Gram-negative bacteria surface display system, construction method and application thereof

Abstract

The present application belongs to the field of synthetic biology and genetic engineering technology, and particularly relates to a gram-negative bacteria surface display system based on Shewanella oneidensis endogenous sortase A (SO2196), and a construction method and application thereof. The present application utilizes the specific recognition and covalent cleavage transpeptidation function of Shewanella oneidensis endogenous sortase to the atypical motif LPQTS, and through a modular assembly strategy, a modular fusion expression vector is constructed, so as to realize the directional covalent anchoring and active display of exogenous proteins on the cell surface of gram-negative bacteria such as Escherichia coli and Shewanella. The present application realizes covalent anchoring by means of sortase transpeptidation reaction, and the exogenous proteins are not easy to fall off from the cell surface, the molecular weight of the displayable exogenous proteins is large, the signal peptide, the exogenous protein and the sortase signal all adopt independent modules, different functional proteins can be replaced, and the present application has strong versatility.

Description

Technical Field

[0001] This invention belongs to the fields of synthetic biology and genetic engineering technology, specifically relating to a Gram-negative bacteria surface display system based on the endogenous sorting enzyme Sortase A (SO2196) of Shewanella oneidensis, its construction method and application. Background Technology

[0002] Bacterial surface display (BSD) is a genetic engineering method that fuses exogenous target proteins (or peptides) with bacterial anchoring motifs, enabling their expression and targeted immobilization on the bacterial cell surface. This technology has undergone long-term development and has formed a mature application system. Compared to yeast and phage display systems, BSD systems have shorter culture cycles, lower costs, simpler genetic modification processes, and are easily coupled with high-throughput screening and biochemical detection technologies, making them particularly suitable for large-scale protein expression, mutant library construction, and rapid activity screening.

[0003] To date, surface display systems mediated by Gram-positive bacterial sorting enzymes (Sortase A) have been the most extensively studied and most maturely applied. These enzymes specifically recognize the conserved LPXTG motif at the C-terminus of substrates, catalyzing a transpeptidation reaction via a triplet to firmly anchor the target protein to the peptidoglycan layer of the bacterial cell wall via covalent bonds, exhibiting excellent spatial structural stability and tolerance to complex conformations. However, due to the fundamental differences in cell wall and outer membrane structures between Gram-negative and Gram-positive bacteria, these positive bacterial sorting enzyme systems cannot be directly applied to Gram-negative bacterial hosts such as *Escherichia coli* and *Shewanella*.

[0004] In recent years, researchers have developed various bacterial surface display systems targeting different Gram-negative bacterial chassis strains, membrane anchoring carriers, and display elements. However, most existing Gram-negative bacterial display systems rely on traditional carriers such as ice nucleoproteins (INPs), outer membrane proteins (e.g., OmpA, OmpC), and lipoproteins. Expression of these elements can easily lead to spatial conformational disorder, making it particularly difficult to carry large exogenous proteins. In addition, traditional display methods are mostly non-covalent, making it easy for exogenous proteins to detach from the bacterial surface. This results in problems such as low display efficiency, poor operational stability, and a narrow range of applicable proteins, limiting the large-scale application of bacterial surface display technology in fields such as whole-cell catalysis, environmental remediation, and protein screening.

[0005] Recent genomic studies have discovered a special class of sorting enzyme homologs (also known as marine sorting enzymes) in the genomes of some Gram-negative bacteria, such as Shewanella. Their catalytic core retains the conserved His-Cys-Arg catalytic triplet from the sorting enzyme superfamily, but they recognize atypical LPQTS motifs for cleavage. Through enzymatic transpeptidation, they covalently link exogenous proteins to the bacterial cell wall, a feature unique to Gram-negative bacteria. Therefore, Shewanella onenaeida endogenous sorting enzymes are ideal tools for constructing high-performance Gram-negative bacterial surface display systems. Summary of the Invention

[0006] This invention aims to overcome the shortcomings of existing Gram-negative bacteria surface display systems, such as low display efficiency, difficulty in adapting to large protein molecules, easy detachment of non-covalent anchors, and heavy metabolic burden on the host. It provides a Gram-negative bacteria surface display system and its construction method, and applies it to whole-cell catalysis, environmental bioremediation, microbial fuel cells, and protein screening.

[0007] To achieve the above-mentioned objectives, the present invention is implemented through the following technical solution: A Gram-negative bacteria surface display system, characterized in that it comprises: Gram-negative bacterial sorting enzyme, which is an enzyme composed of the amino acid sequence of sorting enzyme Sortase A derived from Shewanella onnae; or an enzyme composed of an amino acid sequence having at least 90% homology and / or identity with the amino acid sequence of sorting enzyme Sortase A and having sorting enzyme activity; or a mutant enzyme having sorting enzyme activity obtained by substitution, deletion or addition of one or more amino acid residues in the amino acid sequence of sorting enzyme Sortase A; capable of specifically recognizing the LPQTS motif and catalyzing peptide bond cleavage transpeptidation reaction; The sorting signal element includes an N-terminal signal peptide and a C-terminal cell wall sorting signal, wherein the C-terminal cell wall sorting signal carries the LPQTS motif. A recombinant expression vector containing a modular fusion expression cassette, wherein the modular fusion expression cassette is sequentially connected from the 5' end to the 3' end with a nucleotide sequence encoding the N-terminal signal peptide, a nucleotide sequence encoding the exogenous target protein, and a nucleotide sequence encoding the C-terminal cell wall sorting signal; The fusion protein expressed by the modular fusion expression cassette is covalently anchored to the surface of Gram-negative bacterial cells by the catalysis of the Gram-negative bacterial sorting enzyme.

