Mercury ion whole-cell biosensor and construction method and application thereof
Patent Information
- Application Number
- CN202610717148.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-05-22
- Publication Date
- 2026-08-21
AI Technical Summary
然而,目前已报道的汞生物传感器仍存在灵敏度不足、检测限达不到国家饮用水标准、特异性差、响应时间较长等问题,限制了其在实际环境检测中的推广应用
[0029] This invention uses E. coli DH5α as the chassis cell and amplifies and clones merR-P from the genomic DNA of the heavy metal tolerant strain WH-1. merT Using a mercury-responsive element (-merT) as the sensing element, green fluorescent protein (GFP) as the reporter element, and adding a signal amplification module (hrpR/S), along with the high-copy plasmid pUC57 as the sensor carrier, a microbial fluorescent sensor was fabricated. This biosensor can specifically respond to Hg within a short time. 2+ This generates fluorescence with varying RFU values, exhibiting a linear relationship within a certain concentration range, thus enabling the fluorescence detection of pollutant molecules. Compared to existing Hg...2+ The detection method utilizes a biosensor that exhibits rapid response, high specificity and sensitivity, and strong environmental adaptability, thus making it suitable for Hg detection. 2+ The testing field has broad application prospects.
Smart Images

Figure CN122609601A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of genetic engineering, synthetic biology and environmental monitoring technology, and specifically relates to a mercury ion whole-cell biosensor, its construction method and application. Background Technology
[0002] Mercury ions (Hg²⁺) are highly toxic heavy metal pollutants widely found in industrial wastewater, mine tailings, and agricultural emissions. Due to their persistence and bioaccumulation, inorganic mercury can be transformed into the more toxic methylmercury in the environment and accumulate through the food chain, ultimately posing a serious threat to ecosystems and human health, causing respiratory diseases, kidney damage, neurological disorders, and cancer. Therefore, establishing efficient, rapid, and accurate mercury ion detection technologies is of great significance for environmental protection and public health.
[0003] Currently, existing mercury ion detection technologies mainly fall into two categories: electronic detection methods and biosensing technologies. Among these, several advanced spectroscopic analysis techniques, including atomic absorption spectrometry (AAS), inductively coupled plasma atomic emission spectrometry (ICP-AES), inductively coupled plasma mass spectrometry (ICP-MS), and atomic fluorescence spectrometry (AFS), have been used to monitor heavy metal content in environmental and biological samples. While these methods possess extremely high sensitivity and specificity, they generally suffer from drawbacks such as expensive instruments, complex sample pretreatment, cumbersome operation, and the need for specialized technical personnel, making it difficult to achieve large-scale, rapid on-site detection and in-situ real-time monitoring. Against this backdrop, developing biosensing detection methods that are simple to operate, low-cost, and suitable for rapid on-site screening has become an important research direction for replacing traditional instrumental analysis.
[0004] In recent years, microbial sensors have become a research hotspot in the field of environmental heavy metal detection due to their advantages such as low cost, ease of operation, biodegradability, and the ability to perform online or in-situ analysis. These sensors typically consist of two parts: a biorecognition element and a signal conversion element. The recognition element, such as microorganisms, enzymes, or nucleic acids, is responsible for specifically binding to the target analyte; the signal conversion element transforms the recognition event into measurable optical, electrochemical, or other physical signals, thereby achieving high sensitivity and selectivity in detection. Among various biosensors, whole-cell sensors constructed using genetic engineering techniques to modify microorganisms have received widespread attention in the field of environmental heavy metal monitoring due to their clear genetic background, ease of standardized preparation, and large-scale application. In the field of mercury biosensors, existing research has utilized the mer operon as a recognition element and green fluorescent protein (GFP) or its mutants as a reporter gene to construct various detection systems. However, currently reported mercury biosensors still suffer from insufficient sensitivity, detection limits that do not meet national drinking water standards, poor specificity, and long response times, limiting their widespread application in practical environmental monitoring. How to further improve the overall detection performance of mercury ion whole-cell biosensors remains a pressing technical problem to be solved in this field.
