Protein involved in regulating manganese accumulation, its encoding gene and use

CN122609610APending Publication Date: 2026-08-21CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510191823.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-02-20
Publication Date
2026-08-21

AI Technical Summary

Technical Problem

过量的Mn也可能导致氧化胁迫

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005280726190000111
    Figure BDA0005280726190000111
  • Figure BDA0005280726190000121
    Figure BDA0005280726190000121
  • Figure BDA0005280726190000122
    Figure BDA0005280726190000122
Patent Text Reader

Abstract

The present application provides a protein involved in regulating manganese accumulation, a coding gene and use thereof. The inventor separates and obtains HIPP45 and identifies the biological function thereof through systematic research and experimental analysis, and the HIPP45 gene plays an important role in regulating the traits of manganese accumulation and kernel size of plants. The present application provides a new operation target for optimizing the traits of plants.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of molecular biology, plant physiology, plant genetics and breeding, nutrition, etc.; more specifically, this invention relates to a protein involved in regulating manganese (Mn) accumulation and grain shape regulation, and also includes its encoding gene and its uses. Background Technology

[0002] Grasses, such as rice, contain a certain amount of manganese. Manganese plays an important role in plant growth, promoting seed germination and growth, and enhancing the activity of amylase. Furthermore, manganese affects chlorophyll synthesis; manganese deficiency leads to inhibited chlorophyll synthesis, thus affecting photosynthesis. Therefore, efficient absorption of manganese from the soil is necessary for plants.

[0003] Manganese is a key component of chlorophyll and participates in the photosynthetic process. Manganese deficiency leads to the inability of chlorophyll to form normally, resulting in chlorosis of leaves and a significant decrease in the intensity of photosynthesis, ultimately affecting the growth and yield of rice. Manganese can also enhance the activity of amylase, promoting the decomposition and utilization of starch, thereby affecting the energy metabolism and growth and development of rice.

[0004] The determination of manganese content in plants is well-known in the field, and can be achieved using methods such as wet ashing or dry ashing. Wet ashing requires the use of reagents such as nitric acid and sulfuric acid for digestion, which is complex and consumes a large amount of acid. Dry ashing does not require the addition of reagents and is less susceptible to contamination, but uneven furnace temperature can lead to incomplete ashing. Dilute hydrochloric acid extraction is also used in this field. In addition, atomic absorption spectrophotometry (AAS) and plasma atomic emission spectrometry (CP-AES) are also used for manganese determination, offering advantages such as speed, simplicity, and accuracy.

[0005] While manganese is an essential micronutrient for plant growth, excessive manganese can inhibit plant growth and affect photosynthesis and enzyme activity. High manganese levels have certain cytotoxic effects, such as causing widespread cytoplasmic damage and plasma membrane rupture in the outer root cap and meristematic cells. Excessive Mn may also lead to oxidative stress. Reducing the manganese content in crops may help make plant seeds more suitable for human consumption or industrial processing. In addition, controlled manganese content in food can reduce consumer health risks and improve food safety.

[0006] In summary, regulating the amount of manganese in grains is of great significance, and there is an urgent need in this field to explore genes that regulate manganese content in plants. Summary of the Invention

[0007] The purpose of this invention is to provide a protein involved in regulating manganese (Mn) accumulation and grain shape regulation, including its encoding gene and its uses.

[0008] In a first aspect of the invention, the use of HIPP45 protein is provided for: (a) regulating manganese accumulation and grain shape traits in gramineous plants; or (b) preparing a regulator for regulating manganese accumulation and grain shape traits in gramineous plants.

[0009] In one or more preferred embodiments, the manganese accumulation includes: manganese accumulation in grains, manganese accumulation in aboveground parts, manganese accumulation in roots, and manganese accumulation in xylem.

[0010] In one or more preferred embodiments, the grain manganese accumulation includes brown rice manganese accumulation and husk manganese accumulation.

[0011] In one or more preferred embodiments, the grain shape includes: grain length and grain width.

[0012] In one or more preferred embodiments, the regulator is a HIPP45 downregulator molecule, the uses of which include: (i) increasing manganese accumulation in gramineous plants; (ii) reducing grain length and grain width in gramineous plants.

[0013] In one or more preferred embodiments, the HIPP45 downregulating molecule includes: a reagent that knocks out or silences the gene encoding the HIPP45 protein, or a reagent that inhibits the activity of the HIPP45 protein.