[0008] This invention designs a fusion expression cassette containing an N-terminal signal peptide and a C-terminal cell wall sorting signal carrying the LPQTS motif. This allows the newly synthesized fusion protein to smoothly cross the inner membrane along the host's inherent Sec pathway, while the C-terminal sorting signal, upon reaching the periplasmic side, is precisely exposed to the action range of the sorting enzyme (Sortase A). At this point, the Gram-negative bacterial sorting enzyme specifically recognizes the LPQTS motif, enabling the transpeptide reaction to occur efficiently, ultimately firmly attaching the target protein to the cell surface via covalent bonds. This covalent anchoring mode driven by Gram-negative bacterial sorting enzyme fundamentally changes the binding properties of the displayed protein to the bacterial surface. Compared to traditional non-covalent adsorption or hydrophobic interactions, its elution resistance and mechanical stability are significantly improved, and the target protein maintains a high retention rate even in multiple batches of repeated reactions.

[0009] The modular design of the fusion expression cassette further enhances the versatility of the surface display system. Target proteins from different sources can share the same mature surface display pathway by following the same reading frame insertion, significantly reducing the construction cost and trial-and-error cycle for developing new targets. When the fusion expression cassette is introduced into Shewanella, the native host of the sorting enzyme, the target protein can be displayed on the surface of Shewanella bacteria. When the fusion expression cassette and the sorting enzyme are co-introduced into Escherichia coli or other non-native hosts of the sorting enzyme, the target protein can be displayed on the surface of other Gram-negative bacteria.

[0010] Most importantly, the implementation of the surface display system of the present invention does not rely on destructive modification of the outer membrane pore protein or lipopolysaccharide structure. Instead, it achieves the orderly arrangement of target proteins on the bacterial surface by finely controlling the natural cleavage sites of endogenous sorting enzymes. This not only preserves the original barrier function and biosafety of Gram-negative bacteria, but also allows the displayed proteins to be exposed to the aqueous environment in a state closer to their native conformation, thus better maintaining their biological activity.

[0011] Preferably, the amino acid sequence of the Gram-negative bacterial sorting enzyme (SO2196, UniProt ID: Q8EF09) contains a conserved His-Cys-Arg catalytic triplet.

[0012] Preferably, the amino acid sequence of the Gram-negative bacterial sorting enzyme is as shown in SEQ ID NO.2, or is encoded by a gene with a nucleotide sequence as shown in SEQ ID NO.1.

[0013] The Gram-negative bacterial sorting enzyme SO2196 is derived from *S. oneidensis* MR-1, and its spatial conformation possesses characteristics derived from His... 126 -Cys 184 -Arg 197The catalytic triplet can site-specifically recognize and cleave the peptide bond between threonine and serine in the aforementioned LPQTS motif.

[0014] Preferably, the sorting signal element is derived from the natural substrate protein SO2195 (UniProt ID: Q8EF10) of the sorting enzyme from *Schizophyllum ovale*. The N-terminal signal peptide is a transmembrane signal peptide that guides the transmembrane secretion of the fusion protein. The C-terminal cell wall sorting signal (CWSS) also includes a hydrophobic transmembrane region and a positively charged tail.

[0015] Preferably, the amino acid sequence of the C-terminal cell wall sorting signal is as shown in SEQ ID NO.4, or is encoded by a gene with a nucleotide sequence as shown in SEQ ID NO.3.

[0016] Preferably, the recombinant expression vector uses the pBAD plasmid as the expression backbone, and the modular fusion expression cassette is induced by the arabinose-inducible promoter P. BAD Transcriptional regulation.

[0017] As a further preferred embodiment, the modular fusion expression cassette uses a kanamycin resistance gene as a screening marker.

[0018] As a further preferred embodiment, the recombinant expression vector comprises a gene fragment of the N-terminal signal peptide (SP) and a gene fragment of the C-terminal cell wall sorting signal (CWSS) in the substrate protein SO2195 (the natural substrate of the sorting enzyme), as well as the gene sequence encoding the target protein to be displayed.

[0019] The method for constructing a Gram-negative bacteria surface display system as described above includes the following steps: Obtain gene fragments encoding the sorting enzyme and sorting signal element of the Gram-negative bacteria, as well as gene fragments encoding the exogenous target protein; The gene fragments were assembled sequentially into the expression vector backbone to obtain the recombinant expression vector. The recombinant expression vector was introduced into a Gram-negative bacterial host to obtain surface-displaying recombinant engineered bacteria; Specifically, when the Gram-negative bacterial host is a non-sorting enzyme native host such as Escherichia coli, the recombinant expression vector simultaneously assembles the sorting enzyme gene fragment; when the Gram-negative bacterial host is a sorting enzyme native host such as Shewanella, the assembly of the sorting enzyme gene fragment is omitted from the recombinant expression vector.

