Dracaena cochinchinensis Dcsts5 gene and application thereof in preparing resveratrol

Abstract

The application relates to the technical field of bioengineering, and particularly relates to a Dracaena cochinchinensis DcSTS5 gene and application thereof in preparing resveratrol. DcSTS5 The nucleotide sequence of the gene is shown as SEQ ID NO:1. Through systematic verification, the application establishes DcSTS5 the core function of catalyzing the conversion of a precursor into resveratrol in a phenylpropanoid metabolic pathway, provides a key gene target for in-depth analysis of the molecular regulation mechanism of the efficient accumulation of stilbenes in dragon's blood, enriches the functional diversity of the plant stilbene synthase gene family, and lays a solid preliminary foundation for subsequent molecular basis research on the synthesis of active ingredients of the species.

Description

Technical Field

[0001] This invention relates to the field of bioengineering technology, and more particularly to a sword-leaved dragon tree. DcSTS5 Genes and their application in the preparation of resveratrol. Background Technology

[0002] Sword-leaved Dragon Blood Tree ( Dracaena cochinchinensis Dragon's Blood (Dracaena cochinchinensis) is the core source plant of the traditional and precious Chinese medicinal herb. The red resin secreted by the plant after mechanical damage or adverse environmental stress is known as Dragon's Blood Resin, which in traditional medicine has effects such as promoting blood circulation, removing blood stasis, stopping bleeding, and relieving pain. Modern pharmacological studies have confirmed that it also has significant activity in anti-inflammatory, analgesic, anti-atherosclerotic, and anti-tumor effects. Resveratrol compounds are the core active ingredient group of Dragon's Blood Resin, among which resveratrol and its derivatives are key substances for its efficacy. The average resveratrol content in *Dracaena cochinchinensis* is 1.28 mg / g, with a maximum of 3.56 mg / g, approximately 20 times that of traditional source species such as grapes. This significant content advantage provides ideal natural germplasm for studying the efficient synthesis mechanism of resveratrol. However, Dragon's Blood Resin has long relied on wild plant collection, facing an increasingly severe problem of resource depletion. Furthermore, traditional plant extraction methods are limited by the long plant growth cycle and large fluctuations in the content of effective components, making it difficult to meet the needs of large-scale production.

[0003] Stilbene synthase (STS) is a key rate-limiting enzyme in the resveratrol biosynthesis pathway. Its enzymatic activity directly determines the synthesis efficiency and accumulation level of stilbene compounds in plants, making it a core target for elucidating the resveratrol synthesis mechanism. Currently, significant progress has been made in the study of resveratrol synthesis pathways in model plants and economic crops such as peanuts and grapes. Existing studies have clarified that its biosynthesis mainly originates from the phenylpropane metabolic pathway, using phenylalanine or tyrosine as starting substrates, and ultimately generating resveratrol under STS catalysis through multiple enzymatic reactions. However, existing STS enzymes derived from grapes, peanuts, and other species generally suffer from low expression levels, insufficient catalytic efficiency, and poor substrate compatibility in heterologous expression systems, resulting in resveratrol production from microbial synthesis falling far short of industrialization requirements. Furthermore, chemical synthesis methods are cumbersome and highly polluting, further limiting the large-scale supply of resveratrol. Therefore, discovering and cloning novel STS enzyme genes with high catalytic activity and good heterologous expression characteristics is a crucial technical problem that urgently needs to be solved.

[0004] We cloned the STS enzyme gene from *Dracaena fragrans* for the first time through whole-genome sequencing and systematic screening, and proved its effectiveness by constructing a multi-gene co-expression vector and fermenting with *E. coli*. DcSTS5 The recombinant strain can ferment to produce resveratrol. This gene differs significantly from known grape VvSTS and peanut AhSTS genes in sequence structure and catalytic active sites, and... TAL and4CL The co-expression system exhibits excellent adaptability and carbon flux conversion efficiency. These results directly verify... DcSTS5 Its catalytic function is clearly defined. DcSTS5 It possesses catalytic function in the synthesis of resveratrol from precursor substances. The above research not only provides a preliminary foundation and enzyme engineering elements for the efficient biosynthesis and molecular breeding of resveratrol, but also offers a practical and feasible technical path for the artificial substitution of dragon's blood resources. Summary of the Invention

[0005] The purpose of this invention is to provide a DcSTS5 gene from Dracaena fragrans and its application in the preparation of resveratrol.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a sword-leaf dragon blood tree DcSTS5 Genes, the ones mentioned DcSTS5 The nucleotide sequence of the gene is shown in SEQ ID NO:1.