[0014] In one or more preferred embodiments, the HIPP45 downregulation molecule includes: a gene editing reagent, homologous recombination reagent, or site-directed mutagenesis reagent targeting the gene encoding the HIPP45 protein, wherein the reagent performs a loss-of-function mutation on the HIPP45 protein; or, an interfering molecule that specifically interferes with the expression of the gene encoding the HIPP45 protein.

[0015] In one or more preferred embodiments, the regulator is a HIPP45 upregulated molecule, the use of which includes: (i) reducing manganese accumulation in gramineous plants, such as reducing manganese accumulation in gramineous plants in plants with significantly low HIPP45 expression (which have significantly high manganese accumulation); and (ii) increasing grain length and width in gramineous plants, such as increasing grain length and width in plants with significantly low HIPP45 expression (which have significantly low grain length and width).

[0016] In one or more preferred embodiments, the plant with significantly low HIPP45 expression refers to a plant with significantly low HIPP45 expression compared to a wild-type plant or control plant with normal HIPP45 expression.

[0017] In one or more preferred embodiments, the HIPP45 upregulation molecule includes: an expression cassette or expression construct (including an expression vector) that overexpresses the HIPP45 protein; or an expression cassette or expression construct that improves the translation efficiency of the HIPP45 protein; or a molecule that interacts with the HIPP45 protein to improve its expression or activity.

[0018] In one or more preferred embodiments, the HIPP45 protein includes its homologs.

[0019] In another aspect of the present invention, a method for altering manganese accumulation and grain shape traits in gramineous plants is provided, comprising: regulating the expression or activity of HIPP45 protein in the plant; wherein the manganese accumulation includes: grain manganese accumulation, aboveground manganese accumulation, root manganese accumulation, and xylem manganese accumulation; the grain manganese accumulation includes brown rice manganese accumulation and husk manganese accumulation; wherein the grain shape includes: grain length and grain width.

[0020] In one or more preferred embodiments, the altered trait is to increase manganese accumulation in grasses and reduce grain length and width; the method includes: downregulating the expression or activity of HIPP45 protein in plants.

[0021] In one or more preferred embodiments, downregulating the expression or activity of HIPP45 protein in plants includes: knocking out or silencing the gene encoding HIPP45 protein in plants, or inhibiting the activity of HIPP45 protein; more preferably, it includes: gene editing using a CRISPR system to knock out the gene encoding HIPP45 protein; knocking out the gene encoding HIPP45 protein by homologous recombination; silencing it with an interfering molecule that specifically interferes with the expression of the gene encoding HIPP45 protein; or performing a loss-of-function mutation on the HIPP45 protein.

[0022] In one or more preferred embodiments, the altered trait is to reduce (e.g., in plants with significantly low HIPP45 expression) manganese accumulation in grasses and to increase (e.g., in plants with significantly low HIPP45 expression) grain length and grain width; the method includes: upregulating the expression or activity of HIPP45 protein in plants.

[0023] In one or more preferred embodiments, the upregulation of HIPP45 protein expression or activity in plants includes: introducing an exogenous gene encoding HIPP45 protein into the plant to overexpress HIPP45 protein; or, regulating the expression or activity of HIPP45 protein by means of upregulating molecules that interact with HIPP45 protein.

[0024] In another aspect of the present invention, the use of the endogenous HIPP45 gene or the protein encoded by it in grasses is provided for detecting manganese accumulation and grain shape traits in grasses; wherein the manganese accumulation includes: grain manganese accumulation, aboveground manganese accumulation, root manganese accumulation, and xylem manganese accumulation; the grain manganese accumulation includes brown rice manganese accumulation and husk manganese accumulation; and the grain shape includes: grain length and grain width.

[0025] In one or more preferred embodiments, the selection of desirable traits / phenotypes in plants is carried out by analyzing the endogenous HIPP45 gene or its encoded protein in grasses. During the detection, the expression or activity of HIPP45 protein in the test plants is analyzed: if the expression or activity of HIPP45 protein in the test plants is lower than the average expression or activity of HIPP45 protein in the same type of plant (control plants), then the plant has high (significantly high) manganese accumulation and reduced (significantly reduced) grain length and width; if the expression or activity of HIPP45 protein in the test plants is higher than the average expression or activity of HIPP45 protein in the same type of plant (control plants), then the plant has low (significantly low) manganese accumulation and increased (significantly increased) grain length and width.

[0026] In one or more preferred embodiments, the expression of the gene encoding the HIPP45 protein is analyzed using the primers shown in SEQ ID NO:4 and SEQ ID NO:5.