[0020] As a further preferred embodiment, a method for constructing a Gram-negative bacteria surface display system includes the following steps: S.1: Using S. oneidensis MR-1 genomic DNA as a template, gene fragments encoding the endogenous sorting enzyme SO2196, the N-terminal signal peptide (SP) of the substrate protein SO2195, and the C-terminal cell wall sorting signal (CWSS) gene fragment, as well as the exogenous target protein, were obtained by PCR amplification using artificial primers. S.2: The expression vector backbone was linearized using reverse PCR technology. The gene fragments of the N-terminal signal peptide of the substrate protein SO2195, the exogenous target protein, the C-terminal cell wall sorting signal, and the sorting enzyme SO2196 were inserted into the linearized vector backbone in a modular, forward tandem manner to construct the recombinant expression vector. S.3: The recombinant expression vector was transformed into Escherichia coli, and the recombinant engineered bacteria with the correct surface display phenotype were obtained by screening with resistance plates.

[0021] As a further preferred embodiment, a method for constructing a Gram-negative bacteria surface display system includes the following steps: S.1: Using S. oneidensis MR-1 genomic DNA as a template, gene fragments of the N-terminal signal peptide (SP) and C-terminal cell wall sorting signal (CWSS) of the substrate protein SO2195, as well as gene fragments of the exogenous target protein, were obtained by artificial primer PCR amplification. S.2: The expression vector backbone was linearized using reverse PCR technology. The gene fragments of the N-terminal signal peptide of the substrate protein SO2195, the exogenous target protein, and the C-terminal cell wall sorting signal were inserted into the linearized vector backbone in a modular, forward tandem manner using multi-fragment homologous recombination seamless cloning technology to construct the recombinant expression vector. S.3: The recombinant expression vector was transformed into the Escherichia coli WM3064 donor strain, and then directionally introduced into the Shewanella recipient strain using the conjugation transfer method. After reverse screening with resistance plates, the surface-displaying recombinant engineered bacteria with the correct phenotype were obtained.

[0022] Preferably, the assembly employs a multi-fragment homologous recombination seamless cloning technique; the introduction employs a conjugation transfer method or a transformation method.

[0023] Preferably, the Gram-negative bacterial host is Escherichia coli or Shewanella.

[0024] The above-described Gram-negative bacteria surface display system has applications in whole-cell catalysis, environmental bioremediation, microbial fuel cells, protein mutant library construction, or high-throughput screening of target proteins.

[0025] An efficiency verification method for cell surface display using a Gram-negative bacteria surface display system as described above includes a spatial partitioning detection step: Collect the bacterial culture after induced expression, and separate the extracellular supernatant sample, the undamaged bacterial cell sample, and the damaged supernatant sample; The biocatalytic kinetic absorbance values ​​of exogenous reporter proteins in three types of samples were measured to evaluate the efficiency of the surface display system.

[0026] Preferably, the extracellular supernatant sample is used to detect the level of target protein loss and shedding from the cell surface; the unruptured bacterial cell sample is used to detect the catalytic activity of the target protein displayed on the surface using a macromolecular chromogenic substrate that is difficult to penetrate the cell membrane; and the ruptured supernatant sample is used to detect the total expression level of the target protein inside the host using the same substrate.

[0027] As a further preferred embodiment, an efficiency verification method for cell surface display using a Gram-negative bacteria surface display system as described above includes a spatial partitioning detection step: (a) The bacterial culture after arabinose-induced expression was centrifuged at low temperature and low speed, and the clear supernatant after centrifugation was collected and labeled as "extracellular supernatant sample" to quantitatively characterize the level of loss and shedding of target protein from the cell surface; (b) The bacterial cell pellet obtained by centrifugation was washed twice with isotonic PBS buffer and then the bacterial cells were resuspended with PBS as “unruptured bacterial cell sample”. The catalytic activity of the target protein displayed on the surface was measured by taking advantage of the physical barrier property that the macromolecular chromogenic substrate cannot permeate the membrane. (c) Take an equal amount of bacterial cell precipitate, sonicate it in an ice bath, centrifuge it, collect the lysate supernatant by centrifugation, and label it as "cell lysis supernatant sample" to characterize the total expression level of the target protein in the host. (d) The biocatalytic kinetic absorbance values ​​of the exogenous reporter proteins in the above three groups of samples were measured to evaluate the efficiency of the surface display system.

[0028] Therefore, the present invention has the following beneficial effects: (1) This invention utilizes the specific recognition and covalent cleavage transpeptidation function of the endogenous sorting enzyme SO2196 of Shewanella on atypical motifs LPQTS. Through a modular assembly strategy, a modular fusion expression vector is constructed to realize the orientation, covalent anchoring and activity display of exogenous proteins on the cell surface of Gram-negative bacteria such as Escherichia coli and Shewanella. (2) When the present invention is applied to Gram-negative bacteria such as Escherichia coli, the sorting enzyme element can be introduced through the carrier to exert the catalytic effect; when applied to Shewanella, it can rely on the natural sorting enzyme and sorting signal of the bacterial cell, without the need to introduce additional sorting enzyme element, the host metabolic burden is small, and the growth of the strain is not significantly affected. (3) The present invention relies on the sorting enzyme transpeptide reaction to achieve covalent anchoring, which can display exogenous proteins with large molecular weight and not easy to fall off from the cell surface, which is superior to the traditional non-covalent surface display system; (4) The signal peptide, exogenous protein, and sorting signal of the present invention are all independent modules, which can replace different functional proteins and have strong versatility; (5) The exogenous protein of the present invention is mainly located on the surface of the bacterial cell, the proportion of extracellular free protein is extremely low, and the utilization rate of the target protein is high. Attached Figure Description

[0029] Figure 1 This is a structural diagram of the SP-LacZ-CWSS ​​fusion expression box.

