 3-10 times that of the vector DNA); ddH2O to 10 μL. Incubate at 16 ℃ for 12 h.

[0041] All the ligation products were added to 100 μL of DH5α competent cells and incubated on ice for 25 min; after heat shock at 42 ℃ for 45 s, the cells were incubated in an ice-water bath for 3 min. Then, 400 μL of LB liquid medium was added, and the cells were incubated at 37 ℃ with shaking at 150 rpm for 60 min; subsequently, the cells were incubated in a solution containing kanamycin (K... + Incubate overnight on LB solid medium (50 mg / L). Pick a single colony and place it on a streak plate of LB solid medium (K). + Incubate at 50 mg / L for about 12 h, and simultaneously detect positive clones by PCR.

[0042] Example 4: Recombinant quality transformation of Agrobacterium GV3101.

[0043] Plasmid extraction was performed using a plasmid extraction kit, following the instructions. The accuracy of the target sequence in the recombinant vector was further confirmed by first-generation sequencing. The recombinant plasmid was then transformed into Agrobacterium GV3101 cells using the following steps: 1 μg of purified plasmid was added to 100 μL of competent Agrobacterium GV3101 cells and gently vortexed to mix. The cells were placed on ice for 5 min, then immediately immersed in liquid nitrogen for 5 min; incubated at 37 ℃ for 5 min; 350 μL of LB medium was added, and the cells were incubated at 28 ℃ with shaking at 200 rpm / min for 1 h. After centrifugation to remove most of the supernatant, the precipitate was gently mixed by pipetting. 100 μL of the bacterial culture was plated onto LB agar plates containing 50 mg / L kanamycin and 12.5 mg / L rifampin and incubated at 28 ℃ for 48 h. Once resistant colonies are visible, select a single colony and inoculate it into 2 mL of LB medium (containing kanamycin and rifampin), and incubate overnight at 28 °C with shaking; finally, perform PCR to identify positive colonies.

[0044] Example 5: GUS staining analysis of tobacco.

[0045] Sow the seeds of Nicotiana benthamiana on the surface of moistened nutrient soil, cover with a black opaque film and keep moist until the seeds germinate. After removing the black film, place the tobacco seedlings in a greenhouse (25℃, 14 h light / 10 h dark) for cultivation. After the tobacco has grown for 3 weeks. Select positive single clones that have been correctly identified by PCR and incubate them overnight in a small black bottle with shaking. Take 2 mL of bacterial culture and centrifuge at 3000 rpm for 10 min at room temperature to collect the bacterial cells. Remove the supernatant, resuspend the bacterial cells in 10 mM MgCl2, centrifuge at 3000 rpm for 5 min to collect the bacterial cells. Remove the supernatant, add 2 mL of 10 mM MgCl2 to resuspend the bacterial cells and wash once, centrifuge again at 3000 rpm for 5 min to remove as much bacterial culture as possible. Adjust the OD600 of the bacterial culture to 0.4 with 10 mM MgCl2 (for co-transformation of two strains, adjust the OD to 0.8 separately before mixing in equal volumes and then injecting). Add acetylsyleugenol (AS) to a final concentration of 200 μM, gently shake to mix, and let stand at room temperature for 2 h. Remove the tobacco plants (approximately 3-4 weeks old) to be injected from the culture room and incubate under white light for 1 hour. h, to fully open the stomata of the leaves, suitable for transformation; select newly extended, healthy, mature leaves below the stem tip, and slowly push the settled bacterial solution into the leaf from the lower epidermis using a syringe without the needle. Return the transformed plants to the culture room and water them thoroughly with nutrient solution. After culturing the transformed tobacco for 40-48 h, treat the infected tobacco at 4℃, and collect leaf samples at 0 h, 1 h, 3 h, 6 h, 12 h, and 24 h. Immerse the samples in GUS staining working solution (using the GUS staining kit from Coollab, product number: SL7160; refer to the instruction manual for specific methods) for staining. After staining, incubate with 75% alcohol at 65℃ until the chlorophyll is completely removed, then photograph. Results are as follows. Figure 3 As shown, under 4℃ treatment, the CaDof33 promoter in tobacco leaves was highly expressed at 1 h, and continued to be expressed until 3 h before showing a downward trend, and remained expressed thereafter. These results indicate that when peppers are exposed to low temperatures, CaDof33 can be rapidly induced by cold stress, and its expression level increases rapidly.