[0027] In one or more preferred embodiments, the grass is a plant that expresses HIPP45 protein or its homologs; preferably, the grass includes (but is not limited to): rice, barley, wheat, oats, rye, corn, sorghum, and sedge.

[0028] In one or more preferred embodiments, the amino acid sequence of the HIPP45 protein is selected from the group consisting of: (i) a protein with the amino acid sequence shown in SEQ ID NO:3; (ii) a protein derived from (i) having the function of (i) formed by substituting, deleting, or adding one or more (e.g., 1-20, 1-10, 1-5, 1-3) amino acid residues of the amino acid sequence shown in SEQ ID NO:3; (iii) a protein having the regulatory trait function with an amino acid sequence homology of ≥85% (preferably ≥90%, ≥95%, ≥98%, or ≥99%); (iv) an active fragment of a protein with the amino acid sequence shown in SEQ ID NO:3; or (v) a protein formed by adding a tag sequence or restriction enzyme site sequence to the N or C terminus of the protein with the amino acid sequence shown in SEQ ID NO:3, or by adding a signal peptide sequence to its N terminus.

[0029] In one or more preferred embodiments, low expression or low activity refers to a statistically significant reduction in expression or activity compared to the average expression or activity of similar or identical plants, such as a reduction of 10%, 20%, 40%, 60%, 80%, 90%, or lower.

[0030] In one or more preferred embodiments, high expression or high activity refers to a statistically significant increase in expression or activity compared to the average expression or activity of similar or identical plants, such as an increase of 10%, 20%, 40%, 60%, 80%, 90%, or higher.

[0031] In one or more preferred embodiments, "high yield" and "increased grain length / width" refer to yield and grain length / width that are statistically significantly higher than those of similar or identical plants, such as 10%, 20%, 40%, 60%, 80%, 90%, or higher.

[0032] In one or more preferred embodiments, "low quantity" and "reduced grain length / width" refer to quantities and grain length / width that are statistically significantly lower than those of similar or identical plants, such as 10%, 20%, 40%, 60%, 80%, 90%, or lower.

[0033] Other aspects of the invention will be apparent to those skilled in the art from the disclosure herein. Attached Figure Description

[0034] Figure 1 Cloning HIPP45 from rice; schematic diagram of the conserved domains of the HIPP45 protein. Numbers represent amino acid sites. HIPP45 is a member of the heavy metal-associated isoprenelated protein family, possessing a heavy metal binding (HMA) domain and an isoprenelation site (CaaX).

[0035] Figure 2 Tissue and subcellular localization of HIPP45;

[0036] A. Subcellular localization of mRFP-HIPP45 in rice protoplasts;

[0037] B. The entire rice seedling at 1 week old;

[0038] C. The base of the stem of a 1-week-old rice seedling;

[0039] D. Section;

[0040] E. Leaf sheath;

[0041] F. Spikes during flowering period;

[0042] G. Leaf cross section;

[0043] H. Grains during the grain-filling stage;

[0044] I. Little Flower;

[0045] J, the last section;

[0046] K. From left to right: leaf tip, leaf middle, junction of leaf blade and leaf sheath;

[0047] L, the junction of root and stem;

[0048] M, root;

[0049] The scale is shown in the figure.

[0050] Figure 3 The Hipp45 rice mutant showed increased manganese content in the aboveground parts and grains;

[0051] A. Mn content in the aboveground parts of hipp45 mutant and wild-type rice during the seedling stage;

[0052] B. Mn content in roots of hipp45 mutant and wild-type rice during seedling stage;

[0053] C. Mn content in xylem sap of hipp45 mutant and wild-type rice during seedling stage;

[0054] D. Mn content in brown rice of hipp45 mutant and wild-type rice;

[0055] Mn content in the glumes of E, hipp45 mutant and wild-type rice;

[0056] The data are presented as mean ± standard deviation, n = 6-8. An asterisk indicates that the p-value is less than 0.05 (*), 0.01 (**), or 0.001 (***) compared to the wild type. The Student's t-test was used for the test.

[0057] Figure 4 The Hipp45 mutant had a lower seed set rate and lower thousand-seed weight than the wild type.

[0058] A. Phenotypic diagram of grain length of hipp45 mutant and wild type;

[0059] B. Phenotypic diagram of grain width of hipp45 mutant and wild type;

[0060] C. Statistical data on seed length of the hipp45 mutant and wild type;

[0061] D. Statistical data on grain width between the hipp45 mutant and the wild type;

[0062] The data are presented as mean ± standard deviation, n = 8, and an asterisk indicates that the p-value is less than 0.05 (*) or 0.001 (***) compared with the wild type. The Student's t-test was used for the test. Detailed Implementation

[0063] Based on extensive research, the inventors identified a novel protein, HIPP45, associated with the regulation of manganese accumulation and grain shape traits in gramineous plants. This invention provides a new operational target for plant trait optimization.