[0007] This invention provides a product containing the aforementioned DcSTS5 A recombinant expression vector for a gene, wherein the recombinant expression vector is pET28a - TAL - 4CL - DcSTS5 , its origin pET28a Inserted sequentially into the carrier TAL Gene, 4CL Genes and DcSTS5 Constructed from genes; the stated TAL The gene's GenBank accession number is ABC886. 4CL The gene's GenBank accession number is U5084.

[0008] Preferably, the nucleotide sequence of the recombinant expression vector is shown in SEQ ID NO:2.

[0009] The present invention provides a recombinant strain containing the recombinant expression vector, wherein the recombinant strain is Escherichia coli BL21(DE3) or DH5α strain.

[0010] This invention provides the aforementioned DcSTS5 The application of the gene or the recombinant expression vector in the preparation of resveratrol.

[0011] This invention provides the application of the recombinant strain in the fermentation production of resveratrol.

[0012] This invention provides a method for producing resveratrol by fermentation using the recombinant strain, comprising the following steps: (1) The recombinant strain was inoculated into M9 medium containing Kan and Chl resistance and cultured until the OD600 was 0.5~0.6; (2) IPTG was added to induce expression. The induction temperature was 15-17℃ and the induction time was 5-7 hours. (3) Induction followed by fermentation culture; (4) Collect the fermentation broth, extract and detect resveratrol.

[0013] Preferably, the M9 culture medium also contains methionine and CaCO3.

[0014] Preferably, the M9 culture medium contains 400-600 μL of kanamycin, 400-600 μL of chloramphenicol, 0.05-0.10 g of methionine, and 1.0-1.5 g of CaCO3 per 500 mL. Preferably, the fermentation culture parameters are set to 25~27℃ and 150~250rpm for 60~72 hours.

[0015] Compared with the prior art, the present invention has the following beneficial effects: This invention marks the first successful cloning and identification of a zirconia synthase gene with a clearly defined catalytic function from Dracaena fragrans. DcSTS5 This fills a gap in the resource of key rate-limiting enzyme genes for resveratrol biosynthesis in this rare medicinal plant. Through systematic validation, the gene sequence was established. ​ The core function of catalyzing the conversion of precursor substances to resveratrol in the phenylpropane metabolic pathway provides a key gene target for in-depth analysis of the molecular regulatory mechanism of efficient accumulation of succinate compounds in dragon's blood, enriches the functional diversity of the plant succinate synthase gene family, and lays a solid preliminary foundation for subsequent molecular basis research on the synthesis of active ingredients in this species.

[0016] The invention constructs ​ - ​ - ​ - ​ A multi-gene co-expression vector successfully achieved the targeted biosynthesis of the target product in *E. coli* host. This technical route overcomes the limitations of traditional resveratrol production, which relies excessively on plant resource extraction or chemical synthesis, and provides an effective strategy for heterologous biosynthesis. This prokaryotic expression system not only validates... ​ Its applicability in enzyme engineering also provides a practical enzyme engineering element and strain platform for the green and controllable production of succinate compounds using microbial chassis cells, significantly broadening the preparation route of resveratrol.

[0017] The technical solution established in this invention forms a complete research and application system for resveratrol biosynthesis, from gene cloning and vector construction to recombinant strain fermentation. This invention not only provides directly operable genetic elements for molecular breeding of *Dracaena fragrans*, but also provides technical support for accelerating the genetic improvement of superior medicinal plant germplasm. It has significant application value and strategic significance for promoting the sustainable development and high-value utilization of *Dracaena fragrans*-related traditional Chinese medicine resources. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0019] ​ The image shows a sword-leaf dracaena plant (left image is an overall view of the plant, right image is an image showing damage-induced damage to the stem). ​ The chromatogram of the fermentation product of the recombinant strain by HPLC; a: Resveratrol standard; b: Methanol blank; c: ​ - ​ - ​ No-load comparison; d: Recombinant strain ​ - ​ - ​ - ​ -1; e: Recombinant strain ​ - ​ - ​ - ​ -2; f: Recombinant strain ​ - ​ - ​ - ​ -3. Detailed Implementation

[0020] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0021] Example 1

[0022] one, ​ Gene cloning

[0023] 1. Experimental Materials

[0024] The dragon blood trees used in the experiment came from the Yunnan Branch of the Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences. The plant material was identified by professionals as *Dracaena fragrans* var. *sharpium*. ​ (Lour.) SCChen ( ​ In the experiment, its xylem was collected for RNA extraction.