[0046] Example 6: Agrobacterium-mediated transient genetic transformation of pepper leaves.

[0047] Select positive Agrobacterium single clones (TRV2:00, CaDof33-TRV2:00) into a solution containing kanamycin (K + 50 mg / L) and rifampin + In liquid LB medium (50 mg / mL), the culture was incubated on a shaker at 28°C with a rotation speed of 220 rpm / min until saturation.

[0048] The saturated bacterial culture was added to 50 ml of liquid LB medium containing 50 mg / mL Kana, 50 mg / mL Rif, 10 µM pH 5.6 morpholine ethanesulfonic acid (MES), and 40 µM acetosyringone (AS) at a ratio of 1:40, and cultured on a constant temperature shaker at 28 °C for 16 h at a speed of 220 rpm / min.

[0049] Agrobacterium was collected at 5000 rpm / min. The supernatant was discarded, and the Agrobacterium was resuspended in ddH2O containing 200 mM magnesium chloride (MgCl2) and 150 µM AS (i.e., 1 mL of prepared resuspension solution + 50 mL of water). The bacterial suspension was adjusted to a suitable concentration (OD). 600 =0.3), then wrap it with aluminum foil and let it stand at room temperature for 2-3 hours before injection for infection.

[0050] The pepper seedlings were injected at the "two-leaf-one-heart" stage. During injection, the bacterial solution was injected into the leaf using a 1 mL syringe on the underside of the cotyledon or true leaf. After inoculating the pepper seedlings with Agrobacterium, they were cultured under optimal conditions until they reached the "eight-leaf-one-heart" stage. Half of the silent plants and the control plants were then subjected to low-temperature treatment, placed in a biochemical incubator, and chilled at 4°C for 48 h. Phenotypic changes in the control and silent plants were then observed.

[0051] like Figure 5 As shown, under normal culture conditions, the growth of pepper seedlings infected with Agrobacterium tumefaciens with empty vector and those infected with Agrobacterium tumefaciens carrying the CaDof33-TRV2 plasmid were almost identical. However, under low temperature treatment, the plants infected with Agrobacterium tumefaciens containing empty vector only showed slight leaf drooping. In contrast, the pepper seedlings infected with Agrobacterium tumefaciens carrying the CaDof33-TRV2 plasmid showed obvious severe wilting of leaves, with the leaves completely drooping, curling, and dehydrating.

[0052] Example 7: Real-time quantitative PCR detection of transformed gene expression.

[0053] RNA was extracted from leaves of individual chili pepper plants and subjected to reverse transcription and real-time quantitative PCR to detect the expression of the gene. The chili pepper gene CaUbi3 was used as an internal reference gene. The primer sequences are as follows: CaUbi3-F: CCCTGGAATTGCTGACCGTA (sequence shown in SEQ ID NO.4), CaUbi3-R: TGGAAAGTGCTGAGGGATGC (sequence shown in SEQ ID NO.5). RNA extraction from chili pepper leaves, reverse transcription of cDNA first strand, and real-time quantitative PCR were all performed according to the kit instructions. The results are as follows: Figure 8As shown, the expression level of CaDof33 in the leaves of these VIGS-silenced peppers was higher than that in the control group.

[0054] Example 8: Determination of SOD, POD, MDA and CAT content in chili pepper leaves.