[0064] the term

[0065] As used herein, "plant" includes plants that express HIPP45 or contain HIPP45 and the signaling pathways it participates in. It is understood that plants expressing HIPP45 possess a similar or identical mechanism of action as described in this invention, and can achieve the technical effects claimed by this invention. The plant can be a crop, such as a cereal crop, which is a crop with grains (ears). The plant can be a grass (Poaceae). The grasses can be non-limitingly included, such as rice, barley, wheat, oats, rye, corn, sorghum, and *Brachys pubescens*.

[0066] Regarding "control plants," selecting appropriate control plants is a routine part of experimental design. These can include corresponding wild-type plants or transgenic plants without the target gene. Control plants are generally the same plant species or even varieties of the same species or class as the plant being evaluated. Control plants can also be individuals from transgenic plants that have lost their transgenic components due to segregation. As used in this article, control plants refer not only to whole plants but also to plant parts, including seeds and seed portions.

[0067] As used in this article, "grain" can refer to the fruit or seed of a plant, and in crops such as rice, corn, wheat, and barley, it is also called ear grain.

[0068] HIPP45 gene and its encoded protein

[0069] The HIPP45 described in this invention is a polypeptide (protein) having the amino acid sequence shown in SEQ ID NO:3. This invention also includes sequence variants having the same function as the HIPP45 protein.

[0070] Unless otherwise stated, the "HIPP45 protein" described in this invention includes its homologs (homological proteins). Proteins derived from species other than rice that share high sequence homology with the sequence shown in SEQ ID NO:3, or that play the same or similar roles in the same or similar signaling pathways, are also included in this invention. It should be understood that although HIPP45 proteins obtained from specific species are preferably studied in this invention, other proteins or genes obtained from other species, particularly grasses, that are highly homologous to the HIPP45 protein (e.g., having more than 70%, more particularly 80%, 85%, 90%, 95%, or even more than 98% sequence identity) are also within the scope of this invention.

[0071] In addition, functional variants of the HIPP45 protein, or those formed by adding other proteins or tags at both ends, are also included in this invention.

[0072] The polynucleotide sequence encoding the HIPP45 protein of this invention can be inserted into a recombinant expression vector to circularize plants. Transformation of the host using recombinant DNA can be performed using conventional techniques well known to those skilled in the art. Transformation of plants can be performed using methods such as Agrobacterium-mediated transformation or gene gun transformation, for example, spraying, leaf disc transformation, or rice embryo transformation.

[0073] Plant Transformation

[0074] Whether the HIPP45 protein is involved in the regulation of manganese (Mn) has not been found in previous techniques in this field; how the HIPP45 protein achieves regulation and in which tissues / organs does it specifically cause manganese to accumulate has not been studied in previous techniques in this field.

[0075] Through systematic research and experimental analysis, the inventors isolated the full-length sequence of HIPP45 and identified its biological functions. The HIPP45 gene plays an important role in regulating traits such as manganese accumulation and grain shape in gramineous plants.

[0076] Based on the inventor's new discovery, a use is provided for HIPP45 protein or its regulatory molecule for: (a) regulating manganese accumulation and grain shape traits in gramineous plants; or (b) preparing a regulator for regulating manganese accumulation and grain shape traits in gramineous plants; wherein the manganese accumulation includes: grain manganese accumulation, aboveground manganese accumulation, root manganese accumulation, and xylem manganese accumulation; the grain manganese accumulation includes brown rice manganese accumulation and husk manganese accumulation; wherein the grain shape includes: grain length and grain width.

[0077] Meanwhile, the present invention also provides a method for altering manganese accumulation and grain shape traits in gramineous plants, including: regulating the expression or activity of HIPP45 protein in plants.

[0078] It should be understood that, after learning about the role of the HIPP45 protein in the trait regulation of grasses, various methods well known to those skilled in the art can be used to regulate the expression or activity of the HIPP45 protein according to actual needs, and these methods are all included in this invention.