[0030] Figure 2 This image shows the quantitative analysis results of the ONPG colorimetric reaction on the surface of the LacZ-targeted protein in Escherichia coli.

[0031] Figure 3 This image shows the quantitative analysis results of the ONPG colorimetric reaction on the surface of LacZ-targeted protein in Shewanella.

[0032] Figure 4 This image shows the quantitative analysis results of the Nitrocefin colorimetric reaction on the surface of BlaA protein in Shewanella. Detailed Implementation

[0033] The present invention will be further described below with reference to the accompanying drawings and specific embodiments. Those skilled in the art will be able to implement the present invention based on these descriptions. Furthermore, the embodiments of the present invention described below are generally only some, not all, of the embodiments of the present invention. Therefore, all other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort should fall within the scope of protection of the present invention.

[0034] Example 1: PCR amplification and construction of fusion expression cassette of endogenous sorting enzymes and sorting signal elements in Shewanella onychomycosis. Based on the publicly available whole-genome nucleotide sequence of *S. oneidensis* MR-1, targeted synthetic primers were designed to target the N-terminal transmembrane signal peptide (SP, 129 bp) of the natural substrate SO2195 recognized by the endogenous sorting enzyme SO2196, and the cell wall sorting signal (CWSS, 210 bp) containing the recognition motif LPQTS at the C-terminus. To facilitate seamless cloning and assembly of the downstream plasmid backbone, linearized pBAD vector homologous recombination crosslinking arms of 18–22 bp were introduced at the 5' end of all relevant primers.

[0035] A standardized PCR reaction system of 50 μL was established using high-fidelity DNA polymerase: 25 μL Phanta Max Buffer, 2 μL forward primer, 2 μL reverse primer, 1 μL MR-1 genomic DNA template, and finally brought to 50 μL with sterile, enzyme-free deionized water. The prepared reaction tubes were placed in a PCR thermal cycler. After amplification, horizontal electrophoresis was performed on agarose gel for physical identification. If the identification result was correct, purification was performed using a purification kit (purchased from Nanjing Novizan Biotechnology Co., Ltd.). The purified DNA was then eluted with 30 μL dd H2O and collected. After measuring the concentration, the DNA was stored at -20 ℃ for later use.

[0036] For the construction of the surface display system fusion expression cassette, the following element order was followed: pBAD promoter → SO2195 N-terminal signal peptide (SP) → exogenous target protein → SO2195 C-terminal CWSS (containing LPQTS motif) → terminator; Using β-galactosidase (LacZ) with a molecular weight of approximately 116 kDa as a typical exogenous target protein, a fusion expression cassette SP-LacZ-CWSS ​​was constructed: signal peptide + β-galactosidase LacZ + LPQTS sorting signal. The SP-LacZ-CWSS ​​fusion expression cassette structure is as follows: Figure 1 As shown. Figure 1 In this context, SP represents the signal peptide, TM represents the transmembrane helix, and "+" indicates a positively charged tail. LacZ can be replaced with other exogenous target proteins. The primer sequences required for constructing the LacZ fusion expression cassette are shown in Table 1 below.

[0037] Table 1. Primer sequences used in constructing the LacZ fusion expression cassette pBAD-SO2195-F TGGGGATCCGAGCTCGAGATGATCATCAAAGAACAGGGT Amplifying SP SP-lacZ-R TGCTAAGACTGCAAAGGGT Amplifying SP lacZ-F ACCCTTTGCAGTCTTAGCAATGACCATGATTACGGATTCAC Amplification of lacZ lacZ-R TAGGACACCAAATTTTTGACACCAGACCAACTG Amplification of lacZ SO2195-CWSS-F GGTGTCAAAAATTTGGTGTCCTACCACAAACATC Amplify CWSS SO2195-CWSS-R AACAGCCAAGCTTCGAATTCTTATGAGCCACCGCCAC Amplify CWSS blaA-F CCCTTTGCAGTCTTAGCAATGCGGTGTTAGCCTTA Amplification of blaA blaA-R GTTTGTGGTAGGACACCAAATGGAATTATCTTTTCCTGTTTAAGC Amplification of blaA .

[0038] Example 2: Construction of an Escherichia coli surface display system Selected promoters contain broad-spectrum host replicons and arabinose-inducible strong promoters (P... BAD The pBAD plasmid, containing the kanamycin resistance selection marker gene (Km), was used as the universal expression backbone vector for this surface display system. The circular pBAD plasmid was linearized and amplified using inverse PCR (F: ATTCGAAGCTTGGCTGTTTTG / R: ATCTCGAGCTCGGATCC). The prepared reaction tubes were placed in a PCR thermal cycler. After amplification, agarose gel electrophoresis was performed for physical identification. The gel imaging results showed correctness. Purification was performed using a purification kit (purchased from Nanjing Novizan Biotechnology Co., Ltd.), and the final product was eluted with 30 μL dd H2O and collected. After concentration measurement, it was stored at -20 ℃ for later use.