[0025] 2 methods

[0026] 1) Induce damage to the stems of healthy, 10-year-old sword-leaf dracaena trees (e.g.) ​ (See right image). Five days later, the surface wood of the wound was collected and quickly frozen in liquid nitrogen. Total RNA was extracted using the RNA Easy Fast Plant Tissue RNA Rapid Extraction Kit (batch number: Y2107, Tiangen Biotech (Beijing) Co., Ltd.).

[0027] 2) The RNA extracted from the stem of *Dracaena fragrans* was reverse transcribed using the HiScriptⅢ 1st Strand cDNA Synthesis Kit (+gDNAwiper) to obtain cDNA.

[0028] 3) Target gene amplification and purification: Using the cDNA obtained in the previous step as a template, the *Dracaena fragrans* var. *spinosa* was amplified using 2×Phanta MaxMaster Mix (Dye Plus) high-fidelity enzyme (Nanjing Novizan Biotechnology Co., Ltd.). ​ Gene, (the primers for amplifying the target gene are: ​ -F1: ATGGTGGCCATCGATGAG (as shown in SEQ ID NO:3); ​ -R1: CTAGTTAGTAGCCACACTGCGCAGC (as shown in SEQ ID NO:4) , the system is shown in Table 1, and the amplification program is shown in Table 2. After PCR, the products were examined by agarose gel electrophoresis, and fragment sizes were compared using DNA Maker to determine the correct PCR products. The PCR products were then extracted and recovered using a gel extraction kit.

[0029] Table 1. Preparation of PCR reaction system

[0030] Table 2 PCR amplification program

[0031] 4) Ligation: The target fragment, purified by gel extraction, was ligated into the pLB cloning vector. The ligation system is shown in Table 3. Gently tap the centrifuge tube to mix the reaction solution, centrifuge briefly for 3-5 seconds, and then incubate the mixture at 22°C for 5 minutes. After the reaction, place the centrifuge tube on ice for subsequent transformation. Calculation of the amount of insert fragment used in the ligation system: Insertion fragment amount ng = (3~10) × 0.4 × carrier amount ng Table 3 Connection System

[0032] 5) Transformation: Prepare LB agarose plates containing a final concentration of ampicillin of 100 μg / ml. Place the plates at 37°C and preheat for at least 20 min.

[0033] a. Add 5 μL of the ligation product to 50 μL of LDH5α competent cells.

[0034] b. After heat shock at 42℃ for 90 seconds, immediately place in an ice bath for 2-3 minutes. Do not shake the centrifuge tube during this time.

[0035] c. Then add 250-500 μL of preheated LB medium (without antibiotics) at 37℃, and shake at 37℃ for 45 min to restore the culture. Spread 200 μL of bacterial culture onto LB solid medium containing ampicillin, and after the plate dries, incubate upside down at 37℃ for 12-16 h.

[0036] 6) Bacterial selection and culture: After ultraviolet disinfection of the ultra-clean bench, select 15-20 single colonies and inoculate them into 1 ml of LB medium (containing ampicillin at a final concentration of 100 ug / ml), and culture at 37℃ and 200-250 rpm for 4-5 hours with shaking.

[0037] 7) Bacterial culture PCR identification: Use 1 μl of bacterial culture as a template and perform PCR identification using universal primers for the pLB vector. The reaction system and procedure are the same as in Tables 1 and 2. Positive clones are sent for sequencing verification. The sequencing primers are universal primers PLB.

[0038] PLB-F: CGACTCACTATAGGGAGAGCGGC (as shown in SEQ ID NO:5); PLB-R: AAGAACATCGATTTTCCATGGCAG (as shown in SEQ ID NO:6). ​ The gene sequence is as follows.

[0039] ​ Nucleic acid sequence (as shown in SEQ ID NO:1): 8) Strain preservation: For positive strains whose sequencing results match the reference sequence, take 350 μL of bacterial culture and mix it with 60% sterile glycerol in a 1:1 ratio, and store it in a -80℃ refrigerator for long-term preservation.