[0055] After the sample was ground into powder using liquid nitrogen, approximately 0.1 g of the sample was weighed. The contents of SOD, POD, MDA, and CAT were determined using the kit according to the instructions. Figure 6 As shown, under low-temperature treatment, the MDA content of silent plants was significantly increased and higher than that of the negative control; at the same time, the SOD and POD enzyme activities of silent plants were significantly lower than those of the negative control. DAB and NBT staining of leaves revealed that both NBT and DAB staining results indicated higher levels of superoxide anion and hydrogen peroxide in the leaves of silent plants. Figure 7 This indicates that low temperature causes a greater degree of cell damage.

[0056] Example 9: Determination of expression levels of genes related to cold stress regulation in chili pepper leaves.

[0057] RNA was extracted from leaves of individual chili pepper plants and subjected to reverse transcription and real-time quantitative PCR to detect the expression of cold-response-related genes such as CaCBF1a and CaCBF1b. The chili pepper gene CaUbi3 was used as an internal reference gene. The primer sequences are as follows:

[0058] CaUbi3-F (sequence shown in SEQ ID NO.4): CCCTGGAATTGCTGACCGTA,

[0059] CaUbi3-R (sequence as shown in SEQ ID NO.5): TGGAAAGTGCTGAGGGATGC.

[0060] Forward primer for the CaDof33 gene (sequence shown in SEQ ID NO.6): 5'-CCACCATACCTTCGATGATCAGCC-3',

[0061] Reverse primer (sequence shown in SEQ ID NO.7): 5'-CATCTTCAGATCACCGGACGGC-3'.

[0062] The forward primer for the CaCBF1a gene (sequence shown in SEQ ID NO.8): 5'-AATCTGCTGACAGTAGTTCTCC-3',

[0063] Reverse primer (sequence shown in SEQ ID NO.9): 5'-TCAACTTCCACATGATCTCCAA-3'.

[0064] The forward primer for the CaCBF1b gene (sequence shown in SEQ ID NO.10): 5'-GGCTATAGCATTAAGAGGTCGT-3',

[0065] Reverse primer (sequence shown in SEQ ID NO.11): 5'-ATCTTTAGTGTCAGAGGAAGCC-3'.

[0066] Forward primer for the CaPOD gene (sequence shown in SEQ ID NO.12): 5'-TCCTCCTCCTACTTCTAACC-3',

[0067] Reverse primer (sequence shown in SEQ ID NO.13): 5'-CATCTTCAGATCACCGGACGGC-3'.

[0068] Forward primer for the CaSOD gene (sequence shown in SEQ ID NO.14): 5'-TATGGAGCCTTAGAACCTGC-3',

[0069] Reverse primer (sequence shown in SEQ ID NO.15): 5'-CCATTGAACTTGATAGCACCT-3'.

[0070] The forward primer for the CaERD15 gene (sequence shown in SEQ ID NO.16): 5'-TATGGAGCCTTAGAACCTGC-3',

[0071] Reverse primer (sequence shown in SEQ ID NO.17): 5'-CCATTGAACTTGATAGCACCT-3'.

[0072] The results are shown in Figure 8. Silencing CaDof33 inhibited the expression of key genes involved in low-temperature response and ROS clearance.

[0073] Example 10: Subcellular localization analysis of CaDof33.