[0039] A seamless cloning ligation technique using multi-fragment homologous recombination was employed. The actual loading volume of each recovered fragment was calculated according to the molar ratio: linearized pBAD plasmid vector backbone: SP signal peptide fragment: exogenous target protein gene fragment (using LacZ as an example in this embodiment): CWSS sorting signal fragment = 1:3:3:3. A 10 μL seamless recombination ligation reaction system was established: 2 μL of purified linearized vector backbone (concentration 50 ng / μL), 0.5 μL of recombinant SP signal peptide fragment, 0.5 μL of exogenous target protein gene fragment, 0.5 μL of CWSS sorting signal fragment, 5 μL of Basic Mix, and finally, sterile deionized water was added to bring the total volume to 10 μL. The well-mixed recombination ligation system was placed in a PCR instrument and the recombination reaction was precisely performed at 50 ℃ for 15 min. The correctly tandemly structured recombination surface displayed the expression plasmid pBAD-SP-LacZ-CWSS.

[0040] The ligation product was transformed into *E. coli* WM3064 and plated on LB agar plates containing kanamycin (50 μg / mL) and DAP (0.3 mmol / L). The plates were incubated overnight at 37 °C. Sequencing confirmed the correct sequence of the fusion expression cassette. The recombinant plasmid was extracted and transformed into *E. coli* MG1655 to obtain strain MG1655 / pBAD-SP-LacZ-CWSS.

[0041] Since Escherichia coli itself does not have an endogenous sorting enzyme that can recognize and cleave the LPQTS motif, when constructing the surface display system, the Shewanella-derived sorting enzyme SO2196 was additionally introduced on the basis of the original plasmid pBAD-SP-LacZ-CWSS.

[0042] Working principle: The signal peptide guides the exogenous target protein to be secreted into the periplasm of the cell membrane via the Sec pathway; the sorting enzyme SO2196 specifically recognizes the LPQTS motif in CWSS, cuts the peptide bond, and then covalently anchors the exogenous target protein to the cell surface through a transpeptidation reaction, thereby achieving activity display.

[0043] Construction of a surface display system containing SO2196: The signal peptide + β-galactosidase + LPQTS sorting signal (SP-LacZ-CWSS) fusion expression cassette in the pBAD-SP-LacZ-CWSS ​​plasmid was amplified using relevant primers (pBAD-SO2195-F / LacZ-CWSS-R). Simultaneously, primers (SO2196-F / SO2196-R) were designed for SO2196 and amplified, and the circular pBAD plasmid was linearized and amplified. The prepared reaction tubes were placed in a PCR thermal cycler. After amplification, agarose gel electrophoresis was performed for physical identification. The gel imaging results showed correct amplification. Purification was performed using a purification kit (purchased from Nanjing Novizan Biotechnology Co., Ltd.), and the sample was finally eluted with 30 μL dd H2O and collected. After concentration measurement, it was stored at -20 ℃ for later use.

[0044] A seamless cloning ligation technique using multi-fragment homologous recombination was employed. The actual loading volume of each recovered fragment was calculated based on the molar ratio of linearized pBAD plasmid vector backbone: (SP-LacZ-CWSS): SO2196 = 1:3:3. A 10 μL seamless recombination ligation reaction system was established. The homogeneously mixed recombination ligation system was placed in a PCR instrument and precisely recombinated for 15 min at a constant temperature of 50℃. The correctly tandemly structured recombination surface displayed the expression plasmid pBAD-SP-LacZ-CWSS-SO2196.

[0045] The ligation product was transformed into *E. coli* MG1655 and plated on LB agar plates containing kanamycin (50 μg / mL) and DAP (0.3 mmol / L). The plates were incubated overnight at 37 °C. Sequencing confirmed the correct sequence of the modular fusion expression cassette containing SO2196, yielding strain MG1655 / pBAD-SP-LacZ-CWSS-SO2196. Simultaneously, the pBAD empty vector plasmid was transformed into *E. coli* MG1655 to obtain the control strain MG1655 / pBAD.

[0046] All strains were treated with glycerol to a final concentration of 20% and stored at -80 °C for later use. The primer sequences used in constructing the SO2196 protein surface display system are shown in Table 2 below.

[0047] Table 2. Primer sequences used in constructing the SO2196 protein surface display system .

[0048] Example 3: Determination of the surface display effect of β-galactosidase (LacZ) The classic o-nitrophenyl-β-D-galactoside (ONPG) was selected as the chromogenic substrate for displaying LacZ target proteins on the surface of this system. When LacZ exposed on the bacterial cell surface comes into contact with the substrate, it specifically hydrolyzes the glycosidic bonds in the ONPG molecule, catalyzing the formation of the yellow chromogenic product o-nitrophenol (ONP). In the given isothermal reaction system at 30 °C, the intensity of the yellow color of the reaction solution (i.e., the optical density value at 420 nm) showed a positive linear correlation with the protein activity on the surface.

[0049] This invention further discloses a method for quantitatively verifying the efficiency of whole-cell surface display using the above-mentioned Gram-negative bacteria surface display system, including a spatial partitioning detection step: (a) The bacterial culture after arabinose-induced expression was centrifuged at low temperature and low speed, and the clear supernatant after centrifugation was collected and labeled as "extracellular supernatant sample" to quantitatively characterize the level of loss and shedding of target protein from the cell surface; (b) The bacterial cell pellet obtained by centrifugation was washed twice with isotonic PBS buffer and then the bacterial cells were resuspended with PBS as “unruptured bacterial cell sample”. Taking advantage of the physical barrier property that the macromolecular chromogenic substrate is difficult to permeate through the membrane, the catalytic activity of the target protein displayed on the bacterial surface was measured. (c) Take an equal amount of bacterial cell precipitate, sonicate it in an ice bath, centrifuge it, collect the lysate supernatant by centrifugation, and label it as "cell lysis supernatant sample" to characterize the total expression level of the target protein in the host. (d) The biocatalytic kinetic absorbance values ​​of the exogenous reporter proteins in the above three groups of samples were measured to evaluate the efficiency of the surface display system.

