Detoxification gene of yunnan ips grandicollis and dsrna and application thereof

Abstract

The application discloses detoxification metabolism genes of Tomicus yunnanensis, dsRNA and application thereof, and belongs to the technical field of genetic engineering and biological control. TyCYP450_5 and TyJehe Two dsRNAs are developed, which can be used for efficiently silencing the detoxification metabolism genes of S-alpha-pinene of Tomicus yunnanensis. The two dsRNAs prepared by the application can significantly increase the sensitivity of Tomicus yunnanensis to S-alpha-pinene and improve the mortality of Tomicus yunnanensis under the action of S-alpha-pinene when the two dsRNAs are injected into Tomicus yunnanensis. The application provides a new idea and target for green control of dry wood-boring pests and provides a theoretical basis for developing a new biological control technology and reducing the use of chemical pesticides.

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and biological control technology, and in particular to the detoxification and metabolic genes of the Yunnan shoot beetle, its dsRNA, and their applications. Background Technology

[0002] Secondary metabolites of conifers are an effective defense against herbivorous insects. Through long-term co-evolution between trees and herbivorous insects, such as bark beetles, various adaptive strategies have been developed to cope with host defense. (The Yunnan bark beetle...) Tomicus yunnanensis (This is a major quarantine borer in the forest areas of Southwest China, listed as a key controlled forest pest by the National Forestry and Grassland Administration. It mainly damages Yunnan pine.) Pinus yunnanensis Since the 1980s, this insect has caused persistent outbreaks, leading to the large-scale death of Yunnan pines and severely disrupting the balance of forest ecosystems in the southwestern mountainous regions. Current control measures for the Yunnan shoot beetle mainly include silvicultural measures (such as thinning, clearing infested trees, and adjusting forest stand structure), pheromone trapping (using aggregation pheromones or host volatiles to trap and kill adult insects), chemical control (spraying highly effective and low-toxicity insecticides or injecting pesticides into tree trunks), and biological control (protecting natural enemy insects and pathogenic microorganisms). These methods have suppressed insect population density to some extent, but due to limitations such as complex terrain, insufficient monitoring coverage, long natural enemy activity cycles, and environmental residues from chemical agents, sustained and effective control remains difficult to achieve. There is an urgent need to develop new green control strategies.

[0003] The invasion process of the Yunnan pine beetle is divided into two stages: the shoot-boring stage and the trunk-boring stage. The trunk-boring stage is a crucial stage for its colonization and population expansion, during which the beetle must detoxify the monoterpenoid defensive volatile substances released by the host tree in order to survive. The volatile substances of Yunnan pine are mainly monoterpenoid compounds (accounting for 99.98% of the total content), among which α-pinene is the most abundant (close to 80%). The fact that the Yunnan pine beetle can break through the host's defense indicates that it must have evolved a mechanism for efficiently detoxifying or utilizing these defensive substances.

[0004] Cytochrome P450 is the largest metabolic enzyme superfamily in insects, participating in the synthesis and degradation of endogenous substances (such as juvenile hormones and ecdysones) and the oxidative metabolism of exogenous substances (such as plant secondary metabolites and pesticides). It is a key enzyme system for insects to adapt to host plant chemical defenses and develop pesticide resistance. Juvenile hormones are an important class of sesquiterpenoid hormones in insects, regulating not only growth, development, metamorphosis, and reproduction, but also participating in the regulation of detoxification enzyme activity and pheromone synthesis, playing a central role in insects' response to environmental stress and coordination of physiological activities. However, the functions of cytochrome P450 and key genes in the juvenile hormone pathway in *Bark Beetle yunnanensis* in S-α-pinene detoxification and pheromone synthesis remain a research gap.

[0005] RNA interference (RNAi) is a molecular technique that uses double-stranded RNA to induce the specific degradation of target gene mRNA, thereby silencing gene function. It boasts advantages such as high targeting specificity, environmental friendliness, and no alteration of the genome sequence, and has been widely applied in insect functional genomics research and pest control. However, there are few reports on the use of RNAi to control the Yunnan leaf beetle. Therefore, given the environmental risks, unstable efficacy, and susceptibility to pesticide resistance associated with existing chemical control methods, there is an urgent need for novel, targeted, precise, green, and efficient control technologies and target genes. Summary of the Invention

[0006] The purpose of this invention is to provide the detoxification and metabolic gene of *Spodoptera exigua*, its dsRNA, and its applications, in order to solve the problems existing in the prior art. This invention is based on the detoxification and metabolic gene of *Spodoptera exigua*. TyCYP450_5 and TyJehe Two dsRNAs were developed for the efficient silencing of genes involved in the detoxification metabolism of S-α-pinene in the Yunnan twig borer. Injection of the two dsRNAs prepared in this invention into the Yunnan twig borer significantly increased its sensitivity to S-α-pinene and improved its lethality under S-α-pinene treatment.

