Application of GmD14 gene in regulating soybean agronomic traits
Patent Information
- Application Number
- CN202610881761.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-06-17
- Publication Date
- 2026-08-21
AI Technical Summary
[0005]本发明的主要目的在于提供一种GmD14基因在调控大豆农艺性状中的应用,以解决现有技术中缺乏同时调控大豆株高、分枝数、豆荚数、豆粒数和单株产量的问题
[0026] By applying the technical solution of this invention, by knocking out the... GmD14 Genes (e.g., GmD14a and/or GmD14b This method can reduce the height of the main stem of the plant while promoting the occurrence and development of lateral branches, forming a multi-branched plant structure. At the same time, it significantly increases the number of pods, the number of beans, and the yield per plant, while the 100-bean weight of soybeans is not adversely affected. This provides a new germplasm that can be stably inherited for high-yield soybean cultivation.
Smart Images

Figure CN122609615A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of soybean breeding technology, and more specifically, to a... GmD14 Application of genes in regulating soybean agronomic traits. Background Technology
[0002] Soybeans are an important oilseed and protein crop, and my country's heavy reliance on soybean imports is detrimental to national food security and the stability of the feed industry chain. Increasing yield per unit area is the core path to breaking this predicament, and plant architecture improvement, as a key breakthrough in high-yield breeding, has become an international research hotspot. Existing research shows that soybean plant height, branching ability, and pod development are closely related: excessively tall plants are prone to lodging and have low light energy utilization, while moderate dwarfing and increased branching can optimize canopy structure, significantly improving photosynthetic efficiency and yield potential.
[0003] Currently, several genes regulating soybean plant architecture have been identified, such as Dt2 , GmMTA , GmTB1 or COL2 Some varieties have achieved reduced plant height or increased branching through gene editing or natural mutation. However, the existing technologies generally have the following limitations: (1) Most genes only regulate plant height or branching in a single way, failing to synergistically increase the number of pods and seeds; (2) Although some mutants reduce plant height, they are accompanied by a decrease in the number of pods and a decrease in fertility, resulting in no increase or even a decrease in yield; (3) It is difficult to balance the 100-seed weight and yield, and most improved varieties exhibit a trade-off effect of smaller seeds while increasing yield.
[0004] Therefore, it is of great value to explore a gene that can simultaneously regulate soybean plant height, number of branches, number of pods, number of seeds, and yield per plant. Summary of the Invention
[0005] The main objective of this invention is to provide a GmD14 The application of genes in regulating soybean agronomic traits aims to address the current lack of technology for simultaneously regulating soybean plant height, number of branches, number of pods, number of beans, and yield per plant.
[0006] To achieve the above objectives, according to a first aspect of the present invention, a [missing information] is provided. GmD14 The application of genes in regulating soybean agronomic traits, including any one or more of the following: plant height, number of branches, number of pods, number of beans, 100-bean weight, or yield per plant.
[0007] Furthermore, knocking out soybeans GmD14 Gene.
[0008] Furthermore, the above applications include: GmD14 The gene is selected from any one or more of the following genes: GmD14a Gene or GmD14b Gene;
[0009] Among them, the above GmD14a The nucleotide sequence of the gene is SEQ ID NO: 1; above GmD14b The nucleotide sequence of the gene is SEQ ID NO: 2.
[0010] Furthermore, the above can be knocked out using any one or more of the following methods. GmD14a Gene:
[0011] 11) Five bases are deleted from positions 121-125 of the nucleotide sequence of SEQ ID NO: 1 above;
[0012] 12) A deletion of 5 bases at positions 121-125 and a deletion of 2 bases at positions 340-341 of the nucleotide sequence of SEQ ID NO: 1 above; or
[0013] 13) Thirteen bases are deleted at positions 117-129 of the nucleotide sequence of SEQ ID NO: 1 above.
[0014] Furthermore, the above can be knocked out using any one or more of the following methods. GmD14b Gene: Insert one base G at position 121 of the nucleotide sequence of SEQ ID NO: 2 above and delete 18 bases at positions 340-357 of the nucleotide sequence of SEQ ID NO: 2 above.
[0015] Furthermore, the above can be knocked out using any one or more of the following methods. GmD14a Genes and the above GmD14b Gene:
[0016] 21) Five bases are deleted from positions 121-125 of the nucleotide sequence of SEQ ID NO: 1 above;
[0017] Two bases are deleted at positions 340-341 of the nucleotide sequence of SEQ ID NO: 1 above;
[0018] Insert one base G at position 121 of the nucleotide sequence of SEQ ID NO: 2 above; and
[0019] The nucleotide sequence of SEQ ID NO: 2 above has 18 bases deleted at positions 340-357; or
[0020] 22) Thirteen bases are deleted from positions 117-129 of the nucleotide sequence of SEQ ID NO: 1 above;
[0021] Insert one base G at position 121 of the nucleotide sequence of SEQ ID NO: 2 above; and
[0022] The nucleotide sequence of SEQ ID NO: 2 above has 18 bases deleted at positions 340-357.
[0023] Furthermore, the above applications include: using the CRISPR-Cas9 gene editing system to perform the above knockout.
[0024] Furthermore, the aforementioned CRISPR-Cas9 gene editing system includes sgRNA; the aforementioned sgRNA includes those that simultaneously target the aforementioned GmD14a Genes and the above GmD14b sgRNA1 and / or sgRNA2 of the gene;
[0025] The nucleotide sequence of sgRNA1 is SEQ ID NO: 3; the nucleotide sequence of sgRNA2 is SEQ ID NO: 4.