[0005] Therefore, developing a whole-cell biosensor for mercury ions that is highly sensitive, specific, fast-responding, and adaptable to complex environmental matrices is of great practical significance and application value for the accurate detection of bioavailable mercury in the environment. Summary of the Invention
[0006] To address the aforementioned technical problems, this invention provides a method for preparing a microbial fluorescent sensor using a specific response element from the heavy metal-tolerant strain Stutzerimonasstutzeri WH-1, and its application. The microbial fluorescent sensor contains regulatory proteins, signal amplification elements, and green fluorescent protein, enabling specific linear detection of mercury metal with high sensitivity. It is suitable for environmental monitoring and has broad application prospects.
[0007] The present invention is implemented using the following technical solutions:
[0008] A recombinant plasmid, using the high copy number plasmid pUC57 as an expression vector, inserts the mercury-responsive element merR / P. merT / merT, signal amplification element hrpR / SP hrpL And the green fluorescent protein gene gfp.
[0009] As a preferred embodiment of the present invention, the green fluorescent protein gene gfp sequence is shown in SEQ ID NO.1.
[0010] As a preferred embodiment of the present invention, the mercury-responsive element merR / P merTThe nucleotide sequence of / merT is shown in SEQ ID NO.2.
[0011] As a preferred embodiment of the present invention, the signal amplification element hrpR / SP hrpL The nucleotide sequence is shown in SEQ ID NO.3.
[0012] As a further preferred embodiment of the present invention, the recombinant plasmid is mainly constructed by the following method:
[0013] (1) Using the plasmid pMD19-T-gfp containing green fluorescent protein preserved in the laboratory as a template, the gfp gene was amplified by PCR. The primer sequences are as follows: SEQ ID NO.4 and SEQ ID NO.5;
[0014] (2) Using total genomic DNA of strain S. stutzeri WH-1 as a template, the mercury-responsive element merR / P was amplified. merT / merT, primer sequences such as SEQ ID NO.6 and SEQ ID NO.7;
[0015] (3) Using the recovered merR / P merT Homologous recombination of pUC57 vector linearized with / merT, gfp, and DpnI was used to construct pUC57-merR-P merT -merT-gfp recombinant vector;
[0016] (4) hrpR / SP hrpL The pET29a(+) vector was synthesized by Genscript Biotech Inc., and then hrpR / SP was amplified by PCR. hrpL Primer sequences are as shown in SEQ ID NO.8 and SEQ ID NO.9;
[0017] (5) Using the recovered hrpR / SP hrpL and linearized pUC57-merR-P merT -merT-gfp was used for homologous recombination to obtain the recombinant plasmid pUC57-merR-P. merT -merT-hrpR / SP hrpL -gfp (sequence shown in SEQ ID NO.13).
[0018] A method for preparing a microbial fluorescent sensor for detecting mercury metal includes the following steps:
[0019] (1) The recombinant plasmid described in this invention was transformed into E. coli DH5α competent cells, and positive clones were screened on LB solid plates containing ampicillin to obtain the recombinant plasmid pUC57-merR-P.merT -merT-hrpR / SP hrpL -gfp engineered bacteria DH-TMHG;
[0020] (2) Inoculate the engineered bacteria into 4 mL of LB liquid medium containing 100 mg / L ampicillin antibiotic and incubate overnight at 37 °C;
[0021] (3) The next day, transfer 1% (v / v) to 50 mL LB medium (containing 100 mg / L ampicillin antibiotic) and incubate at 37 °C until OD. 600 The value was increased to 0.6, thus obtaining the microbial fluorescence sensor.
[0022] A microbial fluorescent sensor capable of linear response to metallic mercury was obtained according to the preparation method described in this invention.
[0023] The application of the recombinant plasmid described in this invention in mercury ion detection.
[0024] The application of the microbial fluorescence sensor described in this invention in mercury ion detection.
[0025] As a preferred embodiment of the present invention, the microbial fluorescence sensor is mixed with the test sample containing mercury ions at a volume ratio of 1:4, reacted for 3 h, and then the sample is added to a black bottom transdermal plate. The fluorescence intensity RFU value is detected using an ELISA reader.