[0007] To achieve the above objectives, the present invention provides the following solution: This invention provides a detoxification metabolic gene for the Yunnan shoot beetle. TyCPY450_5 The TyCPY450_5 The nucleotide sequence is shown in SEQ ID NO.1 or SEQ ID NO.2.

[0008] This invention also provides a detoxification metabolic gene for the Yunnan shoot beetle. TyJehe The TyJehe The nucleotide sequence is shown in SEQ ID NO.3 or SEQ ID NO.4.

[0009] The present invention also provides a dsTyCPY450_5 for controlling the Yunnan shoot beetle, wherein the dsTyCPY450_5 is synthesized from the sequence shown in SEQ ID NO.1 and the reverse complementary sequence shown in SEQ ID NO.2.

[0010] The present invention also provides a dsTyJehe for controlling the Yunnan shoot beetle, wherein the dsTyJehe is synthesized from the sequence shown in SEQ ID NO.3 and the reverse complementary sequence shown in SEQ ID NO.4.

[0011] The present invention also provides the application of the above-mentioned dsTyCPY450_5 or the above-mentioned dsTyJehe in the preparation of products that silence the detoxification metabolic gene of Yunnan twig borer.

[0012] The present invention also provides the application of the above-mentioned dsTyCPY450_5 or the above-mentioned dsTyJehe in the preparation of products for controlling Yunnan shoot beetle.

[0013] The present invention also provides the above. TyCPY450_5 The above TyJehe The application of the above-mentioned dsTyCPY450_5 or dsTyJehe in constructing transgenic plants for controlling Yunnan shoot beetle or in cultivating plants resistant to Yunnan shoot beetle.

[0014] The present invention also provides the application of the above-mentioned dsTyCPY450_5 and / or the above-mentioned dsTyJehe in the preparation of products for controlling Yunnan shoot beetle in combination with pinene.

[0015] The present invention also provides the application of the above-mentioned dsTyCPY450_5 and / or the above-mentioned dsTyJehe in the combined use of pinene to control Yunnan shoot beetle.

[0016] The present invention also provides a method for controlling the Yunnan shoot beetle, comprising the steps of injecting the above-mentioned dsTyCPY450_5 and / or the above-mentioned dsTyJehe into the Yunnan shoot beetle, and then treating the Yunnan shoot beetle with pinene.

[0017] Optionally, the pinene includes S-α-pinene.

[0018] Optionally, the injection dose is 2 μg / head.

[0019] The present invention discloses the following technical effects: This invention has discovered that the Yunnan tip beetle contains... TyCYP450_5 Genes and TyJehe The genes involved are those related to the detoxification metabolism of S-α-pinene in the Yunnan twig borer. Based on these two genes, this invention designed and developed two dsRNAs—dsTyCPY450_5 and dsTyJehe—that can efficiently silence the S-α-pinene detoxification metabolism genes in the Yunnan twig borer. Injecting the Yunnan twig borer with the two dsRNAs prepared in this invention significantly increased the sensitivity of the Yunnan twig borer to S-α-pinene and improved the lethality of the Yunnan twig borer under the action of S-α-pinene. In addition, the combined use of the two dsRNAs was more effective than the use of either dsRNA alone, indicating that the two dsRNAs have a synergistic effect and can greatly enhance the control effect on the Yunnan twig borer.

[0020] This invention provides a novel approach and target for the green control of stem borers, and offers a theoretical basis for developing new biological control technologies to reduce the use of chemical pesticides. Attached Figure Description

[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0022] Figure 1 Image of dsRNA gel electrophoresis; Figure 2 To determine the adult Yunnan shoot beetle 24 hours after injection of dsRNA under S-α-pinene stress. TyCYP450_5 (A) and TyJehe (B) Expression status (gene expression level × 100); NS indicates no significant difference from the control group; Indicates in p The difference was significant at the <0.001 level; Indicates in p The difference was significant at the <0.0001 level; Figure 3 Injection under S-α-pinene stress TyCYP450_5 and TyJehe Evaluation of the lethality of adult Yunnan shoot beetles 24 h and 48 h after dsRNA administration; Note: Indicates in p The difference was significant at the <0.01 level; Indicates in p The difference was significant at the <0.001 level. Detailed Implementation

[0023] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0024] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0025] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0026] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0027] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0028] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the instruments and equipment used in the following examples are all conventional laboratory instruments and equipment; unless otherwise specified, the experimental materials used in the following examples were all purchased from conventional biochemical reagent stores.