[0026] By applying the technical solution of this invention, by knocking out the... GmD14 Genes (e.g., GmD14a and / or GmD14b This method can reduce the height of the main stem of the plant while promoting the occurrence and development of lateral branches, forming a multi-branched plant structure. At the same time, it significantly increases the number of pods, the number of beans, and the yield per plant, while the 100-bean weight of soybeans is not adversely affected. This provides a new germplasm that can be stably inherited for high-yield soybean cultivation. Attached Figure Description
[0027] The accompanying drawings, which form part of this specification, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an undue limitation of the invention. In the drawings:
[0028] Figure 1 A soybean gene editing vector according to an embodiment of the present invention is shown; wherein, RB represents the right boundary sequence of the vector; ubiquitin10p represents the Arabidopsis thaliana ubiquitin10 promoter; AtGRF5: Arabidopsis thaliana GRF5 gene; hspt represents the Arabidopsis thaliana heat shock protein gene terminator; u6-26p and u6-29p represent the Arabidopsis thaliana u6 promoter; u6-26t and u6-29t represent the Arabidopsis thaliana u6 terminator; 35sp represents the cauliflower mosaic virus 35S promoter; zCas9 represents the Cas9 gene optimized according to the maize codon; E9t represents the pea ribulose-1,5-bisphosphate carboxylase small subunit E9 gene terminator; spect represents the spectinomycin resistance gene; 35spolyA represents the cauliflower mosaic virus 35S terminator; LB represents the left boundary sequence of the vector.
[0029] Figure 2 An analysis of gene-edited soybean mutations according to an embodiment of the present invention is shown.
[0030] Figure 3 The plant heights of wild-type and gene-edited soybeans according to embodiments of the present invention are shown.
[0031] Figure 4 The number of branches in wild-type and gene-edited soybeans according to an embodiment of the present invention is shown.
[0032] Figure 5 The number of pods of wild-type and gene-edited soybeans according to an embodiment of the present invention is shown.
[0033] Figure 6 The number of soybeans in wild-type and gene-edited soybeans according to an embodiment of the present invention is shown.
[0034] Figure 7 The 100-seed weights of wild-type and gene-edited soybeans according to embodiments of the present invention are shown.
[0035] Figure 8 A mutant according to an embodiment of the present invention is shown. GmD14a A diagram showing the amino acid sequence alignment between the gene-encoded protein and its wild-type protein.
[0036] Figure 9 A mutant according to an embodiment of the present invention is shown. GmD14b A diagram showing the amino acid sequence alignment between the gene-encoded protein and its wild-type protein. Detailed Implementation
[0037] It should be noted that, unless otherwise specified, the embodiments and features described in the present invention can be combined with each other. The present invention will now be described in detail with reference to the embodiments.
[0038] As mentioned in the background section, existing technologies have identified several key genes regulating soybean plant height, branching, and yield (such as...). Dt2 , GmMTA , GmTB1 (etc.), but the comprehensive breeding goal of significantly reducing plant height, significantly increasing branching and pod number, and greatly increasing yield per plant without affecting the weight of 100 seeds has not yet been achieved.
[0039] In this invention, the inventors attempted to knock out [the following] in soybeans. GmD14 Genes (e.g., GmD14a and / or GmD14bThe invention proposes a protection scheme based on obtaining plants with loss-of-function mutations in the aforementioned genes, thereby synergistically reducing plant height, increasing the number of branches, pods, and beans without changing the 100-seed weight.
[0040] In a first typical embodiment of the present invention, a method is provided. GmD14 Application of genes in regulating soybean agronomic traits; wherein the above-mentioned agronomic traits include any one or more of the following: plant height, number of branches, number of pods, number of beans, 100-bean weight, or yield per plant.
[0041] Through targeted regulation GmD14 Genes can influence the growth and development patterns of soybean plants, thereby altering traits related to plant architecture (e.g., plant height, number of branches, number of pods, number of beans, 100-bean weight, or yield per plant). Knocking out this gene in soybean can reduce plant height, promote branching, increase pod density, and increase the total number of beans per plant. By increasing the number of effective pods and beans, the yield potential per plant is enhanced, providing a genetic target for designing high-yielding plant architectures.
[0042] In a preferred embodiment of the present invention, knocking out the soybean GmD14 Gene.
[0043] Knockout GmD14 The gene can lead to the loss of function of its encoded protein and an increase in the number of branches. Simultaneously, due to inhibited internode elongation, the overall plant height decreases, the canopy structure becomes more compact, and light energy utilization efficiency improves. The loss of this gene function does not interfere with the basic processes of flower bud differentiation and pod formation, but by increasing the number of effective branches, it increases the number of flower and pod attachment sites, thereby increasing the number of pods and the total number of beans per plant, achieving structural optimization of yield components.
[0044] It should be noted that gene knockout refers to the irreversible functional inactivation of a target gene in the genome through molecular biology techniques, resulting in the inability of the protein it encodes to be expressed normally or the loss of biological activity, thereby eliminating the original function of the gene in the organism.
[0045] The CRISPR-Cas9 gene editing system utilizes a designed guide RNA (sgRNA) to guide the Cas9 endonuclease to cut double-stranded DNA at a specific site in the target gene. Through the cell's own non-homologous end joining (NHEJ) repair mechanism, insertion or deletion mutations are introduced, causing frameshift or premature termination, thereby achieving permanent inactivation of gene function.
