Transgenic silkworm strains overexpressing sod and their application in promoting silk gland development and improving silk quality
Patent Information
- Application Number
- CN202611048296.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-07-15
- Publication Date
- 2026-08-21
AI Technical Summary
然而,当前关于SOD对家蚕丝腺发育及蚕丝品质的影响尚缺乏系统研究
[0017]1、本发明的方案首次发现中肠过表达的超氧化物歧化酶蛋白可经血淋巴转运至后部丝腺组织,并进一步穿过丝腺细胞膜分泌进入管腔内部。
Smart Images

Figure CN122609593A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of bioengineering technology, and more specifically, to transgenic silkworm strains overexpressing SOD and their application in promoting silk gland development and improving silk quality. Background Technology
[0002] The silkworm is an important economic insect. The silk gland is the only organ in the silkworm that synthesizes and secretes silk protein, and its developmental state directly determines the yield and quality of cocoons. The silkworm's silk gland can be divided into the anterior, middle, and posterior silk glands. The posterior silk gland is responsible for synthesizing fibroin, while the middle silk gland is responsible for synthesizing sericin. Silk protein is mainly composed of fibroin synthesized by the posterior silk gland and sericin synthesized by the middle silk gland. Fibroin forms the core skeleton of silk, while sericin binds the fibroin fibers together, jointly determining the mechanical properties and quality of silk.
[0003] As an organ, the overall growth and development of the silk gland originates from changes in its constituent units, namely the silk gland cells. Increased organ volume is typically driven by two fundamental cellular processes: an increase in cell number (cell proliferation) and an increase in the size of individual cells (cell growth or hypertrophy). Studies have shown that the PI3K-AKT-mTOR signaling pathway is a core pathway regulating ribosome biosynthesis and protein translation, particularly in silkworms, where it is crucial for silk gland cell growth, DNA replication, and silk protein synthesis.
[0004] The color of silkworm cocoons is one of the important economic traits. Studies have shown that the pigments in colored silkworm cocoons (especially green and yellow cocoons) are mainly flavonoids or carotenoids. These pigments are selectively transported and accumulated in sericin, and flavonoids themselves have strong antioxidant activity. The central silk gland is the core site for sericin synthesis and pigment accumulation. The formation of colored cocoons depends on the absorption, transport, and deposition of flavonoid pigments from mulberry leaves in the silk gland.
[0005] Superoxide dismutase (SOD) is a key antioxidant enzyme in organisms that scavenges reactive oxygen species (ROS), playing a crucial role in maintaining redox homeostasis, mitigating oxidative damage, and regulating physiological functions. SOD protein derived from the extreme thermophilic bacterium HB27 exhibits extremely high thermostability, remaining highly stable at 90°C and retaining 57% of its activity even after treatment at 100°C for one hour. However, systematic research on the effects of SOD on silk gland development and silk quality in silkworms is currently lacking. Therefore, developing a technical solution that can promote silk gland development and improve silk quality through SOD overexpression is of great significance for silkworm germplasm innovation and the improvement of silk industry quality.
[0006] Therefore, this application proposes a transgenic silkworm strain with SOD overexpression and its application in promoting silk gland development and improving silk quality, in order to solve the above-mentioned problems. Summary of the Invention
[0007] The purpose of this invention is to provide transgenic silkworm strains with SOD overexpression and their application in promoting silk gland development and improving silk quality, thereby solving the problem of the lack of technical solutions in the prior art for promoting silk gland development and improving silk quality by utilizing SOD overexpression.
[0008] The above-mentioned objective of the present invention is achieved as follows:
[0009] The present invention provides a transgenic silkworm strain that overexpresses SOD, wherein the midgut of the transgenic silkworm strain specifically overexpresses superoxide dismutase derived from thermophilic bacteria HB27, and the superoxide dismutase protein is secreted by the midgut and then crosses the silk gland cell membrane to enter the silk gland lumen.
[0010] Furthermore, the signal of the superoxide dismutase protein is concentrated in the luminal region of the posterior silk gland.
[0011] Furthermore, the expression of core genes PI3K, AKT, and S6K of the PI3K-AKT signaling pathway, as well as cell cycle regulatory genes Cyclin D and Cyclin E, in the posterior silk gland is activated.