[0026] As a preferred embodiment of the present invention, the microbial fluorescence sensor can detect pollutant molecules with a minimum concentration of 0.25 nM and a maximum concentration exceeding 2000 nM.
[0027] Furthermore, the microbial fluorescent biosensor can sense pollutant molecules of different concentrations, thereby generating fluorescence with different RFU values. The concentration of pollutant molecules is coupled with the fluorescence signal RFU value to achieve the purpose of real-time monitoring of pollutant molecules.
[0028] Beneficial effects
[0029] This invention uses E. coli DH5α as the chassis cell and amplifies and clones merR-P from the genomic DNA of the heavy metal tolerant strain WH-1. merT Using a mercury-responsive element (-merT) as the sensing element, green fluorescent protein (GFP) as the reporter element, and adding a signal amplification module (hrpR / S), along with the high-copy plasmid pUC57 as the sensor carrier, a microbial fluorescent sensor was fabricated. This biosensor can specifically respond to Hg within a short time. 2+ This generates fluorescence with varying RFU values, exhibiting a linear relationship within a certain concentration range, thus enabling the fluorescence detection of pollutant molecules. Compared to existing Hg...2+ The detection method utilizes a biosensor that exhibits rapid response, high specificity and sensitivity, and strong environmental adaptability, thus making it suitable for Hg detection. 2+ The testing field has broad application prospects. Attached Figure Description
[0030] Figure 1 plasmid pUC57-merR-P merT -merT-hrpR / SP hrpL -gfp build process.
[0031] Figure 2 RFU of sensors DH-TMG and DH-TMHG varies with Hg 2+ Changes in concentration.
[0032] Figure 3 Time-fluorescence response of the DH-TMHG sensor.
[0033] Figure 4 The fluorescence intensity of the DH-TMHG sensor after 3 hours and its relationship with Hg 2+ The linear relationship between the logarithmic concentrations.
[0034] Figure 5 Substrate specificity evaluation of the DH-TMHG sensor.
[0035] Figure 6 : The effect of the DH-TMHG sensor on Hg at different pH values 2+ The response signal. Detailed Implementation
[0036] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available. The substantive content of the present invention is described in detail below with reference to embodiments, but this does not limit the scope of protection of the present invention.
[0037] Example 1. Recombinant plasmid pUC57-merR-P merT Build -merT-gfp
[0038] like Figure 1 As shown, the high copy number plasmid pUC57 was used as the expression vector, green fluorescent protein GFP was used as the reporter element, and mercury-responsive element merR / P was used. merT / merT was used as the sensing and control element to construct the recombinant plasmid pUC57-merR-P mer -merT-gfp.
[0039] 1. gfp and merR / P merT Amplification of the target fragment using / merT
[0040] The gfp gene was amplified by polymerase chain reaction (PCR) using the plasmid pMD19-T-gfp containing the green fluorescent protein gene, which was preserved in the laboratory, as a template. The upstream primer sequence for PCR amplification is shown in SEQ ID NO.4, and the downstream primer sequence is shown in SEQ ID NO.5.
[0041] The total volume of the PCR reaction system was 50 μL, and the components and their contents are shown in Table 1.
[0042] Using total genomic DNA from *Stutzerimonas stutzeri* WH-1 as a template, the mercury-responsive element merR-P was amplified by PCR. merT -merT. The upstream primer sequence for PCR amplification is shown in SEQ ID NO.6, and the downstream primer sequence is shown in SEQ ID NO.7.
[0043] The total volume of the PCR reaction system was 50 μL, and the components and their contents are shown in Table 1.
[0044] Table 1 PCR reaction system
[0045] DNA template 1 F 2 R 2 2 × Proofast® Master Mix 25 ddH2O 20
[0046] The PCR reaction program was as follows: 95 °C pre-denaturation for 3 min, 95 °C denaturation for 15 s, 56 °C annealing for 15 s, 72 °C extension for 1 min, for a total of 32 cycles, and a final extension at 72 °C for 5 min.