[0029] The technical concept of this invention is as follows: The inventors previously conducted transcriptome analysis on the Yunnan branch beetle under S-α-pinene stress and found that... CYP450 Family genes and JHEH The gene was significantly upregulated, and this was further verified by qPCR technology. TyCYP450_5 Genes and TyJehe The gene expression pattern under S-α-pinene stress was consistent with transcriptome analysis. This result indicates that... TyCYP450_5 Genes and TyJehe The gene was selected from those related to detoxification and metabolism in the Yunnan bark beetle. TyCYP450_5 and TyJehe Further research will be conducted on the core target genes.

[0030] This invention clones the detoxification and metabolic gene of the Yunnan shoot beetle. TyCYP450_5 and TyJeheThe nucleotide sequences of the TyCYP450_5 gene are shown in SEQ ID NO.1 (its reverse complementary sequence is shown in SEQ ID NO.2) and SEQ ID NO.3 (its reverse complementary sequence is shown in SEQ ID NO.4), respectively. Based on the above two genes, the present invention designed and developed their dsRNAs. The dsRNA of the TyCYP450_5 gene was synthesized from the nucleotide sequence shown in SEQ ID NO.1 and the reverse complementary sequence shown in SEQ ID NO.2; the dsRNA of the TyJehe gene was synthesized from the nucleotide sequence shown in SEQ ID NO.3 and the reverse complementary sequence shown in SEQ ID NO.4. In some embodiments of the present invention, the dsRNA is preferably synthesized using a dsRNA synthesis kit, preferably including the T7 RNA Transcription Kit Plus (Zhisheng Yougu, SJ001V2). The present invention does not have a special limitation on the source of the kit, and commercially available products well known to those skilled in the art can be used.

[0031] SEQ ID NO.1: GTCGTTTAGACCTATTCTCTCGAGTGAAATTTTCAGGATTAAATCGCTCTGGATCGGGATAGTATTCTGGATCTAAATGAACTCCAATTACGGGAATATAAAGTTTGGTTTCCTTTTTCAATCACTATATCGGTATTTTTGATCTTGTAATCTTTTGTGCATTGTCTAGGTATAATTGGTACTACTGGAAATTTACGTAAGGTTTCTCTCACTACTTTGTCAAGGT.

[0032] SEQ ID NO.2: ACCTTGACAAAGTAGTGAGAGAAACCTTACGTAAATTTCCAGTAGTACCAATTATACCTAGACAATGCACAAAAGATTACAAGATCAAAAATACCGATATAGTGATTGAAAAAGGAACCAAACTTTATATTCCCGTAATTGGAGTTCATTTAGATCCAGAATACTATCCCGATCCAGAGCGATTTAATCCTGAAAATTTCACTCGAGAGAATAGGTCTAAACGAC.

[0033] SEQ ID NO.3: TCTCAGAAGCGACCAGTAAACCAGGCTTAGGCCCAGAACGAATAGCACAAATCTTAAAAAATCTGATGAAAAGACTGGGATACGATCAGTTCTACATCCAGGGAGGAGATTGGGGATCGGTCGTCAACTCACACATGTCCGTATTATATCCTGAAAATGTATTGGGGCTTCATTTGAATATGTGTGCTTGCATATCAAAATTGTGCAATCTGAAAGCATGGTTGATAGGCGCCACTTTTCCCTCTTTGCTTGCCACTGAAGAAGAATTGCCTTTGTTTGCTCCAGTGCCCTCAAAAATGGCAGAAGTTGTACTTTTAGAAATGGGATACGCCCATATTCAGTCAACTAAACCGGATACAGTCGGTGTGGCTTTAAGAGACAGTCCAGTTGGTCTTGCTGCTTACATTCTGGA。