[0012] The present invention also provides the application of the above-described transgenic silkworm strain in the preparation of silkworm materials that promote silk gland development.
[0013] The present invention also provides the application of the above-described transgenic silkworm strain in the preparation of silkworm materials that improve silk quality.
[0014] Furthermore, the expression of the silk fibroin synthesis genes FibL and P25 and the ribosomal protein genes mRpl1 and Rpl12 in the posterior silk gland is upregulated.
[0015] Furthermore, the expression of genes related to flavonoid pigment transport and metabolism, namely BmStrGn4, BmStrGn5, CBP, and SCRB15, was upregulated in the central silk gland.
[0016] Compared with the prior art, the present invention has the following beneficial effects:
[0017] 1. The present invention is the first to discover that superoxide dismutase protein overexpressed in the midgut can be transported to the posterior filarial gland tissue via hemolymph and further penetrate the filarial gland cell membrane to be secreted into the lumen.
[0018] 2. The transgenic silkworm strain of the present invention can significantly promote the morphological development of silk glands, with the middle and posterior silk glands becoming darker in color and the posterior silk glands becoming significantly longer.
[0019] 3. The present invention has demonstrated through experiments that SOD overexpression can significantly enhance the proliferative activity of posterior filamentous gland cells, increase the volume of posterior filamentous gland cells, and provide a sufficient cellular basis for silk protein synthesis.
[0020] 4. The present invention demonstrates through experiments that SOD overexpression can activate the expression of core genes (PI3K, AKT, S6K) of the PI3K-AKT signaling pathway and cell cycle regulatory genes (Cyclin D, Cyclin E), driving the proliferation and growth of filamentous gland cells.
[0021] 5. The present invention demonstrates through experiments that SOD overexpression can alter the composition ratio of fibroin and sericin, significantly increasing the proportion of sericin in silkworm cocoons, resulting in denser silk fiber arrangement, significantly reduced inner silk fiber diameter, and optimized silk microstructure.
[0022] 6. The present invention has demonstrated through experiments that SOD overexpression can upregulate the expression of genes related to flavonoid pigment transport and metabolism, promote the deposition of pigment substances in sericin, and deepen the color of silkworm cocoons.
[0023] 7. This invention provides a new technical approach and transgenic material for the study of the regulatory mechanism of silk gland development in silkworms and the improvement of silk quality. Attached Figure Description
[0024] Figure 1 This is a diagram illustrating the effect of SOD overexpression on the morphological development of silk glands in silkworms in this embodiment of the invention (A represents the morphology of silk glands at L5D3, B represents the morphology of silk glands at L5D5, and C represents the observation of silk glands at L5D5 after they were collected into centrifuge tubes).
[0025] Figure 2 This is an immunofluorescence localization analysis diagram of SOD protein in the posterior silk gland of silkworm in an embodiment of the present invention (WT is the wild-type group, and SOM3 is the transgenic strain group).
[0026] Figure 3 This is a diagram showing the effect of SOD overexpression on the morphology and size of posterior silk gland cells in silkworms in an embodiment of the present invention (A is the observation of DAPI and phalloidin staining in the L4D1 stage, and B is the observation of DAPI and phalloidin staining in the L5D1 stage).
[0027] Figure 4 This is a diagram showing the effect of SOD overexpression on the proliferation of silk gland cells and the expression of related signaling pathway genes in the embodiments of the present invention (A is the detection of silk gland cell proliferation by L5D5 EdU, and B is the detection of gene expression related to posterior silk gland proliferation by qPCR).
[0028] Figure 5 This is a graph showing the effect of SOD overexpression on the color of silkworm cocoons and the content of sericin in an embodiment of the present invention (A is the observation of cocoon color, B is the observation of solution color after urea dissolves sericin, and C is the statistical analysis of sericin content).
[0029] Figure 6 This is a diagram illustrating the effect of SOD overexpression on the expression of fibroin and ribosome synthesis-related genes in the posterior silk gland of silkworm in this embodiment of the invention.
[0030] Figure 7 This is a diagram showing the effect of SOD overexpression on the microstructure of silkworm silk fibers and the expression of sericin-related genes in the embodiments of the present invention (A is the silk fiber structure observed by scanning electron microscopy, B is the statistical analysis of the diameter of the inner and outer silk layers, and C is the expression of sericin factors detected by qPCR).