[0046] Zinc finger nucleases are artificial nucleases formed by fusing a zinc finger DNA-binding domain with a FokI endonuclease domain. By designing zinc finger arrays to recognize specific DNA sequences, they dimerize and cleave target sites, inducing NHEJ repair to achieve gene knockout.
[0047] Transcription activator-like effector nucleases are composed of a TALE DNA-binding domain fused with a FokI endonuclease. They recognize long DNA sequences through modular assembly, induce double-strand breaks, and then achieve gene knockout through NHEJ repair.
[0048] Homologous recombination-mediated targeted knockout refers to the process of constructing a gene knockout vector containing homologous arms (including selection markers and termination sequences) to induce homologous recombination with endogenous genes within cells, thereby replacing or inserting inactivating sequences and thus achieving gene knockout.
[0049] Chemical mutagenesis or radiation mutagenesis refers to the random induction of genomic mutations using chemical mutagens such as EMS (ethyl methanesulfonate) and NaN3, or physical mutagenesis methods such as gamma rays and X-rays, and obtaining mutants with inactivated target genes through large-scale screening.
[0050] In a preferred embodiment of the present invention, the above application includes: GmD14 The gene is selected from any one or more of the following genes: GmD14a Gene or GmD14b Genes; among which, the above GmD14a The nucleotide sequence of the gene is SEQ ID NO: 1; above GmD14b The nucleotide sequence of the gene is SEQ ID NO: 2.
[0051] The nucleotide sequence of SEQ ID NO: 1 is as follows:
[0052] atgggcacttccattctcgacgccctgaacgtccgcgtggaaggttccggcgataagtaccttttcctggcccacggcttcggcacagaccaatccgcgtggcagcgcgtgctcccttacttcacccgcaactacagcgtcattctctacgacctcgtctgcgccggcagcgtcaaccccgaccacttcgactaccgccgctacaccaccctcgacgcctacgtcgacgacctcctcaacatcctcgacgccctccgcgtcccccgctgcgtctacgtcggccactccatctccgccatgatcggcatgctggcctccatccgccgccccgacctcttctccaaactcatcctcataggcgcctcccctaggtacaacaagaaattaatcttcctctttcccctcaatttaatcaattctgttcgagtcacaacttcttaactaattgttgattaagtttctcagattcctgaatgacaaggactaccacgggggatttgagcagggagagatcgagcaggtgttttcggcaatggaggcgaactacgaggcctgggtgaacggtttcgcgccgctgtcggtgggagcggatgttcccgcggcggtgcgggagttttcccggacgctgttcaacatgaggccggacatctcgctgttcgtgtcgcggacggtgttccacagcgacctgagggggattctgggtctggttaacgtcccctgttgtattatgcagacggcacgtgacatgtccgtgcctgccagcgtggcgacctacatgaaggaccacatcggcggaaagagcagcatccagtggctggacacggagggccacctcccgcacttgagtgctccttcatacctggctcgccagcttgagattgcgctttcccagtag。
[0053] Among them, the nucleotide sequence of SEQ ID NO: 2 is:
[0054] atgggcacttccattctcgacgccctgaacgttcgcgtggaaggttccggcgacaagtaccttgtcctggcccacggcttcggcacggaccaatccgcgtggcagcgcgtgctcccttacttcacccgcaactacagcgtcattctctacgacctcgtctgcgccggcagcgtcaaccccgaccacttcgactaccgccgttataccaccctcgacgcctacgtcgacgacctcctcaacatcctcgacgccctccgcgtcccccgctgcgcctacgtcggccactccatctccgccatgatcggcatgctcgcctccatccgccgcccgga cctcttctccaaactcatcctcatc ggcgcctcccctaggtacaacaagtaattctcttctccctcctcaattctattctattctattctattctatgcgagcaaataggagcaattagcgcttgaatttctcagattcctgaacgacaaggactaccacgggggatttgagcagggagaaatcgagcaggtgttttcggcaatggaggcgaactacgaggcgtgggtcaacggattcgctccgctggcggtcggggcggatgtaccggcggcggtgagggaattttcccggacgctgttcaacatgcgccctgacatctcgctcttcgtgtcgcggacggtgttcaacagcgacctgagggggattctgggcctggtgaacgtcccctgctgtattatgcagacggcacgtgacatgtccgtgccggccagcgtggctacctacatgagggaccacatcgccggaaagagcaccatccagtggctcgacacggaggggcacctcccccaccttagtgctccttcatacctagctcgccagctagagattgcgctctcgcagtag。
[0055] GmD14a and GmD14bThese are two homologous genes in soybean, sharing 91% nucleotide sequence homology. Located at different chromosomal loci, their encoded proteins both possess typical α / β hydrolase domains. Knocking out either gene alone or both genes simultaneously reduces soybean plant height, promotes branching, increases pod density, and raises the total number of seeds per plant, ultimately contributing to increased soybean yield. Synergistic inactivation of both genes achieves more thorough signal blocking, resulting in a more stable effect on increasing branch number, pod number, and total number of seeds per plant, as well as reducing plant height.
[0056] In a preferred embodiment of the present invention, the above-mentioned methods are used to eliminate the defects. GmD14a Gene: 11) a deletion of 5 bases at positions 121-125 of the nucleotide sequence of SEQ ID NO: 1 above; 12) a deletion of 5 bases at positions 121-125 of the nucleotide sequence of SEQ ID NO: 1 above and a deletion of 2 bases at positions 340-341 of the nucleotide sequence of SEQ ID NO: 1 above; or 13) a deletion of 13 bases at positions 117-129 of the nucleotide sequence of SEQ ID NO: 1 above.