[0079] The activity of HIPP45 protein can be upregulated by molecules that upregulate its expression or activity. These upregulating molecules include promoters, agonists, and activators. The terms "upregulation" and "promotion" refer to either the upregulation or promotion of protein activity or protein expression. Any substance that can increase the activity of HIPP45 protein, improve the stability of the HIPP45 protein gene or protein, upregulate the expression of the HIPP45 protein gene, or increase the effective duration of action of HIPP45 protein can be used in this invention as a useful substance for upregulating HIPP45 protein or its encoded protein. These substances can be compounds, small chemical molecules, or biomolecules. The biomolecules can be at the nucleic acid level (including DNA and RNA) or at the protein level.

[0080] In a preferred embodiment, a method for upregulating the expression of HIPP45 protein in plants is provided, the method comprising: transferring the HIPP45 protein or an expression construct or vector of the protein encoded by it into plants.

[0081] Preferably, a method for preparing transgenic plants is provided, comprising:

[0082] (1) Transforming the exogenous nucleic acid encoding the protein of the present invention into a plant organ or tissue to obtain a plant tissue or organ transformed with the nucleic acid encoding the protein; and

[0083] (2) The plant tissue or organ obtained in step (1) that has been transferred with the exogenous protein encoding nucleic acid of the present invention is regenerated into a plant plant.

[0084] As a preferred example, the method includes the steps of:

[0085] (i) Providing Agrobacterium carrying an expression vector, said expression vector containing nucleic acid encoding the HIPP45 protein of the present invention;

[0086] (ii) Contacting plant tissues or organs with Agrobacterium in step (i) to transfer the nucleic acid encoding the protein into and integrate it into the chromosome of the plant cell;

[0087] (iii) Selecting plant tissues or organs into which the nucleic acid encoding the HIPP45 protein has been transferred; and

[0088] (iv) Regenerate a plant from the plant tissues or organs in step (iii).

[0089] The present invention also includes plants obtained using any of the foregoing methods, said plants comprising: transgenic plants into which the nucleic acid encoding the HIPP45 protein has been transferred.

[0090] In this invention, the downregulating HIPP45 protein or its encoding gene refers to any substance that can reduce the activity of HIPP45 protein, reduce the stability of HIPP45 protein or its encoding gene, downregulate HIPP45 protein expression, reduce the effective duration of HIPP45 protein action, inhibit the transcription and translation of the HIPP45 gene, or reduce the phosphorylation / activation level of the protein. These substances can all be used in this invention as substances useful for downregulating HIPP45 protein. They can be compounds, small chemical molecules, or biomolecules. The biomolecules can be at the nucleic acid level (including DNA and RNA) or at the protein level. For example, the downregulating molecule is: interfering RNA molecules or antisense nucleotides that specifically interfere with the expression of HIPP45 protein or other signaling pathway genes; or gene editing reagents that specifically edit the HIPP45 gene, etc.

[0091] As a preferred embodiment of the present invention, a method for downregulating HIPP45 protein in plants is provided, comprising targeted mutation, gene editing, or gene recombination of the HIPP45 protein to achieve downregulation. As a more specific embodiment, any of the above methods is used to transform the HIPP45 protein into its mutant form, thereby rendering it ineffective. As a more specific embodiment, gene editing is performed using a CRISPR / Cas9 system. Suitable sgRNA target sites result in higher gene editing efficiency; therefore, suitable target sites can be designed and identified before gene editing. After designing specific target sites, in vitro cell activity screening is required to obtain effective target sites for subsequent experiments. Preferred gene editing reagents are provided in the embodiments of the present invention.

[0092] As an alternative approach, the method for downregulating the expression of HIPP45 protein in plants may include: (1) transferring an interfering molecule that interferes with HIPP45 gene expression into plant cells, tissues, organs, or seeds to obtain plant cells, tissues, organs, or seeds transformed with the interfering molecule; (2) regenerating plants from the plant cells, tissues, organs, or seeds transformed with the interfering molecule obtained in step (1). Preferably, the method further includes: (3) selecting plant cells, tissues, or organs transformed with the vector; and (4) regenerating plants from the plant cells, tissues, or organs obtained in step (3).

[0093] Plant trait / phenotypic analysis

[0094] Based on the inventors' new findings, a target suitable for determining manganese accumulation and grain shape traits, namely the HIPP45 gene, is provided. This invention also relates to specific molecular markers designed for the HIPP45 gene, and analytical strategies.