[0031] Figure 8 This is a diagram illustrating the effect of SOD overexpression on the expression of genes related to cocoon color in the middle silk gland of silkworms in an embodiment of the present invention. Detailed Implementation
[0032] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.
[0033] The implementation of the present invention will be described in detail below with reference to specific embodiments.
[0034] Example 1: Experimental Materials and Reagents
[0035] The silkworm strain used in this embodiment is the non-diapause Dazao (D9L). The silkworm eggs were incubated at room temperature of 25°C and relative humidity of about 75%. The larvae were raised under conditions of 25°C, 12 hours of light, 12 hours of dark light cycle and relative humidity of 75%.
[0036] Experimental instruments include: tweezers (Zhongjing Keyi), scissors (Sangon Biotech), quantitative PCR instrument (ABI), fluorescence microscope (Life Technologies), microinjection apparatus (Eppendorf), and pure water system (Millipore), etc.
[0037] The experimental reagents included: PBS (Shanghai Sangon Biotech), Trizol (Invitrogen), 4% paraformaldehyde (Beyotime), Triton X-100 (Shanghai Sangon Biotech), DEPC (Sigma), DAPI (Beyotime), etc.
[0038] Preparation of main solutions: (1) 8M urea solution: Weigh about 4.8g of urea and place it in a 15mL centrifuge tube. Add autoclaved ddH2O to bring the volume up to the 10mL mark. Prepare and use immediately.
[0039] The primers required for the experiment are shown in Table 1 below:
[0040] Table 1 Primers
[0041] SWT TTCGTACTGGCTCTTCTCG TTCAAAGTTGATAGCAATTCCCT SOD ATGGGTAGATTTGGTTCAGGG GTATTTAAGGTAGTAAGCGTGTT PI3K ATGTGGTTGCAAGGGAGAGG CTGTCTCCGGGTGCAATTAA AKT TAAGTTCCCTGAAGACATTCT ATTTTGTAATCCAAGCCATA S6K CGTCCGAGACCGCATCATAAA AGGTCTCTTTGTTGAGCGTG Yki GAAAGGGACCGCTCAAAGC ATCGCCAAAGACGATACGATAGAAGAC CyclinD GTGTCATCCGCTGTCCGTAG ATAATCTCCCATTGCCTCACT CyclinE CCCAAGACAATCCAGGCAAG AGGCGAGTCCACCCCA FibH TCTGTGTCATCTGCTTCATCT CGTATCCAGGACGAAGTAAAGAAAC FibL ATACCGATTGGTCACATAACAG GCAGATAGATGGGCGATAA P25 ACCCTGCTGCCACTTTACGAA ACCGAAGTCGCAGAGTGTT mRpl1 CGATGAGCACAAAGCGATAC ATGAGGCAGCAAGGACAAAC Rpl12 GGTCCTCTTGGTCTGTCTCCT ATCTGGGCTTGTCTTGTTTGA Rps13 TGCCCAAGTAAGATTCGTAACT TTTGCTGTCTTTGTCTTTCCTG Ser1 CACAACCGATAAGACGAGGA CGAAGTGGAGGAAGCSer2 Ser2 CATCGGCTGACTACCAAGAGT TGCTGCCCTTAC Ser3 TGTCCTGCGGTGGAATTGTT GTATGACTGGCTCT BmStrGn4 GTCGTATCTATTCTCTGTAGTTGGT GCCTTGACTTTCTCATAGTCAGCGCT BmStrGn5 CACCTTATTTATTCGCCCTCGAT CTTCCTCTGTGTTTCAAAGTTTCAC CBP ACACGAAACCAACGTGCAAC CGGGCTGTTTCTCTTGTCT SCRB15 CGCTGATCCTCACAGATCCC TTGAACAGGTACACCGGCAA UGT40K1 TGTTGGGTGAATTGAAACAGAC CTCCGTGTGTGATGAATAACACC Cameo2 GGAGTTTGTGGAGAGTGGGG ACTCGCCCTTACAGAAGCAC
[0042] Example 2: Anatomical observation of silk glands
[0043] Under the same rearing conditions, the silk glands of WT and SOM1, SOM2, and SOM3 silkworms at L5D3 and L5D5 stages were dissected, observed, and analyzed morphologically.