[0057] exist GmD14a Introducing base deletions of specific lengths into a gene sequence can lead to reading frame shifts or disruption of key domains, causing premature termination or loss of function in the translation product. Deletions of 5, 2, or 13 bases are all non-multiples of 3 and can trigger frameshifts, resulting in non-functional truncated proteins. The selection of different deletion sites can cover different functional domains of the gene, ensuring the consistency of mutant phenotypes. This type of mutation achieves gene knockout without introducing exogenous sequences, avoiding the genetic instability caused by transgene integration.
[0058] When soybeans GmD14a When the gene undergoes the mutation described in point 11), compared to the protein encoded by the gene before the mutation, the amino acid sequence of the encoded protein in the obtained soybean mutant differs from the 41st amino acid, causing premature termination of the downstream sequence after frameshift. The sequence length changes from the original 266 amino acids to 121 amino acids, and the protein loses its function.
[0059] When soybeans GmD14a When the gene undergoes the mutation described in point 12), compared to the protein encoded by the gene before the mutation, the amino acid sequence of the encoded protein in the obtained soybean mutant differs from the 41st amino acid, causing premature termination of the downstream sequence after frameshift. The sequence length changes from the original 266 amino acids to 116 amino acids, and the protein loses its function.
[0060] When soybeans GmD14aWhen the gene undergoes the mutation described in point 13 above, compared to the protein encoded by the gene before the mutation, the resulting soybean mutant shows an amino acid sequence difference starting from the 40th amino acid, leading to premature termination of the downstream sequence after frameshift. The sequence length changes from 266 amino acids to 95 amino acids, and the protein loses its function (see...). Figure 8 ).
[0061] In a preferred embodiment of the present invention, the above-mentioned methods are used to eliminate the defects. GmD14b Gene: Insert one base G at position 121 of the nucleotide sequence of SEQ ID NO: 2 above and delete 18 bases at positions 340-357 of the nucleotide sequence of SEQ ID NO: 2 above.
[0062] exist GmD14b Inserting a single G base or deleting 18 bases in a gene sequence can disrupt the continuity of its coding frame, leading to complete disorder of downstream amino acid sequences and loss of protein function. Inserting a single base is a minimal frameshift mutagenesis method, easily implemented via CRISPR editing; deleting 18 bases can eliminate critical conserved regions, resulting in complete loss of protein function. Both methods are stably inherited and do not rely on selection markers, making them suitable for non-transgenic breeding systems without residual resistance.
[0063] When soybeans GmD14b When the gene undergoes the above mutation, compared with the protein encoded by the gene before the mutation, the amino acid sequence of the protein encoded by the obtained soybean mutant differs from the 41st amino acid, causing premature termination of the downstream sequence after frameshift. The sequence length changes from the original 269 amino acids to 117 amino acids, and the protein loses its function (see...). Figure 9 ).
[0064] In a preferred embodiment of the present invention, the above-mentioned methods are used to knock out the defects. GmD14a Genes and the above GmD14b Gene:
[0065] 21) A deletion of 5 bases at positions 121-125 of the nucleotide sequence of SEQ ID NO: 1; a deletion of 2 bases at positions 340-341 of the nucleotide sequence of SEQ ID NO: 1; an insertion of 1 base G at position 121 of the nucleotide sequence of SEQ ID NO: 2; and a deletion of 18 bases at positions 340-357 of the nucleotide sequence of SEQ ID NO: 2; or
[0066] 22) 13 bases are deleted at positions 117-129 of the nucleotide sequence of SEQ ID NO: 1 above; 1 base G is inserted at position 121 of the nucleotide sequence of SEQ ID NO: 2 above; and 18 bases are deleted at positions 340-357 of the nucleotide sequence of SEQ ID NO: 2 above.
[0067] At the same time, targeting GmD14a and GmD14b Implementing multiple editing helps eliminate the compensatory effect of gene redundancy, achieving synergistic loss of function in two genes. (Method 21) GmD14a Through deletion mutations at two different sites, GmD14b By employing both insertion and deletion to disrupt the phenotype, a complex mutant can be formed, thereby enhancing phenotypic stability; 22) the method involves... GmD14a Large single missing data and GmD14b Dual-mode disruption enables more thorough functional knockout. This type of composite editing strategy can reduce the number of screening generations, improve the efficiency of obtaining plants with ideal phenotypes, and provide a genetic basis for the aggregation of desirable traits.
[0068] When soybeans GmD14a Genes and GmD14b When the gene undergoes the mutation described in point 21 above, compared to the protein encoded by the gene before the mutation, the resulting soybean mutants show the following differences:
[0069] GmD14a An amino acid sequence difference occurs at amino acid position 41 of the gene-encoded protein, causing premature termination of the downstream sequence after a frameshift. The sequence length decreases from 266 amino acids to 116 amino acids, resulting in the protein losing its function.
[0070] GmD14b An amino acid sequence difference occurs at amino acid position 41 of the gene-encoded protein, causing premature termination of the downstream sequence after a frameshift. The sequence length decreases from 269 amino acids to 117 amino acids, resulting in the protein losing its function.