[0074] The gene was constructed into the pEGAD-GFP expression vector via enzyme digestion and ligation, and the subcellular localization of the CaDof33-GFP fusion protein was observed using an Agrobacterium GV3101-mediated transient tobacco transformation system. The coding region DNA sequence of CaDof33 was amplified by RT-PCR. The cDNA of CaDof33 was ligated between the Sma I and BamH I sites of the pEGAD vector, which is initiated by the 35S promoter, using enzyme digestion and ligation. In pEGAD, the multiple cloning sites are all located at the C-terminus of the gene encoding green fluorescent protein. For subcellular localization analysis, CaDof33 was transformed into Agrobacterium GV3101 competent cells using a freeze-thaw method. Agrobacterium strain GV3101 carrying the CaDof33 gene was cultured with shaking for 48 h, centrifuged at 5000 r / min for 8 min to collect the bacteria, removed the supernatant, and resuspended the cells in an invasion staining solution (10 mmol / L MgCl2, 150 μmol / L acetylsyringone AS). The bacterial concentration was adjusted to OD600 = 0.3-0.4. After incubating the prepared bacterial solution in the dark for 2 h, 6-8 leaf-stage Nicotiana benthamiana were selected from the culture room and injected into the entire leaf. The injected tobacco was bagged and cultured in the dark. After 3 days, the epidermis on the underside of the leaf was peeled off with forceps and placed on a glass slide to prepare a temporary section. The temporary section was placed upside down on the stage of a laser confocal microscope (Leica, Germany) to detect the fluorescence signal of green fluorescent protein (GFP). Figure 9 As shown, green fluorescence was observed in both the cell membrane and nucleus of tobacco cells expressing GFP exclusively. Figure 9 Specific green fluorescence was observed in tobacco cells expressing CaDof33-GFP fusion protein on both the cell nucleus and cell membrane. These results indicate that the CaDof33-GFP fusion protein is located on the cell nucleus and cell membrane, suggesting that CaDof33 plays a transcriptional regulatory role in the cell nucleus.

[0075] Example 11: Verification of the transcriptional activation activity of CaDof33 protein.

[0076] To verify whether CaDof33 is a transcription factor with transcriptional regulatory functions, its transcriptional activation activity was tested in a yeast system. First, the full-length open reading frame (amino acids 1-311), N-terminal (amino acids 1-88), and C-terminal (amino acids 89-311) DNA fragments of the CaDof33 transcription factor were ligated into the pGBKT7 vector using enzyme digestion and ligation. This fused the full-length, N-terminal, or C-terminal sequence of the target gene protein with the GAL4 DNA-binding domain of the pGBKT7 vector, respectively. The cells were then transformed into *E. coli* DH5α by heat shock and subsequently expressed using a monoclonal antibody (K... +Single colonies were selected from LB agar plates and verified by RT-PCR. Positive plasmids BD-CaDof33ΔC, BD-CaDof33ΔN, and BD-CaDof33 were obtained after sequencing. Using blank pGBKT7 as a negative control, these pGBKT7 vectors fused with different fragments were transformed into Y2H strain yeast. Positive single colonies were first obtained by culturing on SD / -Trp agar plates. Single colonies were then selected, and the yeast culture was serially diluted and transferred to yeast SD medium (SD / -Trp, His, Ade) lacking tryptophan, histidine, and adenine. The culture was incubated at 30°C for 3 days, and transcriptional activation assays were performed based on yeast growth. Figure 10 As shown, the results indicate that the C-terminus of the CaDof33 protein has significant transcriptional activation activity, and can bind to specific DNA sequences in the promoter and activate gene transcription responses.

[0077] Finally, it should be noted that the above descriptions are merely preferred embodiments of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. The application of the pepper CaDof33 gene in regulating the pepper's cold stress response, characterized in that, The nucleotide sequence of the chili CaDof33 gene is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The amino acid sequence of the chili CaDof33 gene is shown in SEQ ID NO.

2.

3. Application of genes with specific nucleotide sequences for silencing the CaDof33 gene as shown in SEQ ID NO.3 in regulating the cold stress response of pepper.

4. A method for improving the cold stress tolerance of chili peppers, characterized in that, The method includes the step of overexpressing the chili pepper CaDof33 gene in chili peppers, wherein the nucleotide sequence of the chili pepper CaDof33 gene is shown in SEQ ID NO.

1.

5. The method according to claim 4, characterized in that, The method also includes constructing an overexpression vector for the CaDof33 gene in chili peppers and introducing it into chili peppers.