[0034] SEQ ID NO.4: TCCAGAATGTAAGCAGCAAGACCAACTGGACTGTCTCTTAAAGCCACACCGACTGTATCCGGTTTAGTTGACTGAATATGGGCGTATCCCATTTCTAAAAGTACAACTTCTGCCATTTTTGAGGGCACTGGAGCAAACAAAGGCAATTCTTCTTCAGTGGCAAGCAAAGAGGGAAAAGTGGCGCCTATCAACCATGCTTTCAGATTGCACAATTTTGATATGCAAGCACACATATTCAAATGAAGCCCCAATACATTTTCAGGATATAATACGGACATGTGTGAGTTGACGACCGATCCCCAATCTCCTCCCTGGATGTAGAACTGATCGTATCCCAGTCTTTTCATCAGATTTTTTAAGATTTGTGCTATTCGTTCTGGGCCTAAGCCTGGTTTACTGGTCGCTTCTGAGA。

[0035] In the present invention, the upstream primer for amplifying the sequences shown in SEQ ID NO.1 and SEQ ID NO.2 is as shown in SEQ ID NO.5, and the downstream primer is as shown in SEQ ID NO.6.

[0036] SEQ ID NO.5: taatacgactcactatagggGTCGTTTAGACCTATTCTCTCGA; lowercase letters represent promoter sequences.

[0037] SEQ ID NO.6: taatacgactcactatagggACCTTGACAAAGTAGTGAGAGA; lowercase letters represent promoter sequences.

[0038] In this invention, the reaction system used to amplify the sequences shown in SEQ ID NO.1 and SEQ ID NO.2 is as follows: 1 μL cDNA, 1 μL each of primer F / R (10 μM), 25 μL 2×Phanta Max Master Mix, and ddH2O to a final volume of 50 μL; the reaction program is as follows: 95℃ pre-denaturation for 3 min, 1 cycle; 95℃ denaturation for 15 s, 58℃ annealing for 15 s and 72℃ extension for 30 s, for a total of 35 cycles; 72℃ final extension for 5 min, 1 cycle; 4℃ ∞.

[0039] In this invention, the upstream primer for amplifying the sequences shown in SEQ ID NO.3 and SEQ ID NO.4 is shown in SEQ ID NO.7, and the downstream primer is shown in SEQ ID NO.8.

[0040] SEQ ID NO.7: taatacgactcactatagggTCTCAGAAGCGACCAGTAAA; lowercase letters represent promoter sequences.

[0041] SEQ ID NO.8: taatacgactcactatagggTCCAGAATGTAAGCAGCAAG; lowercase letters represent promoter sequences.

[0042] In this invention, the reaction system used to amplify the sequences shown in SEQ ID NO.3 and SEQ ID NO.4 is as follows: 1 μL cDNA, 1 μL each of primer F / R (10 μM), 25 μL 2×Phanta Max Master Mix, and ddH2O to a final volume of 50 μL; the reaction program is as follows: 95℃ pre-denaturation for 3 min, 1 cycle; 95℃ denaturation for 15 s, 58℃ annealing for 15 s and 72℃ extension for 30 s, for a total of 35 cycles; 72℃ final extension for 5 min, 1 cycle; 4℃ ∞.

[0043] This invention also provides the application of the above-mentioned dsRNA in the preparation of the silencing reagents for the detoxification and metabolism genes TyCYP450_5 and TyJehe of the Yunnan twig borer.

[0044] In some embodiments of the present invention, when the dsRNA is injected into Yunnan bark beetle, the injection volume of the dsRNA is 2 μg / head; the S-α-pinene is used by headspace fumigation, and the amount of S-α-pinene used is 3 μL per treatment group.

[0045] To further illustrate the present invention, the following detailed description is provided in conjunction with embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0046] Example 1: Yunnan branch beetle TyCYP450_5 Genes and TyJehe dsRNA synthesis of genes 1. RNA extraction (a) Three healthy adult Yunnan twig borers were selected as one biological replicate. Three biological replicates were set up. The insects were ground into powder in a mortar with liquid nitrogen and transferred to 1.5 mL RNase-free centrifuge tubes.

[0047] (b) Add 600 μL of lysis buffer to a 1.5 mL RNase-free centrifuge tube, homogenize with a micro electric homogenizer, and place at room temperature for 5 min.

[0048] (c) Place the centrifuge tube in a centrifuge and centrifuge at 14000×g for 2 min. Transfer the supernatant to a new centrifuge tube.