[0071] When soybeans GmD14a Genes and GmD14b When the gene undergoes the mutation described in point 22), compared to the protein encoded by the gene before the mutation, the resulting soybean mutants show the following differences:
[0072] GmD14a An amino acid sequence difference occurs at amino acid position 40 of the gene-encoded protein, causing premature termination of the downstream sequence after a frameshift. The sequence length decreases from 266 amino acids to 95 amino acids, resulting in the protein losing its function.
[0073] GmD14bAn amino acid sequence difference occurs at amino acid position 41 of the gene-encoded protein, causing premature termination of the downstream sequence after a frameshift. The sequence length decreases from 269 amino acids to 117 amino acids, resulting in the protein losing its function.
[0074] It should be noted that the specific mutation types mentioned above are only for implementation purposes. GmD14 Gene( GmD14a and / or GmD14b This is a specific manifestation of loss of function, and any other mutation type that can cause the above-mentioned gene to lose function is applicable to this invention.
[0075] In a preferred embodiment of the present invention, the above application includes: performing the above knockout using a CRISPR-Cas9 gene editing system.
[0076] The CRISPR-Cas9 system can achieve [the following] through the design of specific guide RNA: GmD14 Precisely targeted gene cleavage induces cells to insert or delete bases through non-homologous end joining mechanisms, thereby achieving gene knockout. This system does not require exogenous DNA integration, avoids residual transgenic components, and is suitable for non-GMO breeding regulations. Its high efficiency, programmability, and ability to edit multiple targets in parallel make it an ideal tool for regulating multi-gene redundancy networks, especially suitable for… GmD14a and GmD14b Simultaneous editing of two genes.
[0077] In a preferred embodiment of the present invention, the above-mentioned knockout using the CRISPR-Cas9 gene editing system includes: constructing a dual-target gene editing vector, transforming soybean recipient material through Agrobacterium-mediated transformation, and obtaining plants with the above-mentioned gene loss-of-function mutation. In a more preferred embodiment of the present invention, the above-mentioned Agrobacterium-mediated transformation method can be replaced by a gene gun or virus-mediated method.
[0078] In a preferred embodiment of the present invention, the CRISPR-Cas9 gene editing system includes sgRNA; the sgRNA includes components that simultaneously target the above-mentioned... GmD14a Genes and the above GmD14b The sgRNA1 and / or sgRNA2 of the gene; wherein the nucleotide sequence of the above-mentioned sgRNA1 is SEQ ID NO:3; and the nucleotide sequence of the above-mentioned sgRNA2 is SEQ ID NO:4.
[0079] sgRNA1 and sgRNA2 were designed to be recognizable GmD14a and GmD14bThe highly conserved target sequence in the gene, with its target site located in the homologous region of both genes, allows a single sgRNA to simultaneously bind to and cleave the DNA of both genes, achieving co-editing of two genes. The sequences SEQ ID NO: 3 and SEQ ID NO: 4 have complementary pairing capabilities, forming a complex with the Cas9 protein to induce double-strand breaks, thereby triggering mutations in both genes in a single transformation event. This significantly improves editing efficiency, reduces the workload of screening regenerated plants, and enhances the reproducibility of mutant phenotypes.
[0080] It should be noted that, GmD14a and GmD14b The genes have high homology and essentially the same nucleotide sequence, so sgRNA1 and sgRNA2 can target the same gene simultaneously. GmD14a and GmD14b Designing sgRNA sequences based on the target gene sequence is a conventional method in the art. Any sgRNA capable of knocking out and inactivating the target gene of this application is applicable to this invention.
[0081] The present invention will be further described in detail below with reference to specific embodiments, which should not be construed as limiting the scope of protection claimed by the present invention.
[0082] Example 1: Construction of a soybean gene editing vector
[0083] The genome number Glyma.14g089000 was downloaded from the soybean genome database (https: / / phytozome-next.jgi.doe.gov / , version Glycinemax Wm82.a2.v1, Phytozome genome ID: 275). GmD14a Gene (named in this embodiment) G14 ) and gene number Glyma.17g235300 GmD14b Gene (named in this embodiment) G17 The genome sequence of the gene was obtained. Two guide RNAs were designed using CRISPR-P 2.0 software (http: / / crispr.hzau.edu.cn / CRISPR2 / ). gRNA1, TGTAGTTGCGGGTGAAGTAA (SEQ ID NO: 3), and gRNA2, TGAGGATGAGTTTGGAGAAG (SEQ ID NO: 4), both target two homologous genes and are expected to cause gene mutations.
[0084] The first step, based on the DN001 plasmid constructed in our laboratory (the preparation method of the plasmid can be found in patent application CN118147157A), uses... Pme I, EcoThe RI restriction site was used to digest the 8279bp fragment. Based on the pHSE401 plasmid (plasmid information can be found in the literature Hui-Li Xing, Li Dong, Zhi-Ping Wang, Hai-Yan Zhang, Chun-Yan Han, Bing Liu, Xue-Chen Wang and Qi-Jun Chen. (2014) BMC Plant Biology, 14:327-338), the vector backbone containing the Hyg gene was excised using PmeI, EcoRI, and NdeI restriction enzymes, and a 7955bp fragment was recovered. The two fragments were ligated using T4 DNA ligase (TransGold, FL101-02) to obtain plasmid pSSE401.