[0050] The surface display effect of β-galactosidase (LacZ) in three *Escherichia coli* strains MG1655 (MG1655 / pBAD, MG1655 / pBAD-SP-LacZ-CWSS, and MG1655 / pBAD-SP-LacZ-CWSS-SO2196) was determined. 100 μL of the test sample (extracellular supernatant, undisturbed bacterial cell sample, and ruptured supernatant) from different spatial partitions was aseptically added to each well of a 96-well plate, followed by the rapid addition of 100 μL of 4 mg / mL ONPG reaction substrate solution prepared with PBS buffer. Timing was started at the beginning of the reaction upon substrate addition, and absorbance was read approximately 30 minutes later. To ensure the reliability of the experimental data, three independent biological replicates were set up for all test and control groups. Results are expressed as mean ± standard deviation (Mean ± SD). The internationally standardized β-galactosidase activity unit (Miller Units) is derived and calculated digitally according to the following legally prescribed standard formula: Enzyme activity (Miller Units) = (1000 × OD) 420 ) / (T×V×OD 600 ), where T is the reaction time (min) and V is the volume of the bacterial culture medium during the reaction (mL). The quantitative analysis results of the ONPG colorimetric reaction displaying LacZ as the target protein surface in *E. coli* are as follows: Figure 2 As shown. Figure 2 In the sample, 1 represents extracellular supernatant sample; 2 represents unbroken bacterial cell sample; and 3 represents ruptured supernatant sample.

[0051] Depend on Figure 2 Analysis shows that the MG1655 strain, equipped with both the sorting enzyme SO2196 and the fusion expression cassette, exhibited significant LacZ enzyme activity on the bacterial surface (i.e., in undisturbed cell samples), which was essentially consistent with the enzyme activity after cell lysis. Simultaneously, no enzyme activity was detected in the extracellular supernatant sample. This indicates that the surface display system constructed in this embodiment can be used for the surface display of LacZ proteins; almost all proteins were displayed on the bacterial surface and were difficult to detach. In contrast, the strain equipped only with the fusion expression cassette and lacking the sorting enzyme showed weak surface catalytic activity, thus demonstrating that the inclusion of the sorting enzyme SO2196 is a necessary condition for the successful implementation of the surface display system in this embodiment.

[0052] Example 4: Construction of a Shewanella surface display system Example 3 was conducted in the Gram-negative bacterium Escherichia coli. SO2196 is an endogenous natural sorting enzyme in Onedashewanella. To demonstrate that the surface display system based on SO2196 can function well in different Gram-negative bacteria, the present invention also conducted relevant experiments in Onedashewanella, the original host of the sorting enzyme SO2196.

[0053] Construction of SO2195 and SO2196 deletion strains: The endogenous sorting enzyme gene SO2196 and the endogenous sorting enzyme substrate protein gene SO2195 in the MR-1 strain genome were knocked out using homologous recombination. First, two rounds of PCR were performed to prepare the deletion fusion fragment: two pairs of primers were designed to amplify the upstream and downstream flanking fragments of the target gene, respectively. Then, fusion PCR was performed using the two flanking products as templates to obtain the gene deletion fusion fragment, which was purified and stored at -20 ℃ for later use. The primer sequences used in constructing the SO2195 and SO2196 deletion strains are shown in Table 3 below.

[0054] Table 3. Primer sequences used in constructing SO2195 and SO2196 deletion strains SO2195-5O GGGGACAAGTTTGTACAAAAAAGCAGGCTAATTCAACAGGGCGTTGCAC Amplification of the upstream flanking sequence of SO2195 SO2195-5I GATTCATCTACATGCTGAGGCCTGATACCCGCATCGAGAC Amplification of the upstream flanking sequence of SO2195 SO2195-3I CCTCAGCATGTAGATGAATCTGAGTCGTGATGCTGTGGTT Amplification of SO2195 downstream flanking sequences SO2195-3O GGGGACCACTTTGTACAAGAAAGCTGGGTGACGCACTCGACAACACAAG Amplification of SO2195 downstream flanking sequences SO2196-5O GGGGACAAGTTTGTACAAAAAAGCAGGCTGGGCGCCAAGGTCATAAGAA Amplification of the upstream flanking sequence of SO2196 SO2196-5I AGCACCTGACGCATCATAGGGGCAAAGTGTGCTTTCGCTT Amplification of the upstream flanking sequence of SO2196 SO2196-3I CCTATGATGCGTCAGGTGCTAAAGTCCGTGCTGTGTAGTT Amplification of SO2196 downstream flanking sequences SO2196-3O GGGGACCACTTTGTACAAGAAAGCTGGGTGTGCCTAAAAGACCGACGTA Amplification of SO2196 downstream flanking sequences .

[0055] The fusion fragment was ligated into the pHGM01 suicide plasmid using Gateway BP recombination. The recombinant product was transformed into Escherichia coli WM3064 competent cells. After culture and colony PCR verification, donor bacteria carrying the recombinant plasmid were obtained.