[0047] 2. Ligation, transformation, and positive clone screening of the target fragment.
[0048] PCR products were purified using a gel extraction and purification kit (Vazyme) to recover the gfp fragments, and the merR / P ratio was used. merT The / merT fragment underwent homologous recombination with the linearized vector pUC57. The total volume of the homologous recombination reaction system was 20 μL, and the reaction system is shown in Table 2.
[0049] Table 2 Homologous recombination reaction system
[0050] <![CDATA[merR-P merT -merT fragment]]> 3 gfp fragment 3 pUC57 linearized carrier 4 2×Ezmax® Universal CloneMix 10
[0051] The above reaction system was reacted at 37 °C for 30 min. After the reaction was completed, the product was immediately transferred to an ice bath and allowed to stand for 2 min to terminate the enzymatic reaction, yielding the recombinant ligation product.
[0052] 20 μL of the ligation product was added to 50 μL of E. coli DH5α competent cells, plated on LB agar containing 100 mg / L ampicillin, and incubated upside down at 37 °C for 12 h. Positive clones were screened by colony PCR, and the recombinant plasmid pUC57-merR-P was extracted from the positive clones. merT The merT-gfp sequence (as shown in SEQ ID NO.12) was sent to Youkang Biotechnology Co., Ltd. for sequencing. Sequencing results showed that the merR-P in the obtained recombinant plasmid... merT The -merT and gfp fragments have been correctly inserted into the pUC57 vector, and the sequences are correct, thus the recombinant plasmid pUC57-merR-P has been successfully constructed. merT -merT-gfp. This recombinant plasmid was transformed into E. coli DH5α, thereby obtaining the engineered strain DH-TMG.
[0053] Example 2: Construction of the mercury biosensor DH-TMHG
[0054] In recombinant plasmid pUC57-merR-P merT Based on the -merT-gfp, a signal amplification module hrpR / SP is further added. hrpL Constructing the recombinant plasmid pUC57-merR-P merT -merT-hrpR / SP hrpL -gfp, to obtain the optimized mercury biosensor DH-TMHG.
[0055] hrpR / SP hrpL The gene fragment pET29a(+) was synthesized by Genscript Biotech Inc., and its nucleotide sequence is shown in SEQ ID NO.3. The plasmid pET29a(+)-hrpR / SP was used. hrpL Amplification of hrpR / SP template hrpL The fragment, with primers SEQ ID NO.8 and SEQ ID NO.9, was used with plasmid pUC57-merR-P. merT -merT-gfp was used as a template for linearizing and amplifying the full plasmid sequence. The primers were SEQ ID NO.10 and SEQ ID NO.11. The PCR reaction system and procedure were the same as in Example 1.
[0056] The PCR products were treated with Dpn I enzyme to digest the residual template plasmid, and the linearized vector fragment was recovered and combined with the recovered hrpR / SP. hrpL The amplified fragments were subjected to homologous recombination. The total volume of the homologous recombination reaction system was 20 μL, and the reaction system is shown in Table 3.
[0057] Table 3 Homologous recombination reaction system
[0058] <![CDATA[hrpR / S-P hrpL [Excerpt] 5 <![CDATA[pUC57-merR-P merT -merT-gfp linearized vector]]> 5 2×Ezmax® Universal CloneMix 10
[0059] The above reaction system was incubated at 37 °C for 30 min. After the reaction, the product was immediately transferred to an ice bath and allowed to stand for 2 min to terminate the enzymatic reaction, yielding the recombinant ligation product, which was then transformed into E. coli DH5α. Single colonies were picked for colony PCR screening to identify positive clones. The recombinant plasmid was extracted from the positive clones and sent to Youkang Biotechnology Co., Ltd. for sequencing. The correctly sequenced recombinant plasmid pUC57-merR-P was confirmed. merT -merT-hrpR / SP hrpL -gfp was transformed into E. coli DH5α, thereby obtaining the engineered strain DH-TMHG.