[0085] The second step involved using the pDT1DT2 plasmid as a template (plasmid information can be found in the literature Hui-Li Xing, Li Dong, Zhi-Ping Wang, Hai-Yan Zhang, Chun-Yan Han, Bing Liu, Xue-Chen Wang and Qi-JunChen. (2014) BMC Plant Biology, 14:327-338), and primers S1F and S1R, and S2F and S2R, respectively, to amplify PCR fragments containing gRNA1 and gRNA2; Bsa The plasmid JM003 was obtained by digestion and ligation with I restriction enzyme and T4 DNA ligase.
[0086] Among them, S1F (SEQ ID NO: 5) is AATATGGTCTCGATTGGTAGTTGCGGGTGAAGTAAGTT;
[0087] S1R (SEQ ID NO: 6) is ATTATTGGTCTCGAAACCTTCTCCAAACTCATCCTCAA;
[0088] S2F (SEQ ID NO: 7) is TGGTAGTTGCGGGTGAAGTAAGTTTTAGAGCTAGAAATAGC;
[0089] S2R (SEQ ID NO: 8) is AACCTTCTCCAAACTCATCCTCAATCTCTTAGTCGACTCTAC.
[0090] Third step, use PmeThe plasmid JM003 was digested with enzyme I, and the 15603 bp fragment was recovered. Using pZHW503 as a template (plasmid information can be found in the literature Wenbo Pan, Zhentao Cheng, Zhiguo Han, Hong Yang, Wanggen Zhang, Huawei Zhang. Efficient genetic transformation and CRISPR / Cas9-mediated genome editing of watermelon assisted by gene encoding developmental regulators. J Zhejiang Univ Sci B. 2022, 23(4):339-344.), the ubiquitin10p-AtGRF5-hspt sequence was amplified. The primers were as follows:
[0091] S15F (SEQ ID NO: 9) is: GTCAAACACTGATAGTTTGATCAGGATATTCTTG;
[0092] S15R (SEQ ID NO: 10) is: ACTTAGACTCATCATCTGTTAATCAGAAAAACTC;
[0093] S16F (SEQ ID NO: 11) is: TTTTCTGATTAACAGATGATGAGTCTAAGTGGAAGTAGCGGGA;
[0094] S16R (SEQ ID NO: 12) is: TCCCGCCTTCAGTTTCTTTATCTTTAATCATATTCCATAGTCCA.
[0095] The enzyme digestion products and PCR products were ligated using the Vazyme cloning kit to obtain plasmid JM007 (see...). Figure 1 ).
[0096] The recombinant plasmid was transformed into *E. coli* strain DH5α, plated on LB agar plates containing 50 μg / mL kanamycin, and incubated overnight at 37°C. Single colonies were selected, and their sequence accuracy was verified by sequencing conducted by Beijing Qingke Biotechnology Co., Ltd. Sequencing confirmed the successful construction of the soybean gene-editing vector.
[0097] Example 2: Agrobacterium-mediated genetic transformation of soybean
[0098] Agrobacterium genetic transformation was carried out using soybean variety Williams 82 (abbreviated as W82) as recipient material (see patent application CN118147157A for reference).
[0099] Seed sterilization: Select soybean seeds with smooth surfaces, no disease spots, and intact seed coats. Place the seeds in a petri dish, and put the petri dish desiccator in a fume hood. Add 100 ml of sodium hypochlorite and 3.5 ml of hydrochloric acid to the petri dish and sterilize overnight for 10-16 hours. Remove the sterilized soybeans and place them in a clean bench to allow the chlorine to dissipate completely. Seed germination: Germinate the sterilized soybean seeds on germination medium (Germ) at room temperature in the dark for 16-24 hours.
[0100] Preparation of bacterial culture: Agrobacterium, taken from a -80°C freezer, was spread onto YEB plates containing the corresponding antibiotic and incubated in the dark at 28°C for 2 days. Resistant colonies were observed. Single colonies of Agrobacterium were picked and inoculated into 5 ml of YEB liquid medium containing the corresponding antibiotic, and incubated at 28°C and 220 rpm for 8 hours. 300 µl of the above culture was transferred to 250 ml of YEB liquid medium containing the corresponding antibiotic and incubated overnight at 28°C and 220 rpm until OD660 = 0.5-1.0. The culture was then centrifuged at 5000 rpm for 6 min, resuspended in infection medium (Inf), and the bacterial concentration was adjusted to OD660 = 0.5-0.8.
[0101] Explant preparation: Use tweezers to pick up germinating soybean seeds. Make a transverse cut on the hypocotyl 2 mm below the cotyledon node, removing part of the hypocotyl and radicle. Carefully separate the cotyledons along the suture between the two cotyledons with a scalpel, retaining one cotyledon with the hypocotyl and plumule. Under a microscope, use a scalpel to remove the growing point of the pair of true leaves and plumule. Quickly immerse the explants in the prepared infection solution.
[0102] Co-culture: Soybean explants infected in the infection solution for 2 hours were transferred to co-culture medium (CCM) and cultured in the dark at 23°C for 4-5 days. Recovery culture: The co-cultured explants were transferred to recovery medium and cultured in the dark at 26°C for 7 days under 16 / 8h light / dark conditions.
[0103] Shoot induction and selection culture (Sel): Explants that have undergone recovery culture were transferred to shoot induction and selection culture medium and cultured at 26 degrees Celsius for 3 weeks under 16 / 8h light and dark conditions, resulting in the emergence of a large number of shoots.