[0044] Anatomical methods of silk gland tissue in silkworms:
[0045] (1) Preliminary preparation: autoclaved 1×PBS solution, foam board, petri dish, autoclaved filter paper, dissecting forceps, scissors, thumbtack;
[0046] (2) Cut the silkworm open from the tail end, carefully remove the silk gland and place it in a 1×PBS solution that has been autoclaved for easy observation;
[0047] (3) Silk gland materials for which protein or RNA needs to be extracted should be flash-frozen in liquid nitrogen and stored at -80°C.
[0048] The results show that ( Figure 1 During the L5D3 stage, the central silk gland (MSG) of silkworms in the SOM3 group showed a significant deepening of color, differing from the WT group. Upon entering the L5D5 stage, the central and posterior silk glands (PSG) of silkworms in both the SOM2 and SOM3 groups showed significant deepening of color, with the posterior silk gland exhibiting a marked increase in length. These changes in volume and color were more clearly observed after collecting the silk glands into centrifuge tubes, indicating that SOD overexpression significantly promotes the morphological development and material accumulation of the silk glands.
[0049] Example 3: Immunofluorescence localization of SOD protein in silk glands
[0050] The posterior silk gland tissue of silkworms in the SOM3 group at L5D3 stage was selected, and the subcellular localization of SOD protein was analyzed by immunofluorescence. At the same time, the nucleus and cytoskeleton were labeled with DAPI and Phalloidin, respectively, and the differences between the WT group and the SOM3 group were compared.
[0051] Immunofluorescence staining method:
[0052] (1) Add 4% paraformaldehyde to the target sample for fixation for 30 min;
[0053] (2) Wash three times with 1×PBS, 5 min each time;
[0054] (3) Permeabilize with 1×PBS containing 0.1% Triton X-100 at room temperature for 10 min, and wash 3 times with PBS;
[0055] (4) Block with PBST containing 1% BSA at room temperature for 1 h, discard the blocking solution, and wash 3 times with 1×PBS for 5 min each time;
[0056] (5) Prepare His primary antibody with 0.05% PBST containing 1% BSA at a ratio of 1:1000, and incubate overnight at 4°C or at room temperature for 2 h;
[0057] (6) Wash with 1×PBS 3 times, 5 min each time;
[0058] (7) Prepare Cy3 fluorescent secondary antibody with 0.05% PBST containing 1% BSA at a ratio of 1:1000, shake for 10 min, and incubate at room temperature for 2 h;
[0059] (8) Wash 5 times with 1×PBS, 5 min each time;
[0060] (9) FITC-labeled phalloidin, stained at room temperature for 30 min;
[0061] (10) Stain with DAPI for 15 min, wash with PBS 5 times, 5 min each time;
[0062] (11) After the slide has dried slightly, add 8 μL of anti-fluorescence quencher to immerse the three replicate tissue samples; avoid generating air bubbles. Apply clear nail polish around the coverslip to seal the slide;
[0063] (12) Observe under a suitable field of view under a fluorescence microscope.
[0064] The results show that ( Figure 2 In the WT group, only a very weak non-specific red fluorescent signal (Anti-His-SOD) was detected in the posterior filamentous glands, while the SOM3 group showed a strong and clear red fluorescent signal in the posterior filamentous glands. This signal was mainly concentrated in the filamentous gland lumen region and formed a clear spatial separation from the Phalloidin-labeled cytoskeleton outline. This suggests that the SOD protein overexpressed in the midgut can be transported to the posterior filamentous gland tissue through the hemolymphatic circulation and further secreted into the lumen through the filamentous gland cell membrane.
[0065] Example 4: Effects of SOD overexpression on the morphology and size of posterior filament cells
[0066] The posterior silk glands of WT, SOM1, SOM2, and SOM3 silkworms at L4D1 and L5D1 stages were co-stained with DAPI and Phalloidin to observe changes in cell morphology and size.