[0060] Example 3: Performance Testing of a Mercury Biosensor
[0061] 1. Activation and culture of the sensor
[0062] (1) Select single colonies of biosensors DH-TMG and DH-TMHG and inoculate them into 4 mL of LB liquid medium (containing 100 mg / L ampicillin antibiotic) and incubate overnight at 37 °C.
[0063] (2) The next day, inoculate 1% (v / v) into 50 mL of LB liquid medium (containing 100 mg / L ampicillin antibiotic) and incubate at 37°C for about 2-3 h until the bacterial culture OD 600 Once the concentration reaches 0.6, the bacterial solution for the sensor to be tested is obtained.
[0064] 2. Dose-dependent effects of biosensors
[0065] (1) The above bacterial culture was inoculated at an inoculum of 20% (v / v) to different final concentrations of Hg. 2+ In 20 mL of LB liquid culture medium, Hg 2+ The final concentrations were 0, 0.5, 1, 10, 50, 100, 500, 1000 and 2000 nM, with the 0 nM treatment group serving as the negative control group. The mixtures were cultured at 37 ℃ and 180 rpm for 3 h with shaking.
[0066] (2) Take 1 mL of the above culture medium, centrifuge at 12000 rpm for 1 min, and discard the supernatant; add 1 mL of sterile water, blow and centrifuge, and discard the supernatant; wash twice as described above, and then resuspend the cells in 1 mL of sterile water.
[0067] (3) Take 200 μL of the resuspension into a 96-well plate with a black base, and measure the fluorescence value (FU) and absorbance (OD) of the sample using an ELISA reader. 600 The excitation wavelength is 488 nm, and the emission wavelength is 525 nm. The relative fluorescence value (FU / OD600) is calculated using the formula RFU = FU / OD600 - FU(ck) / OD600(ck). 600 ), where (ck) represents the experimental group when the concentration of the sample to be tested is 0.
[0068] 3. Response time detection of biosensors
[0069] (1) Inoculate the biosensor bacterial solution at an inoculum of 20% (v / v) into areas containing different Hg. 2+ In 20 mL of LB liquid medium at a concentration of Hg 2+ Final concentrations were set at 0, 0.1, 0.25, 0.5, 1, 10, 50, 100, 500, 1000, and 2000 nM, with Hg not added. 2+ LB liquid medium was used as a control; the culture was induced at 37 ℃ and 180 rpm for 0.5 h, 3 h and 6 h respectively.
[0070] (2) Take 1 mL of bacterial suspension and centrifuge at 12000 rpm for 1 min, discarding the supernatant; add 1 mL of sterile water, vortex, centrifuge, and discard the supernatant; wash twice as described above, then resuspend the bacterial cells in 1 mL of sterile water. Add 200 μL of the resuspended solution to a 96-well plate with a black base, and measure the fluorescence value (FU) and absorbance (OD) of the sample using an ELISA reader. 600 The excitation wavelength for detection was 488 nm, and the emission wavelength was 525 nm.
[0071] 4. Substrate-specific detection by biosensors
[0072] (1) The biosensor bacterial culture was inoculated at a rate of 20% (v / v) into 20 mL of LB liquid medium containing different metal ions, namely Hg. 2+ Ni 2+ Zn 2+ Cr 3+ Cu 2+ Mn 2+ Fe 3+ Co 2+ K + Mg 2+ The final concentration of each metal ion was 1000 nM; the cells were induced and cultured at 37 ℃ and 180 rpm for 3 h with shaking.
[0073] (2) After induction, take 1 mL of bacterial culture, centrifuge at 12000 rpm for 1 min, discard the supernatant, add 1 mL of sterile water, mix and centrifuge again, discard the supernatant; wash twice as described above, resuspend in 1 mL of sterile water, take 200 μL and add to a 96-well plate with a black base, and measure the fluorescence value (FU) and absorbance (OD) of the sample using an ELISA reader (excitation wavelength 488 nm, emission wavelength 525 nm). 600 ).
[0074] 5. The effect of pH on the response of biosensors
[0075] (1) Based on LB liquid medium, the pH of the medium was adjusted to 5, 6, 7, 8, 9 and 10 by adding 12 M hydrochloric acid and 10 M sodium hydroxide, respectively.