[0056] Single-exchange integration was achieved through conjugation transfer. Donor bacteria and recipient bacteria, *Shewanella MR-1*, were co-cultured, allowing the suicide plasmid to integrate into the host chromosome via homologous recombination. After bacterial dilution, positive conjugates were screened on gentamicin-containing plates. The cells were then transferred to gentamicin-containing plates and sodium chloride-free plates containing 10% sucrose to screen for gentamicin-positive and sucrose-negative strains. Colony PCR was used to verify the plasmid insertion site.

[0057] Double crossover knockout was achieved through sucrose reverse selection: Positive strains were passaged in salt-free and antibiotic-free LB medium, diluted, and plated on sucrose plates. The lethal effect of the sacB gene induced plasmid detachment from the chromosome. Single colonies were picked and inoculated onto sucrose and gentamicin plates respectively to screen for gentamicin-negative and sucrose-positive strains. Finally, colony PCR using outer primers identified the in-frame deletion mutants ΔSO2195 and ΔSO2196.

[0058] The validated pBAD-SP-LacZ-CWSS ​​and pBAD empty vector were introduced into ΔSO2195 and ΔSO2196 (negative control strains lacking endogenous sorting enzymes) via conjugation transfer. After kanamycin resistance screening and colony PCR identification, the following strains were obtained: ΔSO2195 / pBAD, ΔSO2195 / pBAD-SP-LacZ-CWSS, ΔSO2196 / pBAD, and ΔSO2196 / pBAD-SP-LacZ-CWSS.

[0059] The display effect of LacZ on the surface of Shewanella was determined according to Example 3. The quantitative analysis results of the ONPG colorimetric reaction for surface display of LacZ as the target protein in Shewanella are as follows: Figure 3 As shown. Figure 3 The yellow bars represent the ΔSO2195 host background, and the green bars represent the ΔSO2196 host background; 1 represents the pBAD empty vector cell-lysed supernatant sample; 2 represents the pBAD-SP-LacZ-CWSS ​​cell-lysed supernatant sample; 3 represents the pBAD-SP-LacZ-CWSS ​​unlysed bacterial cell sample; and 4 represents the pBAD-SP-LacZ-CWSS ​​extracellular supernatant sample.

[0060] Depend on Figure 3 Analysis showed that the strain containing the endogenous sorting enzyme and the LacZ fusion expression cassette (i.e., ΔSO2195 / pBAD-SP-LacZ-CWSS) exhibited strong LacZ enzyme activity without cell lysis, and the enzyme activity in the extracellular supernatant sample was extremely low. In contrast, the strain lacking the endogenous sorting enzyme and containing only the LacZ fusion expression cassette (i.e., ΔSO2196 / pBAD-SP-LacZ-CWSS) showed significantly reduced LacZ enzyme activity without cell lysis. Therefore, the surface display system constructed in this embodiment can function effectively in Shewanella, and the endogenous sorting enzyme in this bacterium is a key functional element for the surface display of exogenous proteins.

[0061] Example 5: Verification of β-lactamase BlaA surface display effect To further confirm the universal display capability of this surface display system for exogenous target proteins of different substrate types, this embodiment selected another classic hydrolase, β-lactamase BlaA, as the exogenous target protein in the fusion expression cassette for expansion and validation. Nitrocefin was used as the specific detection substrate. When active BlaA was successfully displayed on the bacterial surface, it efficiently hydrolyzed the lactam ring of the cetrocefin core, initiating recombination of the conjugated system, causing the solution color to drastically change from light yellow to deep red. The surface display efficiency was evaluated by measuring the optical density at 486 nm.

[0062] Following the method in Example 1, the β-lactamase BlaA fusion expression cassette SP-BlaA-CWSS ​​was constructed: signal peptide + β-lactamase BlaA + LPQTS sorting signal.

[0063] The validated pBAD-SP-BlaA-CWSS ​​strain was introduced into ΔSO2195 and ΔSO2196 via conjugation transfer. After antibiotic selection and colony PCR identification, strains ΔSO2195 / pBAD-SP-BlaA-CWSS ​​and ΔSO2196 / pBAD-SP-BlaA-CWSS ​​were obtained.

[0064] Following the treatment method in Example 3, the constructed strains were induced and subjected to three different spatial partitioning treatments. A standardized assay system of 200 μL was established in a 96-well plate: 100 μL of the spatial partitioned sample to be tested was added, followed by 8 μL of 1 mg / mL cefotaximene substrate solution prepared with PBS buffer, and finally brought to 200 μL with PBS. After reacting at 30 °C for 20 minutes, the absorbance of each sample was measured at 486 nm. To ensure the reliability of the experimental data, three independent biological replicates were set up for all test and control groups. The data results are expressed as mean ± standard deviation (Mean ± SD). The quantitative analysis results of the Nitrocefin colorimetric reaction displaying BlaA as the target protein surface in Shewanella are as follows: Figure 4 As shown. Figure 4 The yellow bars represent the ΔSO2195 host background, and the green bars represent the ΔSO2196 host background; 1 represents the pBAD empty vector cell-lysed supernatant sample; 2 represents the pBAD-SP-BlaA-CWSS ​​cell-lysed supernatant sample; 3 represents the pBAD-SP-BlaA-CWSS ​​unlysed bacterial cell sample; and 4 represents the pBAD-SP-BlaA-CWSS ​​extracellular supernatant sample.