[0104] Bud elongation culture: Cotyledons were removed, and explant blocks with numerous clustered buds were transferred to bud elongation medium to induce transgenic bud elongation. Subculture was performed every 2 weeks, and buds that began to elongate were transferred to elongation medium without selection agent. Culture conditions were the same as for clustered bud induction.
[0105] Soil-based rooting culture: When the buds on the explant block elongate to more than 3 cm, cut off the other buds that have not elongated, leaving only the elongated buds. Transplant them into the soil of small nutrient pots, cover them with plastic covers (cups), and cultivate them at 26 degrees Celsius under 16 / 8h light and dark conditions until new leaves or new roots grow. Gradually remove the plastic covers (cups) during the hardening-off process.
[0106] Example 3: Molecular detection of regenerated soybeans
[0107] DNA was extracted from soybean leaves using the SDS method for mutation detection of target genes. The specific extraction method was as follows:
[0108] 1. Take 0.1-0.3g of soybean leaves, put them into a 2ml centrifuge tube containing steel balls, freeze them in liquid nitrogen for 1-2 minutes, and then grind them into powder using a tissue homogenizer.
[0109] 2. Add 600µl of DNA extraction buffer (1.25% SDS), vortex or invert to mix, then place in a 65℃ water bath for 45 minutes, shaking several times in between to ensure complete lysis of the leaf tissue.
[0110] 3. Remove from the oven and place in a 4°C refrigerator to cool the tubes for 15 minutes. Then add 300µL of 6M ammonium acetate and mix well. Let stand in the 4°C refrigerator for 15 minutes.
[0111] 4. Centrifuge at 12000 rpm, 10℃ for 10 min. Using a 1000µL pipette, transfer the supernatant to a new 1.5ml centrifuge tube, add 360µL of isopropanol, gently invert several times until mixed, and then let stand for 5 minutes.
[0112] 5. Centrifuge at 12000 rpm and 10℃ for 10 minutes. After centrifugation, discard the upper layer of liquid.
[0113] 6. Add 400µL of 70% alcohol, invert the container to gently wash up the DNA at the bottom, centrifuge at 12000 rpm, 10℃ for 10 min, discard the supernatant after centrifugation, and repeat the washing once.
[0114] 7. Open the lid in a clean bench and allow the precipitate to air dry (approximately 2 hours). Add 40 µl of ddH2O to dissolve the DNA, and store at -20°C for later use.
[0115] Specific primers were designed based on the gene sequence to amplify fragments containing two gRNA target genes. Glyma.14g089000 ( G14 The amplification primers for ) are H40 and H43; Glyma.17g235300 ( G17The amplification primers for ) are H40 and H42.
[0116] Among them, H40 (SEQ ID NO: 13) is: ATGGGCACTTCCATTCTCG; H43 (SEQ ID NO: 14) is: GAAGTTGTGACTCGAACAGA; H42 (SEQ ID NO: 15) is: CAAGCGCTAATTGCTCCTAT.
[0117] The amplification reaction system was as follows: 2×Rapid Taq Master Mix, 15µL; primer F (10µM), 1µL; primer R (10µM), 1µL; genomic DNA, 50 ng; add ddH2O to 30µL.
[0118] The amplification reaction program was as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 70℃ extension for 30 s, for a total of 32 cycles, 72℃ extension for 10 min, and storage at 16℃.
[0119] Take 3.5 µL of PCR product for electrophoresis (1% agarose gel, TAE electrophoresis solution), and select samples with specific amplified bands for sequencing.
[0120] The gene fragments of the mutant material and the recipient soybean were analyzed and compared using SnapGene software (SnapGene, version 4.2.4) to obtain the specific mutation sites. Figure 2 ).
[0121] Implementation Case 4: Agronomic Trait Testing of Soybeans
[0122] Soybean W82 and mutant soybean g14, g14g17 -1 and g14g17 -2 Soybeans were grown in an intelligent glass greenhouse at the Institute of Modern Agriculture, Peking University, and managed according to conventional soybean cultivation and management practices. At maturity, plant height, number of branches, number of pods, and number of beans were statistically analyzed.
[0123] At the soybean maturity stage, the plant height of wild-type soybean W82 and mutant soybean were measured respectively, and one-way ANOVA was performed using SPSS (IBM SPSS Statistics 27.0.1) software. p =0.05). Wild-type soybean W82 and g14 The average plant heights of the mutants were 96.2±6.7 cm and 91.7±5.4 cm, respectively. g14g17-1 and g14g17-2 With wild type W82 and g14 Both measurements showed significant differences, being 55.8 ± 2.8 cm and 55.1 ± 6.3 cm, respectively. Figure 3 ).
[0124] The number of branches in mature soybean materials was statistically analyzed separately for the first, second, and third branches. One-way ANOVA was performed using SPSS (IBM SPSS Statistics 27.0.1) software. p =0.05). Double mutant g14g17-1 and g14g17-2 Compared to wild-type W82 and g14 Significantly increased branching, with marked differences ( Figure 4 ).
[0125] The total number of pods per plant was counted for wild-type and mutant soybeans. One-way ANOVA was performed using SPSS (IBM SPSS Statistics 27.0.1) software. p =0.05). Double mutant g14g17-1 and g14g17-2 Compared to wild-type W82 and g14 Significantly increased, with marked differences. Wild-type W82 and g14 The total number of pods per plant did not differ significantly between wild-type W82 and gene-edited soybeans. g14 , g14g17-1 and g14g17-2 The average total number of pods per plant was 133.7±8.1, 191.3±25.1, 381.2±63.3, and 363.2±67.7, respectively. Figure 5 ).