[0076] (2) Culture the biosensor DH-TMHG cells to OD 600 When the pH reaches 0.6-0.8, transfer the culture to LB medium at different pH conditions at an inoculum rate of 20% (v / v). Add Hg. 2+ , so that each group of Hg 2+ The final concentration was 1000 nM; it was induced and cultured in a shaker at 37 ℃ for 3 hours.
[0077] (3) After induction, the bacterial cells were collected by centrifugation at 12,000 rpm for 1 min, washed with sterile water, and the relative fluorescence intensity (FU / OD) of each group was measured using an ELISA reader (excitation wavelength 488 nm, emission wavelength 525 nm). 600 ).
[0078] Example 4: Biosensor Detection Results and Their Application in Real-World Environmental Water Sample Detection
[0079] A mercury standard solution was prepared using surface water (0-10 cm below the water surface) instead of high-purity deionized water to investigate the effect of actual water composition on Hg in sensor cells. 2+ The effect of response characteristics was investigated, with each group comprising three parallel samples. Sensor cells were cultured to the logarithmic growth phase and seeded at a 20% (v / v) inoculation rate into 20 mL of solutions containing different final concentrations of Hg. 2+ In LB liquid medium, Hg 2+The concentrations were 0, 1, 5, 10, 50, and 100 nM; the concentration system was constructed based on a 1 mg / mL mercuric nitrate standard stock solution serially diluted with environmental water samples. The cells were then induced and cultured at 37 ℃ and 180 rpm for 3 hours. After induction, the cells were collected by centrifugation at 12000 rpm for 1 min, washed twice with sterile water, and resuspended. The resuspended solution was added to a black 96-well plate, and the fluorescence signal was measured using a microplate reader. The excitation wavelength was 488 nm, and the emission wavelength was 525 nm. The plate was prepared without added Hg. 2+ The negative control was used to correct the background signal.
[0080] The results are as follows Figure 2 As shown, the DH-TMG sensor constructed in this invention operates at 5 nM Hg. 2+ It can trigger a fluorescence signal, achieving the strongest fluorescence response at a concentration of 1000 nM. A signal amplification module hrpR / SP is incorporated. hrpL The DH-TMHG sensor exhibits an order-of-magnitude improvement in fluorescence response intensity and a wider linear range for concentration gradient response. Furthermore, it demonstrates superior performance in the 0-2000 nM Hg range. 2+ Under the induction effect of Hg, its RFU value shows a pollutant concentration dependence. 2+ The higher the concentration, the higher the RFU value, indicating that the hrpR / SP hrpL The cascaded amplification and control mechanism optimizes sensor performance. Figure 3 It can be seen that the DH-TMHG sensor can achieve 0.5 nM Hg in 0.5 h. 2+ A fluorescence response was generated upon induction, and the fluorescence intensity increased with prolonged induction time. After 3 hours of induction, the sensor's detection limit decreased to 0.25 nM, and within the concentration range of 1-1000 nM, the relative fluorescence intensity (RFU) of the sensor was similar to that of Hg. 2+ The logarithmic concentration shows a linear relationship, such as... Figure 4 As shown. Based on response time and fluorescence intensity, a response time of 3 hours was selected for the biosensor. Figure 5 and Figure 6 This indicates that the DH-TMHG sensor can specifically target Hg. 2+ The strain responds to and expresses significant fluorescent signals, and maintains its pollutant responsiveness over a relatively wide pH range.
[0081] A mercury solution was prepared using pond water samples (pH 6) for biosensor response detection. The results are shown in Table 4. Hg was calculated based on the standard curve of the fluorescence response values. 2+ Concentration (based on the standard curve of RFU versus Hg²⁺ concentration established in Example 3) Figure 4(Calculation) The detection value of the DH-TMHG sensor is almost consistent with the mercury ion concentration in the actual environmental water sample, indicating that the sensor can be used as a reliable tool for rapid on-site detection of trace mercury pollution in actual water bodies.