[0049] (d) Add an equal volume of binding buffer to the lysis buffer, gently invert and mix 4 times; transfer the mixture to a purification column, centrifuge at 12000×g for 30s, and discard the liquid in the collection tube; (e) Add 600 μL of washing solution I, centrifuge at 12000×g for 30s, and discard the liquid in the collection tube; add washing solution II, centrifuge at 12000×g for 30s, discard the liquid in the collection tube, and repeat the operation once; centrifuge at the highest speed of 15000×g for 2min to remove the residual liquid.

[0050] (f) Place the RNA purification column in an RNA elution tube, add 40 μL of elution buffer, incubate at room temperature for 3 min, and centrifuge at the highest speed for 30 s.

[0051] (g) Strictly follow the procedures outlined in Beyotime's easy™ animal RNA extraction kit. Measure the absorbance of the obtained total RNA sample using a spectrophotometer, record the concentration, and finally store at -80℃ for later use.

[0052] 2. Reverse transcription to synthesize cDNA (a) Removal of genomic DNA: Prepare the reaction system as shown in Table 1 in RNase-free centrifuge tubes.

[0053] Table 1. Reaction system for the first step of transcription After the reaction system is prepared, gently mix it by pipetting, and then react at 42°C for 2 minutes.

[0054] (b) Configure the reverse transcription reaction system as shown in Table 2.

[0055] Table 2 Reverse transcription reaction system (c) Perform reverse transcription reaction. The reaction procedure is as follows: react at 37℃ for 15 min, react at 85℃ for 5 cycles, and finally react at 4℃.

[0056] (d) The cDNA product after PCR is stored at -20℃ for later use.

[0057] 3. Synthesis of dsRNA According to the Yunnan tip beetle TyCYP450_5 and TyJehe The nucleotide sequences (shown in SEQ ID NO. 1-4) were designed for the synthesis of detoxification metabolic genes of the Yunnan bark beetle. TyCYP450_5 and TyJehe Primer pair 1 and primer pair 2 for dsRNA, the nucleotide sequence of the upstream primer of primer pair 1 is shown in SEQ ID NO.5, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.6; the nucleotide sequence of the upstream primer of primer pair 2 is shown in SEQ ID NO.7, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.8.

[0058] Using the cDNA from step 2 as a template, primer pair 1 was used to amplify dsTyCYP450_5 (225 bp) and primer pair 2 was used to amplify dsTyJehe (412 bp). Then, the detoxification metabolic gene of *Bark Beetle yunnanensis* was obtained using an in vitro dsRNA synthesis kit. TyCYP450_5 and TyJeheThe specific synthesis steps are as follows: The target band was amplified by PCR. The reaction system consisted of: 1 μL cDNA, 1 μL each of primers F / R (10 μM), 25 μL 2×Phanta Max Master Mix, and ddH2O to a final volume of 50 μL. The reaction program was: 95℃ pre-denaturation for 3 min, 1 cycle; 95℃ denaturation for 15 s, 58℃ annealing for 15 s, and 72℃ extension for 30 s, for a total of 35 cycles; final extension at 72℃ for 5 min, 1 cycle; and 4℃ ∞. The system was then expanded for PCR amplification. The PCR product was purified using a MagBeads PCR Cleanup Kit (Polan, PU003). After electrophoresis, the purified product was used as a template for dsRNA synthesis using the T7 RNA Transcription Kit Plus (Zhisheng Yougu, SJ001V2). 1-5 µL of the reaction product was taken and the transcription product synthesis was detected by 1% agarose gel electrophoresis. The results are shown below. Figure 1 As shown. The qualified dsRNA samples were purified using an RNA purification kit (magnetic bead method) (Zhisheng Yougu, PU002) to remove impurities such as free nucleotides and proteins contained in the dsRNA, obtaining dsTyCYP450_5 and dsTyJehe, which were stored at -80℃ for later use.

[0059] Example 2: Evaluation of the silencing effect of dsRNA on detoxification and metabolic genes of *Bark beetle yunnanensis* One hundred and fifty healthy adult Yunnan bark beetles were randomly divided into five groups of 30 each: Control Group 1 (CK); Control Group 1 (dsEGFP): injected with dsEGFP (Zhisheng Yougu, DS001); Treatment Group 1 (T1): injected with dsTyCYP450_5; Treatment Group 2 (T2): injected with dsTyJehe; Treatment Group 3 (T3): injected with a mixture of dsTyCYP450_5 and dsTyJehe. Under a stereomicroscope, a 2 μg / μL solution of dsTyCYP450_5 and dsTyJehe, along with a 1:1 mixture of two dsRNA solutions (2 μg / μL each), was injected into the abdomen of the bark beetles using a microsyringe. The injection dose was 2 μg / beetle, taking care to avoid damaging critical organs during injection. After injection, the beetles were reared in an artificial climate chamber at 25°C and 60% humidity.