[0095] Therefore, this invention provides a method for selecting desirable traits / phenotypes in plants by analyzing the endogenous HIPP45 gene or its encoded protein in grasses. During detection, the expression or activity of HIPP45 protein in the test plant is analyzed: if the expression or activity of HIPP45 protein in the test plant is lower than the average expression or activity of HIPP45 protein in the control plant, it is a plant with high (significantly high) manganese accumulation and reduced (significantly reduced) grain length and width; if the expression or activity of HIPP45 protein in the test plant is higher than the average expression or activity of HIPP45 protein in the control plant, it is a plant with low (significantly low) manganese accumulation and increased (significantly increased) grain length and width. In a preferred embodiment, the primers shown in SEQ ID NO:4 and SEQ ID NO:5 are used to analyze the expression of the gene encoding the HIPP45 protein.

[0096] Based on the novel findings of this invention, those skilled in the art can employ any of the various techniques known in the art or under development to analyze nucleic acid sequences, and these techniques are all included in this invention. The methods described include, but are not limited to: sequencing, PCR amplification, probe methods, hybridization, restriction enzyme digestion analysis, allele polymorphism analysis (such as melting curve analysis), and so on.

[0097] The analytical method of this invention only requires PCR reaction and / or agarose gel electrophoresis. By determining the length of the corresponding PCR product, the phenotype or yield of the sample can be accurately and rapidly determined. It is low-cost, suitable for large-scale analysis, and requires very small sample volumes. If needed, those skilled in the art can design primers for analyzing the molecular markers.

[0098] Methods for obtaining DNA from the sample to be tested are well-known to those skilled in the art, such as the traditional phenol / chloroform / isoamyl alcohol method, or commercially available DNA extraction kits. Polymerase chain reaction (PCR) is also well-known to those skilled in the art; its basic principle is the in vitro enzymatic synthesis of specific DNA fragments. The method of this invention can be performed using conventional PCR techniques.

[0099] This invention has promising applications in molecular design breeding and crop variety improvement using genetic engineering technology.

[0100] After understanding the function of the HIPP45 gene, it can be used as a target for targeted plant screening. This new discovery can also be used to screen for substances or potential substances that can be targetedly regulated by modulating this mechanism.

[0101] Methods for screening substances that act on proteins or genes or specific regions thereof as targets are well known to those skilled in the art, and these methods can all be used in this invention. The candidate substances can be selected from: peptides, polymeric peptides, peptide-like substances, non-peptide compounds, carbohydrates, lipids, antibodies or antibody fragments, ligands, small organic molecules, small inorganic molecules, and nucleic acid sequences, etc. Depending on the type of substance to be screened, those skilled in the art understand how to select an appropriate screening method.

[0102] The detection of protein-protein interactions and their strength can be achieved using a variety of techniques well-known to those skilled in the art, such as GST-Pull Down, bimolecular fluorescence complementation assays, yeast two-hybrid systems, or immunoprecipitation techniques.

[0103] Through large-scale screening, a class of substances that specifically act on the HIPP45 protein or its encoding gene and have a regulatory effect on the improvement of traits in grass plants can be obtained.

[0104] The present invention will be further illustrated below with reference to specific embodiments. The specific experimental examples provided are merely illustrative, and those skilled in the art can make various modifications to them. Although various embodiments of this invention are described below in a specific manner or with reference to one or more individual experimental examples, those skilled in the art can make various alterations and modifications without departing from the principles and spirit of the invention.

[0105] Example 1: Isolation of HIPP45

[0106] Through in-depth research and functional analysis, the inventors isolated the protein HIPP45 from rice, which is involved in regulating the homeostasis of manganese (Mn) in rice.

[0107] A schematic diagram of the conserved domains of the HIPP45 protein is shown below. Figure 1 The numbers represent amino acid sites. HIPP45 is a member of the heavy metal-associated isoprene protein family, possessing a heavy metal binding (HMA) domain and an isoprene site (CaaX).

[0108] The HIPP45 gene sequence consists of a 5UTR region, a 3UTR region, introns, and exons (SEQ ID NO:1, where the coding region is indicated by bold and underline, positions 985-1150 and 1296-1603):

[0109]

[0110]

[0111] HIPP45 gene CDS sequence information (SEQ ID NO:2):

[0112]

[0113] The amino acid sequence of the protein encoded by the HIPP45 gene (SEQ ID NO:3):

[0114]

[0115] Example 2: Tissue and subcellular localization of HIPP45

[0116] Transient expression of 35S promoter-driven mRFP-HIPP45 in rice protoplasts was performed, and fluorescence images were captured using a Leica SP8 confocal scanning microscope.