[0082] Table 4. Hg in ambient water assessed by the DH-TMHG sensor. 2+ content
[0083] 1 1.77±0.03 1.07±0.13 5 2.29±0.05 4.63±0.91 10 2.65±0.03 9.91±1.22 50 3.28±0.02 50.32±3.12 100 3.55±0.03 100.78±12.59
[0084] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions claimed by the present invention.
[0085] Sequence List:
[0086] gfp nucleotide sequence (SEQ ID NO.1)
[0087] ATGAGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTCAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCACATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATAA
[0088] merR / P merT / merT nucleotide sequence (SEQ ID NO. ②)
[0089] It should be noted that in the original text, "SEQ ID NO.2" is likely a reference to a specific sequence identifier in a biological context. Here, it is translated as "SEQ ID NO. ②" for consistency in the translation. If there is a more specific or standard way to represent such sequence identifiers in English in the relevant field, it may need to be adjusted accordingly.TTACTCTCTGATCAGTGCCTCGATGATCGGGCAGATCGTTCCGCCGTCTCCCGCATCACATTGCTGCACCAGTTCGCCTAACAGTTGCTGCATGACGACCAAGTCGGCCATCTTCTGCTCGATCAACGCGAGCTTGCGTGCAGCCCGTGCTCGCGTTTCGGCACAGGCGCACGACTCATCCAGCGTCAGCAGTCCACCGACTTCCGAGAGCGTGAAACCCAGCGCCTGAGCCCGCTTGATGAAACGCAGTCGCTTCACCATGTCCACCGGATAGCGCCGATGGCCACCCAAGGGTTTGGCTGGTTCATCCAGCAGCCCGCGTCGCTGGTAGTAGCGGATCGTCTCGACGTTCACCCCGGCGGCGTCTGCCAGCTTGCCAATGGTCAGCTCTGTGGCCATCACTTTCTCCTTGATTCCGTACTTTGGTACGGAGTTTAGAATAGCACCTAGGCAATCAGGCTCAGGAGATGGGAATGGGGATGCAACTCACCGGGAAAGGCTCGCTGGTCGCGAGTTCGCTGACCGCCATCGGTGCGTCGGTGTGCTGTGTCGGGCCACTGGTGCTGTTGGCACTCGGTGTCGGCGGTACGTGGGTGGGCGCTCTGACCATGATGGAGCCACTACGCCCCCTCTTCATCGGGTTGACTCTACTGTTCCTGGGATTGGCATTCCGCAAGCTCTACCTGGTGCCACAGGTTTGTACGCCAGGTACACCCTGCGCCGATCCGCGCACGCTCGTGCGACAGCGACTCGTGTTCTGGATCGTCAGCGTGCTGCTGCTCGGCCTATTGGCCGTGCCGTGGCTCGCCCCGCTGTTCTACTGA
[0090] hrpR / S-P hrpL Nucleotide sequence (SEQ ID NO.3)
[0091]
[0092] GFP amplification upstream primer (SEQ ID No. 4)
[0093] F:5'-ATGAGTAAAGGAGAAGAACTTTTCACTG-3'
[0094] downstream primers for gfp amplification (SEQ ID No. 5)
[0095] R: 5'-TTATTTGTATAGTTCATCCATGCCATG-3'
[0096] merR / P merT / merT amplification of the upstream primer (SEQ ID No. 6)
[0097] F:5'-gtgaattcgagctcggtaccTTACTCTCTGATCAGTGCCTCGAT-3'
[0098] merR / P merT / merT amplification of downstream primers (SEQ ID No. 7)
[0099] R:5'-ctcatTCAGTAGAACAGCGGGGCG-3'
[0100] hrpR / SP hrpL Amplification of the upstream primer (SEQ ID No. 8)
[0101] F:5'-tcgccccgctgttctactgaATGAGTACAGGCATCGATAAGGACG-3'
[0102] hrpR / SP hrpL Amplification of downstream primer (SEQ ID No. 9)
[0103] R: 5'-ctcctttactcatCTAGTATTTCTCCTCTTCTCTAGAGTACAAG-3'
[0104] pUC57-merR-P merT -merT-gfp amplification upstream primer (SEQ ID No. 10)
[0105] F:5'-AAGCTTGGCGTAATCATGGTCA-3'
[0106] pUC57-merR-P merT-merT-gfp amplification downstream primers (SEQ ID No. 11)
[0107] R: 5'-GGTACCGAGCTCGAATTCACTG-3'
[0108] pUC57-merR-P merT -merT-gfp recombinant plasmid sequence (SEQ ID No. 12)
[0109]
[0110] pUC57-merR-P merT -merT-hrpR / SP hrpL -gfp recombinant plasmid sequence (SEQ ID No. 13)
[0111]
Claims
1. A recombinant plasmid, characterized in that... Using the high copy number plasmid pUC57 as an expression vector, a mercury-responsive element, a signal amplification element, and a fluorescent reporter gene were inserted.