[0060] 24 hours after dsRNA injection, three bark beetles were randomly selected from each group as a biological replicate, and four biological replicates were set up. The replicates were then flash-frozen in liquid nitrogen and stored. Total RNA was extracted from each group of bark beetles according to the total RNA extraction method in Example 1. RNA integrity and purity were tested, and qualified samples were used for subsequent cDNA synthesis. cDNA was synthesized using the extracted total RNA as a template according to the RNA extraction and cDNA synthesis methods in Example 1. The cDNA was diluted 100-fold and used as a template for quantitative real-time PCR, and stored at -20°C for later use.

[0061] The SYBR Green Pro Taq HS premixed qPCR kit was used to detect the virus using real-time quantitative PCR (qRT-PCR). TyCYP450_5 and TyJehe The relative expression level of the gene. The primer sequences involved in qRT-PCR are: TyCYP450_5-F: TGGATTAAATTCCTCTGGATTGGGA, SEQ ID NO.9; TyCYP450_5-R: ACCAGTTGTACCTAGGCTATGC, SEQ ID NO.10; TyJehe-F: AGGCCCAGAACGAATAGCAC, SEQ ID NO.11; TyJehe-R: TGTGAGTTGACGACCGATCC, SEQ ID NO. 12.

[0062] The qRT-PCR reaction system is shown in Table 3, and the reaction procedure is shown in Table 4.

[0063] Table 3 qRT-PCR reaction system Table 4 qRT-PCR reaction procedure For each assay, the expression level of the 18S rRNA of the Yunnan bark beetle was selected as the standard internal reference gene. Subsequently, the expression level of the target gene at different time points under different treatments was detected using the standardized internal reference gene. Specific qPCR primers were designed using Primerpremier 5.0 and synthesized by Hunan Aikerui Biotechnology Co., Ltd. After verifying the amplification efficiency (E) of different genes and confirming it met the requirements, quantitative real-time qPCR experiments were performed. After the experiments, 2... -ΔΔCtRelative expression levels were calculated using the method. SPSS 17.0 software was used for statistical analysis of the data. One-way ANOVA combined with Tukey's test was used to compare differences in gene expression levels among groups (p < 0.05 was considered statistically significant).

[0064] The primer sequences for amplifying the 18S rRNA of the internal reference gene are as follows: 18s rRNA-F: CGGCTACCACATCCAAGG, SEQ ID NO.13; 18s Rrna-R: GGCGGCAAGAGACACAAA, SEQ ID NO. 14.

[0065] Results analysis: such as Figure 2 As shown. 24 hours after dsRNA injection, *Spodoptera yunnanensis* (Yunnan branch beetle)... TyCYP450_5 Genes and TyJehe Gene expression levels changed. Compared to the control group (dsEGFP injection group), treatment group 1 (dsTyCYP450_5 injection group) showed changes at 24h. TyCYP450_5 The relative expression level of the gene was significantly downregulated (p<0.001), with a silencing efficiency of 88.13%; in treatment group 2 (dsTyJehe injection group), at 24h, TyJehe The relative expression level of the gene was significantly downregulated (p<0.0001), with a silencing efficiency of 99.75%; in treatment group 4 (combined injection group), at 24 h, TyCYP450_5 and TyJehe The relative expression levels of all genes were significantly downregulated (p<0.001). TyCYP450_5 The gene silencing efficiency reached 81.72%. TyJehe The gene silencing efficiency reached 96.01%.