[0040] two, ​ - ​ - ​ - ​ Construction of prokaryotic expression vectors

[0041] by ​ Based on the basic framework, the first step is to synthesize... ​ (GenBank login number: ABC886) and ​ (GenBank accession number: U5084) Gene insertion ​ Carrier, Construction ​ - ​ - ​ Intermediate carrier. The optimized codon. ​ The gene is inserted via NheI and EcoRI double restriction sites. ​ - ​ - ​ Vector multiple cloning sites, ultimately obtained ​ - ​ - ​ - ​ Recombinant expression vectors.

[0042] 1. Preparation of linearized carriers

[0043] Linearized vectors were prepared using a double enzyme digestion method, with NheI and EcoRI selected for digestion. The digestion system is as follows: Table 4 Enzyme digestion system

[0044] 1) Mix well, centrifuge briefly at 37℃ for 2.5-3 hours; 2) Take 5 μl for electrophoresis verification: Double enzyme digestion should produce two bands—a large fragment (vector backbone) and a small fragment (the cut MCS region); 3) Cut the gel to recover large fragments (carrier skeleton), determine the concentration (Nanodrop), and store at -20℃ for later use.

[0045] 2. Insertion Fragment Preparation

[0046] 1) Homologous primer design: Introduce 15-20 bp homologous sequences from both ends of the linearized vector into the 5' end of the forward and reverse amplification primers of the insert fragment, so that the 5' and 3' ends of the amplified insert fragment have homologous sequences that correspond to the ends of the linearized vector. ​ The primers for amplifying the target gene are: ​ -F: gtagcggcgcattaagctagcCGAGATTTAATCGCCGCG (as shown in SEQ ID NO:7) ​ -R: gtggtggtgctcgaggaattcTTAGTTGGTCGCAACAGAACGC (as shown in SEQ ID NO:8).

[0047] 2) Insert fragment PCR amplification: Amplification was performed using Phanta Max Super-Fidelity DNA Polymerase (Vazyme#P505) high-fidelity polymerase. The amplification system and procedure are shown in Tables 1 and 2. After determining the concentration (Nanodrop), the sample was stored at -20℃ for later use.

[0048] 3. Calculation of carrier and insert fragment usage: ​ - ​ - ​ The amount of carrier used is 192 ng = 0.02 × 9600 (number of carrier base pairs); ​ Insert fragment usage: 80 ng = 0.04 × 2000 (number of base pairs in the insert fragment)

[0049] 4. Recombination reaction

[0050] 1) Prepare the following reaction system on ice: Table 5 Reaction System

[0051] Note: X / Y represents the calculated amounts of vector and insert fragments; check for any residual circular plasmids.

[0052] 2) Gently pipette and mix well, then centrifuge briefly.

[0053] 3) After reacting in a metal bath at 37°C for 30 minutes, immediately place it on ice to cool.

[0054] 5. Transformation

[0055] 1) Thaw DH5α competent cells on ice before use; 2) Add 10 μl of recombinant product to 100 μl of competent cells, gently tap the tube wall to mix, and let stand on ice for 30 min (the transformation volume of recombinant product should not exceed 1 / 10 of the volume of competent cells). 3) After heat shock at 42℃ for 45 seconds, immediately place on ice to cool for 3 minutes; 4) Add 900 μl of LB medium (without antibiotics) and incubate at 37°C for 1 h (200-250 rpm). At the same time, preheat the LB solid medium with KN resistance in an incubator at 37°C. 5) Centrifuge at 5000 rpm for 5 min, then discard 800 μl of supernatant; 6) Resuspend the bacterial cells in the remaining culture medium and spread them evenly on the preheated plate using a sterile spreader; 7) Incubate upside down in a 37℃ incubator for 12-16 hours.

[0056] 6. Identification of recombinant products

[0057] 1) After ultraviolet disinfection of the ultra-clean bench, select 15-20 single colonies and inoculate them into 1ml LB medium (Kan resistant), and culture at 37℃ and 200-250 rpm for 4-5 hours with shaking.

[0058] 2) Use 1 μL of bacterial culture as a template and perform PCR identification using the vector primers. The reaction system and procedure are the same as in Tables 1 and 2. Positive clones are sent for sequencing verification. The sequencing primers are F: GCCTGCCGAATTAATGAGAT (as shown in SEQ ID NO:9); R: TGGCAAGTGTAGCGGTCAC (as shown in SEQ ID NO:10). Correct alignment of the sequencing results with the reference sequence indicates successful vector construction. The sequencing results are as follows (as shown in SEQ ID NO:2): 3) Strain preservation: Take 350 μl of bacterial suspension for positive strains and mix it with 60% sterile glycerol in a 1:1 ratio, and store it in a -80℃ refrigerator for long-term preservation.