[0126] The number of soybeans per plant at maturity was determined using one-way ANOVA with SPSS (IBM SPSS Statistics 27.0.1) software. p =0.05). Wild-type W82, gene-edited soybean. g14 , g14g17-1 The average total number of seeds per plant for the mutant soybeans g14g17-2 was 350.7±51.8, 430.2±51.7, 496.5±89.2, and 518.9±103.6, respectively. The average total number of seeds per plant for all three mutant soybeans differed significantly from that of the wild-type W82. Figure 6 ).
[0127] At the soybean maturity stage, the 100-seed weight of wild-type soybeans and gene-edited soybeans was analyzed. One-way ANOVA was performed using SPSS (IBM SPSS Statistics 27.0.1) software (p=0.05). Wild-type W82 and gene-edited soybeans... g14 , g14g17-1 and g14g17-2The 100-seed weights were 15.7±0.8 g, 14.8±1.0 g, 14.5±0.9 g, and 14.5±1.2 g, respectively. The 100-seed weight of wild-type soybean was slightly higher than that of the three mutant soybeans, but the difference was not significant (see [link to relevant documentation]). Figure 7 ).
[0128] Based on the average total number of seeds per plant and average weight per 100 seeds of soybeans, the calculated value of (average total number of seeds per plant x average weight per 100 seeds / 100) is recorded as the yield per plant. The average yield per plant for wild-type soybean W82 is 55.0 grams. (Gene-edited soybeans...) g14 , g14g17-1 and g14g17-2 The average yield per plant was 63.2 g, 71.9 g and 75.1 g, respectively, all of which were higher than the average yield per plant of wild soybean (Table 2).
[0129] Table 2 Calculation of soybean yield per plant
[0130]
[0131] As can be seen from the above description, the embodiments of the present invention achieve the following technical effects: The present invention achieves the following technical effects by knocking out the... GmD14 Genes (e.g., GmD14a and / or GmD14b The method obtains plants with loss-of-function mutations in the aforementioned genes, thereby synergistically reducing plant height, increasing the number of branches, pods, and beans, and improving yield per plant without changing the 100-seed weight.
[0132] This method does not require the introduction of exogenous functional genes or reliance on traditional hybridization breeding. It is simple to operate and highly targeted, significantly improving the efficiency of soybean agronomic trait improvement. It provides a gene editing technology path that can be applied on a large scale for creating new high-yielding soybean germplasm with short stalks, multiple branches, and high pod number. It has important practical value and strategic significance for breaking through the bottleneck of soybean yield per unit area in my country and enhancing the ability to independently control germplasm sources.
[0133] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. A kind GmD14 The application of genes in regulating soybean agronomic traits is characterized by, The agronomic traits include any one or more of the following: plant height, number of branches, number of pods, number of beans, weight per 100 beans, or yield per plant.
2. The application according to claim 1, characterized in that, Knock out soybeans GmD14 Gene.
3. The application according to claim 2, characterized in that, The application includes: GmD14 The gene is selected from any one or more of the following genes: GmD14a Gene or GmD14b Gene; Among them, the GmD14a The nucleotide sequence of the gene is SEQ ID NO: 1; GmD14b The nucleotide sequence of the gene is SEQ ID NO:
2.
4. The application according to claim 3, characterized in that, Knock out the following methods or one of the following methods GmD14a Gene: 11) Five bases are deleted from positions 121-125 of the nucleotide sequence of SEQ ID NO: 1; 12) A deletion of 5 bases at positions 121-125 and a deletion of 2 bases at positions 340-341 of the nucleotide sequence of SEQ ID NO: 1; or 13) Thirteen bases are deleted at positions 117-129 of the nucleotide sequence of SEQ ID NO:
1.
5. The application according to claim 3, characterized in that, Knock out the following method GmD14b Gene: One base G is inserted at position 121 of the nucleotide sequence of SEQ ID NO: 2 and 18 bases are deleted at positions 340-357 of the nucleotide sequence of SEQ ID NO:
2.
6. The application according to claim 3, characterized in that, Knock out the following methods or methods GmD14a Genes and the GmD14b Gene: 21) Five bases are deleted from positions 121-125 of the nucleotide sequence of SEQ ID NO: 1; Two bases are deleted at positions 340-341 of the nucleotide sequence of SEQ ID NO: 1; A base G is inserted at position 121 of the nucleotide sequence of SEQ ID NO: 2; and The nucleotide sequence of SEQ ID NO: 2 has 18 bases deleted at positions 340-357; or 22) Thirteen bases are deleted from positions 117-129 of the nucleotide sequence of SEQ ID NO: 1; A base G is inserted at position 121 of the nucleotide sequence of SEQ ID NO: 2; and The nucleotide sequence of SEQ ID NO: 2 has 18 bases deleted at positions 340-357.
7. The application according to any one of claims 2-6, characterized in that, The application includes: performing the knockout using the CRISPR-Cas9 gene editing system.
8. The application according to claim 7, characterized in that, The CRISPR-Cas9 gene editing system includes sgRNA; the sgRNA includes components that simultaneously target the... GmD14a Genes and the GmD14b sgRNA1 and / or sgRNA2 of the gene; The nucleotide sequence of sgRNA1 is SEQ ID NO: 3; the nucleotide sequence of sgRNA2 is SEQ ID NO: 4.
Citation Information
Patent Citations
Soybean genetic transformation method
CN118147157A