[0066] Example 3: Evaluation of the lethal effect of the combined use of dsTyCYP450_5 / dsTyJehe and pinene on *Bark beetle yunnanensis*. One hundred and twenty healthy adult Yunnan bark beetles were randomly divided into four groups of 30 beetles each, with ten beetles per replicate: Control group 1 (dsEGFP): injected with dsEGFP (Zhisheng Yougu, DS001); Treatment group 1 (T1): injected with dsTyCYP450_5; Treatment group 2 (T2): injected with dsTyJehe; Treatment group 3 (T3): injected with a mixture of dsTyCYP450_5 and dsTyJehe. Under a stereomicroscope, a 1:1 mixture of 2 μg / μL dsTyCYP450_5 and dsTyJehe, and 2 μg / μL solutions of two dsRNAs was injected into the abdomen of the bark beetles using a microsyringe. The injection volume was 2 μg / beetle, and care was taken to avoid damaging the beetle's critical organs during the injection process. After injection, the bark beetles were placed in sealed centrifuge tubes containing sterile filter paper with 2 μL of S-α-pinene added, and reared in an artificial climate chamber at 25°C and 60% humidity to simulate host defense stress. Mortality rates of *Bark Beetles yunnanensis* in the three groups were recorded at 24 h and 48 h.

[0067] Results analysis: such as Figure 3 As shown. Compared with the control group, the injection TyCYP450_5 and TyJehe The mortality rate of *S. yunnanensis* treated with dsRNA significantly increased at both 24 and 48 hours. In the control group (injected with dsEGFP combined with S-α-pinene), the mortality rate of *S. yunnanensis* was 10% at 24 hours and 26.7% at 48 hours, indicating that S-α-pinene indeed has a lethal effect on *S. yunnanensis*. Within 24 hours, the mortality rate of *S. yunnanensis* in treatment group 1 (injected with dsTyCYP450_5 combined with S-α-pinene) was 33%, reaching 60% within 48 hours; the mortality rate in treatment group 2 (injected with dsTyCYP450_5 combined with S-α-pinene) was 36%, reaching 56% within 48 hours; and the mortality rate in treatment group 3 (combined injection group) reached 73% at 24 hours and 93% at 48 hours. The results show that dsTyCYP450_5 and dsTyJehe provided by this invention can increase the sensitivity of *Bartholinae yunnanensis* to S-α-pinene through injection, and can increase the mortality rate of *Bartholinae yunnanensis* by combining them with S-α-pinene. The combined use of dsTyCYP450_5 and dsTyJehe resulted in a higher mortality rate of *Bartholinae yunnanensis* than either dsRNA alone, indicating a synergistic effect between the two dsRNAs, and that their combined use can significantly enhance the lethality of *Bartholinae yunnanensis*.

[0068] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A detoxification metabolic gene of the Yunnan shoot beetle. TyCPY450_5 Its characteristics are, The TyCPY450_5 The nucleotide sequence is shown in SEQ ID NO.1 or SEQ ID NO.

2.

2. A detoxification metabolic gene of the Yunnan shoot beetle. TyJehe Its characteristics are, The TyJehe The nucleotide sequence is shown in SEQ ID NO.3 or SEQ ID NO.

4.

3. A method for controlling the Yunnan shoot beetle, dsTyCPY450_5, characterized in that, The dsTyCPY450_5 is synthesized from the sequence shown in SEQ ID NO.1 and the reverse complementary sequence shown in SEQ ID NO.

2.

4. A method for controlling the Yunnan shoot beetle, characterized in that, The dsTyJehe is synthesized from the sequence shown in SEQ ID NO.3 and the reverse complementary sequence shown in SEQ ID NO.

4.

5. The application of dsTyCPY450_5 as described in claim 3 or dsTyJehe as described in claim 4 in the preparation of products that silence the detoxification metabolic gene of *Bartholinae yunnanensis*.

6. The application of the dsTyCPY450_5 of claim 3 or the dsTyJehe of claim 4 in the preparation of products for controlling Yunnan shoot beetle.

7. The claim 1 TyCPY450_5 The claims 2 TyJehe The application of dsTyCPY450_5 as described in claim 3 or dsTyJehe as described in claim 4 in constructing transgenic plants for controlling Yunnan shoot beetle or in cultivating plants resistant to Yunnan shoot beetle.

8. The application of dsTyCPY450_5 as described in claim 3 and / or dsTyJehe as described in claim 4 in the preparation of products for controlling Yunnan shoot beetle in combination with pinene.

9. The application of dsTyCPY450_5 as described in claim 3 and / or dsTyJehe as described in claim 4 in the combined use of pinene to control Yunnan shoot beetle.

10. A method for controlling the Yunnan shoot beetle, characterized in that, The procedure includes injecting the dsTyCPY450_5 of claim 3 and / or the dsTyJehe of claim 4 into the body of *Bartholinium yunnanense*, followed by treating the *Bartholinium yunnanense* with pinene.

Images