[0117] Promoter GUS activity analysis: The 3105bp upstream sequence of HIPP45 ATG in WYJ was amplified by PCR as the promoter fragment, and then transformed into the GUS / pCambia1300 vector. Transgenic lines were obtained by Agrobacterium-mediated transformation of Nipponbare rice, and their activity was analyzed.

[0118] Primer sequences are shown in Table 1.

[0119] Table 1

[0120] name sequence HIPP45-F ATGGGAGGCTCATTGGAGTACTTG(SEQ ID NO:4) HIPP45-R TCACATGAGGGAGCATGCGTTG(SEQ ID NO:5) proHIPP45-GUS-F acgacggccagtgccAAGCTTTTTTCTTTGATGATTTTCGGA(SEQ ID NO:6) proHIPP45-GUS-R GGACTGACCACCCGGGGATCCTTGACACCAAGTTTCTGAAGA(SEQ ID NO:7)

[0121] The tissue and subcellular localization results of HIPP45 are as follows: Figure 2 As shown.

[0122] Example 3: The Mn content in the aboveground parts of hipp45 gene-edited rice was higher than that in wild-type rice.

[0123] To detect the regulation of Mn accumulation in rice by HIPP45, sgRNA and elements encoding Cas9 were introduced into Wuyunjing rice using pYLCRISPR / Cas-HM as a vector. HIPP45 was then knocked out in the Wuyunjing background using CRISPR Cas9 technology to prepare hipp45-edited rice.

[0124] Using dual sgRNAs, they were used to establish HIPP45 knockout lines:

[0125] sgRNA1:

[0126]

[0127] sgRNA2:

[0128]

[0129] Testing revealed that CRISPR Cas9 modification yielded multiple mutant lines with water HIPP45 knocked out, including:

[0130] The Hipp45-2 strain has a mutation that deletes bases at positions 37-38 of the HIPP45 gene, causing the protein to terminate prematurely from position 14.

[0131] The HIPP45-23 strain has a mutation that deletes bases at positions 39-199 of the HIPP45 gene, causing the protein to terminate prematurely from position 15.

[0132] The Mn content in the aboveground parts and roots of mutant and wild-type rice seedlings was detected separately, and the transfer ratio of Mn from the roots to the aboveground parts in different lines was analyzed. Figure 3 As shown in AB, compared with the wild type, the Mn content in the aboveground parts of the mutant plants was significantly increased, and the Mn content in the roots was also significantly increased.

[0133] like Figure 3 As shown in Figure C, the analysis of the xylem also revealed that the Mn content in the xylem sap of the mutant plants was significantly increased compared to the wild type.

[0134] In addition, the Mn content in mature brown rice and husks was statistically analyzed. Compared with the wild type, the Mn content in the xylem sap of the mutant plants was significantly increased, such as... Figure 3 D and Figure 3 As shown in E.

[0135] In the above analysis and experiments, the rice seedlings were collected after 3 weeks of hydroponics, and the grains were collected during the yellow ripening stage.

[0136] Example 4: Changes in grain shape of rice with hipp45 gene editing

[0137] To verify whether HIPP45 has a regulatory effect on other phenotypes of rice, the inventors further bred wild-type rice and mutant rice, observing the agronomic traits of mutant and wild-type rice throughout the growth and maturity period.

[0138] like Figure 4 As shown in AD, the results indicate that the grain shape of the hipp45 mutant is significantly different from that of the wild type, with significant changes (reduction) in grain width and length, which is beneficial for producing grain varieties with small grains.

[0139] In this field, rice varieties with large grains, long grains, and other types have been developed. Small-grain varieties, on the one hand, are beneficial for uniform and dense sowing, and on the other hand, provide a grain variety that is easy to cook or suitable for making porridge.

[0140] It should be understood that the above embodiments and examples are merely illustrative, and those skilled in the art can make various modifications to them. The purpose of the above description, embodiments, and data is to complete the structure of this specification and to serve as examples of practicing the present invention. Although the present disclosure has been disclosed above with reference to embodiments, it is not intended to limit the present disclosure. Any person skilled in the art can make various modifications and refinements without departing from the spirit and scope of the present disclosure. Therefore, the scope of protection of the present disclosure shall be determined by the scope of the appended claims.

Claims

1. Uses of HIPP45 protein: For example, it is used in the following ways: (a) Regulates manganese accumulation and grain shape traits in grasses; or (b) Preparation of regulators for controlling manganese accumulation and grain shape traits in grass plants; in, The manganese accumulation includes: manganese accumulation in grains, manganese accumulation in aerial parts, manganese accumulation in roots, and manganese accumulation in xylem; the manganese accumulation in grains includes manganese accumulation in brown rice and manganese accumulation in husks. The grain shape includes grain length and grain width.