[0065] Depend on Figure 4 Analysis showed that the strain containing the endogenous sorting enzyme and the BlaA fusion expression cassette (i.e., ΔSO2195 / pBAD-SP-BlaA-CWSS) exhibited significant β-lactamase activity without cell lysis, and the enzyme activity in the extracellular supernatant sample was extremely low. Conversely, the strain lacking the endogenous sorting enzyme and containing only the BlaA fusion expression cassette (i.e., ΔSO2196 / pBAD-SP-BlaA-CWSS) showed significantly reduced β-lactamase activity without cell lysis. This further confirms that the surface display system constructed in this embodiment is suitable for various exogenous target proteins.

[0066] The above description is merely a detailed explanation of preferred embodiments and principles of the present invention. For those skilled in the art, there may be changes in specific implementation methods based on the ideas provided by the present invention, and these changes should also be considered within the scope of protection of the present invention.

Claims

1. A Gram-negative bacteria surface display system, characterized in that, include: The Gram-negative bacterial sorting enzyme is an enzyme composed of the amino acid sequence of Sortase A, a sorting enzyme derived from Shewanella oneneidae. The amino acid sequence of the Gram-negative bacterial sorting enzyme is shown in SEQ ID NO.

2. It can specifically recognize the LPQTS motif and catalyze peptide bond cleavage and transpeptide reaction. The sorting signal element is derived from the natural substrate protein SO2195 of the S. oneidensis sorting enzyme. The sorting signal element includes an N-terminal signal peptide and a C-terminal cell wall sorting signal. The N-terminal signal peptide is the N-terminal transmembrane signal peptide of the natural substrate SO2195 recognized by the Gram-negative bacterial sorting enzyme. The N-terminal signal peptide is obtained by PCR amplification using artificial primers with S. oneidensis MR-1 genomic DNA as a template. The primer sequences are: F: 5'-TGGGGATCCGAGCTCGAGATGATCACAAAGAACAGGGT-3'; R: 5'-TGCTAAGACTGCAAAGGGT-3'. The C-terminal cell wall sorting signal carries the LPQTS motif and also includes a hydrophobic transmembrane region and a positively charged tail. The amino acid sequence of the C-terminal cell wall sorting signal is shown in SEQ ID NO.

4. A recombinant expression vector containing a modular fusion expression cassette, wherein the modular fusion expression cassette is sequentially connected from the 5' end to the 3' end with a nucleotide sequence encoding the N-terminal signal peptide, a nucleotide sequence encoding the exogenous target protein, and a nucleotide sequence encoding the C-terminal cell wall sorting signal; The fusion protein expressed by the modular fusion expression cassette is covalently anchored to the surface of Gram-negative bacterial cells by the catalysis of the Gram-negative bacterial sorting enzyme.

2. The Gram-negative bacteria surface display system according to claim 1, characterized in that, The amino acid sequence of the Gram-negative bacterial sorting enzyme contains a conserved His-Cys-Arg catalytic triplet.

3. The Gram-negative bacteria surface display system according to claim 2, characterized in that, The Gram-negative bacterial sorting enzyme is encoded by a gene with a nucleotide sequence as shown in SEQ ID NO.

1.

4. The Gram-negative bacteria surface display system according to claim 1, characterized in that, The C-terminal cell wall sorting signal is encoded by a gene with a nucleotide sequence as shown in SEQ ID NO.

3.

5. The Gram-negative bacteria surface display system according to claim 1, characterized in that, The recombinant expression vector uses pBAD plasmid as the expression backbone, and the modular fusion expression cassette is induced by the arabinose-inducible promoter P. BAD Transcriptional regulation.

6. A method for constructing a Gram-negative bacteria surface display system as described in any one of claims 1 to 5, characterized in that, Includes the following steps: Obtain gene fragments encoding the sorting enzyme and sorting signal element of the Gram-negative bacteria, as well as gene fragments encoding the exogenous target protein; The gene fragments were assembled sequentially into the expression vector backbone to obtain the recombinant expression vector. The recombinant expression vector was introduced into a Gram-negative bacterial host to obtain surface-displaying recombinant engineered bacteria; Wherein, when the Gram-negative bacterial host is a non-sorting enzyme native host such as Escherichia coli, the recombinant expression vector simultaneously assembles the sorting enzyme gene fragment; when the Gram-negative bacterial host is a sorting enzyme native host such as Shewanella, the assembly of the sorting enzyme gene fragment is omitted in the recombinant expression vector.

7. The method for constructing a Gram-negative bacteria surface display system according to claim 6, characterized in that, The assembly employs a multi-fragment homologous recombination seamless cloning technique; the importation employs a conjugation transfer method or a transformation method.

8. The application of the Gram-negative bacteria surface display system as described in any one of claims 1 to 5 in whole-cell catalysis, environmental bioremediation, microbial fuel cells, protein mutant library construction, or high-throughput screening of target proteins.

9. A method for verifying the efficiency of cell surface display using a Gram-negative bacteria surface display system as described in any one of claims 1 to 5, characterized in that, Includes spatial partitioning detection steps: Collect the bacterial culture after induced expression, and separate the extracellular supernatant sample, the undamaged bacterial cell sample, and the dyscellular supernatant sample; The biocatalytic kinetic absorbance values ​​of exogenous reporter proteins in three types of samples were measured to evaluate the efficiency of the surface display system.

Images