[0067] Phalloid peptide staining method:
[0068] (1) Preparation of 1× working solution: Take 10 μL of 1000×Fluor 674 labeled phalloidin stock solution and dilute and mix with 10 mL of PBS solution containing 1% BSA;
[0069] (2) Dissection and sampling: Dissect L4D1 and L5D1 silkworms respectively to obtain the posterior silk glands;
[0070] (3) Fixation: Place the silk glands after removing impurities in a 12-well plate, add an appropriate amount of 4% paraformaldehyde, and fix at room temperature for 30 min or at 4°C overnight;
[0071] (4) Washing: Wash the silk glands 3 times with PBS, 5 min each time;
[0072] (5) Permeation: Permeate with PBS solution containing 0.1% Triton X-100 for 5 min;
[0073] (6) Washing: Repeat (4);
[0074] (7) Phalloidin staining: Transfer the silk glands to 1× working solution, stain in the dark for 1 h 30 min, wash 3 times, 5 min each time;
[0075] (8) Add an appropriate amount of DAPI staining solution and incubate at room temperature in the dark for at least 10 min;
[0076] (9) Add anti-fluorescence quenching agent, seal with nail polish, and temporarily store in a 4°C refrigerator;
[0077] (10) Take pictures and collect images under a fluorescence microscope.
[0078] The results show that ( Figure 3 In L4D1, there was no significant difference in the morphology and size of the posterior sepal cells between the SOM strains and the WT group. After entering L5D1 ( Figure 3 The posterior filament cells of the three transgenic lines SOM1, SOM2, and SOM3 were significantly larger than those of the WT group. Cytoskeleton markers showed a significant increase in cell volume, indicating that SOD overexpression can effectively promote the growth and expansion of posterior filament cells in the early fifth-year stage.
[0079] Example 5: Effects of SOD overexpression on posterior filament cell proliferation and related signaling pathways
[0080] EdU staining and key gene expression detection were performed on the posterior silk glands of L5D5 stage WT and SOM1, SOM2 and SOM3 silkworms.
[0081] EdU staining method:
[0082] (1) Dilute the EdU stock solution with cell culture medium to prepare 2×EdU working solution, and preheat at 37℃ for later use;
[0083] (2) Rinse the cells or filament glands once with PBS, add 2×EdU working solution preheated at 37℃ until the sample is completely submerged, and incubate at 27℃ for 2 h.
[0084] (3) Discard the culture medium, add 1 mL of 4% paraformaldehyde, and fix at room temperature for 30 min;
[0085] (4) Wash three times with PBS washing solution containing 3% BSA, and then permeate and punch holes with 0.3% PBST solution for 15 min;
[0086] (5) Continue rinsing with PBS containing 3% BSA 3 times, 2 min each time;
[0087] (6) Prepare the Click reaction solution strictly according to the components, order of addition, and volume shown in the table below. Use it within 15 minutes after thorough mixing, as shown in Table 2 below:
[0088] Table 2
[0089] Click Reaction Buffer 430.00 μL 2.15 mL 4.30 mL [CuSO4] 20.00 μL 100.00 μL 200.00 μL Azide 555 1.00 μL 5.00 μL 10.00 μL Click Additive Solution 50.00 μL 250.00 μL 500.00 μL Total volume 500.00 μL 2.50 mL 5.00 mL
[0090] (7) Discard the washing solution, add 500 μL of Click reaction solution, and incubate at room temperature in the dark for 30 min;
[0091] (8) Remove the reaction solution under light-protected conditions, and wash three times with washing solution for three minutes each time;
[0092] (9) Add DAPI staining solution and incubate at room temperature in the dark for 10 min;
[0093] (10) Remove the DAPI staining solution and wash three times with washing solution for three minutes each time;
[0094] (11) Add anti-fluorescence quenching mounting solution to mount the slide, and then observe and acquire images under a fluorescence microscope.
[0095] WT and SOM silkworms were co-reared until L5D5. The posterior silk glands of each silkworm were dissected and cultured in vitro for 4-6 hours in sterile medium containing EdU. EdU staining was then performed. Fluorescence microscopy revealed (…). Figure 4(A) Compared with the WT group, the red fluorescence signal of the posterior silk gland of silkworms in the SOM2 and SOM3 groups was significantly enhanced and expanded, indicating that SOD overexpression can significantly enhance the proliferation activity of posterior silk gland cells.