2. The recombinant plasmid according to claim 1, characterized in that, The fluorescent reporter gene is the green fluorescent protein gene gfp, the sequence of which is shown in SEQ ID NO.1; the mercury-responsive element is merR / P. merT / merT, whose nucleotide sequence is shown in SEQ ID NO.2; the signal amplification element is hrpR / SP. hrpL Its nucleotide sequence is shown in SEQ ID NO.
3.
3. A microbial fluorescent sensor containing the recombinant plasmid as described in any one of claims 1 or 2.
4. The method for constructing the recombinant plasmid according to any one of claims 1 or 2, characterized in that, Includes the following steps: (1) Using the plasmid pMD19-T-gfp containing green fluorescent protein preserved in the laboratory as a template, the gfp gene was amplified by PCR. The primer sequences are shown in SEQ ID NO.4 and SEQ ID NO.
5. (2) Using total genomic DNA of strain S. stutzeri WH-1 as a template, the mercury-responsive element merR / P was amplified. merT / merT, primer sequences are shown in SEQ ID NO.6 and SEQ ID NO.7; (3) Using the recovered merR / P merT Homologous recombination of the / merT fragment, gfp fragment, and linearized pUC57 vector was used to construct pUC57-merR-P. merT -merT-gfp recombinant vector; (4) Amplification of hrpR / SP by PCR hrpL The primer sequences are shown in SEQ ID NO.8 and SEQ ID NO.9; (5) Using the recovered hrpR / SP hrpL Fragments and linearization of pUC57-merR-P merT -merT-gfp was used for homologous recombination to obtain the recombinant plasmid pUC57-merR-P. merT -merT-hrpR / SP hrpL -gfp.
5. A method for preparing a mercury ion microbial fluorescence sensor, characterized in that... Includes the following steps: (1) The recombinant plasmid according to any one of claims 1 or 2 is transformed into E. coli DH5α competent cells, and positive clones are screened on LB solid plates containing ampicillin to obtain the recombinant plasmid pUC57-merR-P. merT -merT-hrpR / SP hrpL -gfp engineered bacteria DH-TMHG; (2) Inoculate the engineered bacteria into 4 mL of LB liquid medium containing 100 mg / L ampicillin antibiotic and incubate overnight at 37 °C; (3) The next day, transfer 1% (v / v) to 50 mL LB medium (containing 100 mg / L ampicillin antibiotic) and incubate at 37 °C until OD. 600 The value was increased to 0.6, thus obtaining the microbial fluorescence sensor.
6. The application of the recombinant plasmid as described in any one of claims 1 or 2 in the detection of mercury ions.
7. The application of the microbial fluorescence sensor as described in claim 3 in mercury ion detection.
8. The application according to claim 7, characterized in that, The microbial fluorescence sensor was mixed with the mercury-containing sample at a volume ratio of 1:4 and reacted for 3 h. The sample was then added to a black-bottomed microplate and the fluorescence intensity RFU value was detected using a microplate reader.
9. The application according to claim 7, characterized in that, The microbial fluorescence sensor exhibits a linear response in the pollutant concentration range of 1-1000 nM.