[0059] Fermentation and product detection of triple recombinant strains

[0060] 1. Strain activation and induced expression

[0061] Pre-activation of positive strains: Take out the glycerol stored in the -80°C freezer, thaw it on ice, take 10 μl and streak it on solid culture medium with a sterile toothpick. After streaking, incubate at 37°C overnight. After incubation, select a single colony for expansion culture.

[0062] 1) Take 2 ml of bacterial culture for the positive bacteria in the expansion culture, centrifuge at 4000 rpm for 6 min, discard the supernatant, add 400 μl of M9 medium and gently aspirate to suspend the bacterial cells; 2) Add Kan, Chl, methionine, and CaCO3 to M9 medium, then add 200 μl of bacterial solution and incubate at 37℃ and 200 rpm until OD600 = 0.5-0.6 (generally achieved in 3-4 hours). Add IPTG and induce at 16℃ for 6 hours.

[0063] Table 6 M9 Culture Medium Formulation

[0064] 3) After induction at 16℃ for 6 hours, ferment at 26℃ and 200 rpm for 60-72 hours.

[0065] 2. Extraction and Detection of Fermentation Products

[0066] 1) Take an appropriate amount of fermentation broth into a clean centrifuge tube, centrifuge at 4000 rpm for 10 min, and collect the supernatant; 2) Add an equal volume of ethyl acetate and shake thoroughly to mix. Carefully transfer the upper organic phase into an evaporating dish. Place the evaporating dish on a 60°C water bath and evaporate it in a fume hood. After drying, redissolve it in a certain volume (2 ml) of methanol. Filter the solution through a 0.22 μm filter membrane and perform HPLC analysis.

[0067] UPLC detection ​ - ​ - ​ - ​ The resveratrol content in the fermentation products of the recombinant vector in Escherichia coli was determined. Results showed that no characteristic resveratrol peaks were detected in the fermentation products of the empty vector control strain. ​ - ​ - ​ - ​ The fermentation product of the recombinant strain showed a consistent characteristic peak at the same retention time as the resveratrol standard. ​This result directly confirms that it possesses the catalytic function to synthesize resveratrol from precursor substances. This research provides a preliminary foundation and enzyme engineering elements for the efficient biosynthesis and molecular breeding research of resveratrol.

[0068] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A DcSTS5 gene from Dracaena fragrans, characterized in that, The nucleotide sequence of the DcSTS5 gene is shown in SEQ ID NO:

1.

2. A recombinant expression vector containing the DcSTS5 gene of claim 1, characterized in that, The recombinant expression vector is pET28a-TAL-4CL-DcSTS5, which is constructed by sequentially inserting the TAL gene, 4CL gene and DcSTS5 gene into the pET28a vector; the GenBank accession number of the TAL gene is ABC886 and the GenBank accession number of the 4CL gene is U5084.

3. The recombinant expression vector according to claim 2, characterized in that, The nucleotide sequence of the recombinant expression vector is shown in SEQ ID NO:

2.

4. A recombinant bacterial strain containing the recombinant expression vector of claim 2 or 3, characterized in that, The recombinant strain is Escherichia coli BL21(DE3) or DH5α strain.

5. The use of the DcSTS5 gene of claim 1 or the recombinant expression vector of claim 2 or 3 in the preparation of resveratrol.

6. The application of the recombinant strain according to claim 4 in the fermentation production of resveratrol.

7. A method for producing resveratrol by fermentation using the recombinant strain of claim 4, characterized in that, Includes the following steps: (1) The recombinant strain was inoculated into M9 medium containing Kan and Chl resistance and cultured until the OD600 was 0.5~0.6; (2) IPTG was added to induce expression. The induction temperature was 15-17℃ and the induction time was 5-7 hours. (3) Induction followed by fermentation culture; (4) Collect the fermentation broth, extract and detect resveratrol.

8. The method according to claim 7, characterized in that, The M9 culture medium also contains methionine and CaCO3.

9. The method according to claim 7, characterized in that, The M9 culture medium is supplemented with 400-600 μL of kanamycin, 400-600 μL of chloramphenicol, 0.05-0.10 g of methionine and 1.0-1.5 g of CaCO3 per 500 mL.

10. The method according to claim 7, characterized in that, The fermentation parameters were set at 25-27℃ and 150-250 rpm for 60-72 hours.

Images