[0096] Their posterior silk glands were collected separately and RNA was extracted. qPCR detection revealed ( Figure 4 (B) The expression of PI3K, AKT, and S6K, core genes of the PI3K / Akt / mTOR pathway, was significantly upregulated in all SOM strains, with the activation level being particularly prominent in the SOM2 group. Simultaneously, the expression of Yki, a key transcription factor of the Hippo pathway, and Cyclin D and Cyclin E, cell cycle regulatory genes, was also significantly upregulated.
[0097] Example 6: Effects of SOD overexpression on cocoon color and sericin content
[0098] Morphological observation after clustering shows ( Figure 5 (A) The cocoon color of silkworms in group SOM3 was significantly darker than that in group WT, which is highly consistent with the phenotype of darkening of silk gland color in the early stage.
[0099] Methods for analyzing the content of fibroin and sericin in silkworm cocoons:
[0100] (1) Cut the silkworm cocoons into pieces, weigh 0.02 g of sample using a 0.001 g electronic balance, and transfer it into a pre-weighed 1.5 mL centrifuge tube;
[0101] (2) Add 1 mL of 8M urea and vortex until fully mixed;
[0102] (3) Heat in a metal bath at 95°C for 1 h, and vortex mix once every 15 min during the period;
[0103] (4) Centrifuge at 13,500 rpm for 1 min at room temperature;
[0104] (5) Discard the supernatant, add 1 mL ddH2O, and vortex to mix thoroughly;
[0105] (6) Repeat step (4);
[0106] (7) Repeat steps (5) and (6);
[0107] (8) Dry the sample thoroughly in a 60°C oven, weigh it (total weight of silk fibroin and centrifuge tube) and calculate the content. Set up 3 biological replicates for each group.
[0108] Further dissolving sericin with urea ( Figure 5 (B), the silk fibroin was dried and weighed, and the results showed ( Figure 5In the C group, the proportion of sericin in the SOM3 group increased from 34.63% in the WT group to 44.64%, and the proportion of fibroin changed from 65.37% to 55.36%, suggesting that SOD overexpression may change the fibroin / serice composition ratio while promoting the development of seric glands.
[0109] Example 7: Effects of SOD overexpression on the expression of posterior filament gland fibroin and ribosome synthesis-related genes
[0110] The expression levels of fibroin synthesis genes and ribosomal protein synthesis pathway-related genes in the posterior silk glands of WT and SOM strains were detected by qPCR.
[0111] First, the expression levels of the core silk fibroin synthesis genes FibH, FibL, and P25 were detected. Figure 6 The results showed that, compared with WT, the mRNA expression levels of FibL and P25 were significantly increased in the SOM1 strain, and the expression of FibH also increased to some extent, while the expression levels of these genes in the SOM2 and SOM3 strains were not significantly different from those in the control group.
[0112] Subsequently, the expression of genes related to the ribosomal protein synthesis pathway, mRpl1, Rpl12, and Rps13, was detected. Figure 6 The results showed that the expression levels of mRpl1 and Rpl12 were significantly increased in the SOM1 strain, while the expression levels of these genes in the SOM2 and SOM3 strains were not significantly different from those in the control group.
[0113] Example 8: Effects of SOD overexpression on the microstructure of silkworm silk
[0114] The silk fiber structure of silkworm cocoons in the WT and SOM3 groups was observed using scanning electron microscopy.
[0115] Scanning electron microscopy observation method:
[0116] (1) Sample pretreatment: Cut WT and SOM3 cocoons into small pieces of about 5 mm × 5 mm, and remove the inner and outer layers of cocoons respectively. Take 3 replicates for each group;
[0117] (2) Sample fixation: Place a clean piece of conductive adhesive in the center of the sample stage; use tweezers to flatten the silk sample onto the conductive adhesive, ensuring that the sample is in full contact with the conductive adhesive;
[0118] (3) Spray gold to achieve conductivity, and then place the sample on the machine;
[0119] (4) Scanning electron microscopy observation: Set the observation parameters and take pictures of silk in different areas;
[0120] (5) Image saving and analysis: Save the original TIFF image and annotate it;
[0121] (6) Clean the sample stage and turn off the experimental instruments.
[0122] Scanning electron microscopy results show ( Figure 7 Compared to the WT group, the inner and outer silk fibers of the silkworm cocoons in the SOM3 group were more densely arranged, and the sericin filling was more complete. Further statistical analysis of the silk fiber diameter revealed ( Figure 7 In group B), the diameter of the inner layer fibers in group SOM3 was significantly reduced, while the diameter of the outer layer fibers showed no significant difference.