2. The use as described in claim 1, characterized in that, The regulator is a HIPP45 downregulatory molecule, the uses of which include: (i) increasing manganese accumulation in gramineous plants; (ii) reducing grain length and grain width in gramineous plants.

3. The use as described in claim 2, characterized in that, The HIPP45 downregulating molecules include: reagents that knock out or silence the gene encoding the HIPP45 protein, and reagents that inhibit the activity of the HIPP45 protein. Preferably, the HIPP45 downregulation molecule includes: a gene editing reagent, homologous recombination reagent, or site-directed mutagenesis reagent targeting the gene encoding the HIPP45 protein, wherein the reagent performs a loss-of-function mutation on the HIPP45 protein; or, an interfering molecule that specifically interferes with the expression of the gene encoding the HIPP45 protein.

4. The use as described in claim 1, characterized in that, The regulator is an upregulated HIPP45 molecule, and the uses of the HIPP45 protein or its upregulated molecule include: (i) reducing manganese accumulation in grasses, such as reducing manganese accumulation in grasses in plants with significantly low HIPP45 expression; (ii) increasing grain length and grain width in grasses, such as increasing grain length and grain width in plants with significantly low HIPP45 expression.

5. The use as described in claim 4, characterized in that, The HIPP45 upregulated molecules include: expression cassettes or expression constructs that overexpress the HIPP45 protein; or expression cassettes or expression constructs that improve the translation efficiency of the HIPP45 protein; or molecules that interact with the HIPP45 protein to improve its expression or activity.

6. A method for altering manganese accumulation and grain shape traits in gramineous plants, comprising: Regulates the expression or activity of HIPP45 protein in plants; The manganese accumulation includes: manganese accumulation in grains, manganese accumulation in aboveground parts, manganese accumulation in roots, and manganese accumulation in xylem; the manganese accumulation in grains includes manganese accumulation in brown rice and manganese accumulation in husks. The grain shape mentioned above includes grain length and grain width.

7. The method as described in claim 6, characterized in that, The altered traits are to increase manganese accumulation in grasses and reduce grain length and width; the method includes: downregulating the expression or activity of HIPP45 protein in plants; Preferably, the downregulation of HIPP45 protein expression or activity in plants includes: knocking out or silencing the gene encoding HIPP45 protein in plants, or inhibiting the activity of HIPP45 protein; more preferably, it includes: gene editing using a CRISPR system to knock out the gene encoding HIPP45 protein; knocking out the gene encoding HIPP45 protein by homologous recombination; silencing it with an interfering molecule that specifically interferes with the expression of the gene encoding HIPP45 protein; or performing a loss-of-function mutation on the HIPP45 protein.

8. The method as described in claim 6, characterized in that, The altered traits are to reduce manganese accumulation in gramineous plants and increase grain length and width; the method includes: upregulating the expression or activity of HIPP45 protein in plants; Preferably, the upregulation of HIPP45 protein expression or activity in plants includes: introducing an exogenous gene encoding HIPP45 protein into plants to overexpress HIPP45 protein; or, regulating the expression or activity of HIPP45 protein by means of upregulating molecules that interact with HIPP45 protein.

9. The uses of the endogenous HIPP45 gene or its encoded protein in grasses for detecting manganese accumulation and grain shape traits in grasses; among which, The manganese accumulation includes: manganese accumulation in grains, manganese accumulation in aboveground parts, manganese accumulation in roots, and manganese accumulation in xylem; the manganese accumulation in grains includes manganese accumulation in brown rice and manganese accumulation in husks; the grain shape includes: grain length and grain width.

10. The use as described in claim 9, characterized in that, Selection of desirable traits / phenotypes in grasses is achieved by analyzing the endogenous HIPP45 gene or its encoded protein; during detection, the expression or activity of HIPP45 protein in the tested plants is analyzed. If the expression or activity of HIPP45 protein in the tested plant is lower than the average expression or activity of HIPP45 protein in that type of plant, then it is a plant with high manganese accumulation and reduced grain length and width. If the expression or activity of HIPP45 protein in the tested plant is higher than the average expression or activity of HIPP45 protein in the same type of plant, then it is a plant with low manganese accumulation and increased grain length and width. Preferably, the expression of the gene encoding the HIPP45 protein is analyzed using the primers shown in SEQ ID NO:4 and SEQ ID NO:5.