[0123] The expression of the core gene for sericin synthesis in the central silk gland was detected by qPCR. Figure 7 (C) The results showed that Ser1 expression was significantly downregulated in the SOM3 group, while Ser2 and Ser3 expression did not change significantly.
[0124] Example 9: Effects of SOD overexpression on cocoon color-related gene expression
[0125] The expression levels of genes related to flavonoid pigment transport and metabolism in the middle silk glands of WT and SOM3 silkworms were detected by qPCR.
[0126] The results show that ( Figure 8 Compared with the WT group, the expression levels of flavonoid transport-related genes BmStrGn4, BmStrGn5 and CBP in the middle silk gland of silkworms in the SOM3 group were significantly upregulated, while the expression of flavonoid metabolism-related gene SCRB15 was also significantly increased, while the expression of Cameo2 was significantly downregulated, and the expression of UGT40K1 showed no significant difference.
[0127] In summary, through the above embodiments of the present invention, this invention reveals for the first time that in transgenic silkworm strains overexpressing superoxide dismutase (SOD) derived from thermophilic bacterium HB27 in the midgut, SOD protein can be transported to the posterior silk gland tissue via hemolymphatic circulation and penetrate the silk gland cell membrane to enter the lumen. This discovery breaks through the traditional cognitive framework that SOD is limited to anti-oxidative stress and establishes for the first time a systematic regulatory model of "local expression in the midgut and response in the distal silk gland." Furthermore, this invention discovers for the first time that SOD overexpression specifically activates core genes (PI3K, AKT, S6K) and cell cycle regulatory genes (Cyclin D, Cyclin E) of the PI3K-AKT signaling pathway, synergistically driving the proliferation and volume increase of posterior silk gland cells, thereby promoting silk gland morphological development from both cell number and cell volume dimensions, breaking through previous limitations. Understanding the regulation of silk gland development solely from the perspective of nutritional supply has limitations. More importantly, this invention reveals for the first time the strain-specific regulatory model of SOD overexpression on silk fibroin synthesis. Specifically, the SOM1 strain promotes fibroin synthesis by upregulating FibL, P25, mRpl1, and Rpl12, while the SOM3 strain promotes flavonoid pigment transport and deposition by upregulating BmStrGn4, BmStrGn5, CBP, and SCRB15, and changes the fibroin / sericein composition ratio (sericein content increases from 34.63% to 44.64%), resulting in denser silk fiber arrangement and a significant reduction in the diameter of inner silk fibers. This achieves cross-level quality optimization from silk gland development and silk fibroin composition to silk microstructure. These findings provide a new technical path and theoretical basis for the study of the molecular regulatory mechanism of silk gland development in silkworms and the genetic improvement of silk quality.
[0128] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A transgenic silkworm strain overexpressing SOD, characterized in that, The transgenic silkworm strain specifically overexpresses superoxide dismutase derived from thermophilic bacteria HB27 in its midgut, and the superoxide dismutase protein is secreted by the midgut and then crosses the silk gland cell membrane to enter the silk gland lumen.
2. The transgenic silkworm strain according to claim 1, characterized in that, The signal of the superoxide dismutase protein is concentrated in the lumen region of the posterior silk gland.
3. The transgenic silkworm strain according to claim 1, characterized in that, The expression of the core genes PI3K, AKT, and S6K of the PI3K-AKT signaling pathway, as well as the cell cycle regulatory genes Cyclin D and Cyclin E, was activated in the posterior silk gland.
4. The use of any one of the transgenic silkworm strains according to claims 1-3 in the preparation of silkworm materials that promote silk gland development.
5. The use of any one of the transgenic silkworm strains according to claims 1-3 in the preparation of silkworm materials that improve silk quality.
6. The application according to claim 5, characterized in that, The expression of the fibroin synthesis genes FibL and P25 and the ribosomal protein genes mRpl1 and Rpl12 in the posterior silk gland is upregulated.
7. The application according to claim 5, characterized in that, The expression of genes BmStrGn4, BmStrGn5, CBP, and SCRB15 related to flavonoid pigment transport and metabolism in the central silk glands is upregulated.