Application of blueberry VdDELLA2 gene in improving plant salt tolerance

Abstract

The application discloses a blueberry VdDELLA2 application in improving plant salt tolerance, belongs to the field of plant genetic engineering and biotechnology; the nucleotide sequence of the blueberry VdDELLA2 gene is shown as SEQ ID NO. 1. In transgenic Arabidopsis thaliana overexpressing the VdDELLA2 gene, VdDELLA2 the gene can significantly enhance the salt stress tolerance of Arabidopsis thaliana, significantly reduce the damage of salt stress to plants, promote the normal growth of plants under salt stress, and has important research value and application prospect for cultivating salt-tolerant new materials.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to blueberries. VdDELLA2 Application of genes in improving plant salt tolerance. Background Technology

[0002] blueberry( Vaccinium Blueberries (spp.) are acid-loving plants, extremely particular about soil pH, aeration, and temperature. Therefore, by exploring salt-tolerant genes in blueberries and accelerating the cultivation of salt-tolerant blueberries adapted to saline-alkali lands, and vigorously developing specialized blueberry agriculture in saline-alkali areas, we can not only effectively reduce production costs and boost the regional blueberry industry, but also improve the productivity of saline-alkali lands.

[0003] DELLA protein belongs to a subfamily of plant GRAS transcriptional regulators. It primarily regulates downstream gene expression through interactions with other transcription factors, playing a crucial role in regulating plant growth, development, and responses to abiotic stresses. It has been identified and analyzed in most species. DELLA protein is a core negative regulator of gibberellin (GA) signaling. Under normal conditions, at the cellular level, GA-insensitive dwarf 1 (GID1) binds to biologically active GA. A conformational change in GID1 allows it to bind to DELLA protein, forming a GA-GID1-DELLA trimeric complex. After labeling with the SCF (SKP1-CUL1-F-box) complex, DELLA protein is finally degraded by the 26S proteasome, thus relieving DELLA's inhibitory effect on plant growth. Salt stress disrupts plant physiological processes, causing osmotic stress, ion imbalance, and oxidative damage, thereby impairing growth and development. Decreased GA levels and signal transduction have been shown to contribute to growth restriction in plants exposed to various stresses, including salt, while GA regulates plant growth under abiotic stress conditions through DELLA protein-mediated growth inhibition. Under salt stress, Arabidopsis enhances the salt tolerance of its seedlings by inducing protoxenum discontinuity through a DELLA protein-dependent mechanism. In Arabidopsis, overexpression of the mango DELLA protein gene... MiSLR1 and MiSLR2 The transgenic plants exhibited improved seed germination rate, root length, and survival rate under salt and drought stress. These studies demonstrate that DELLA can directly or indirectly participate in the plant's salt stress response and play an irreplaceable role.

[0004] Currently, there are relatively few reports on the salt tolerance function of DELLAs in woody fruit trees, indicating a broad research prospect. Therefore, this study uses the blueberry sequencing variety Evergreen Blueberry as the research object and combines genetic engineering technology with molecular biology technology to analyze the salt tolerance mechanism regulated by VdDELLA2, providing a theoretical basis and technical support for the subsequent development of salt-tolerant plants using VdDELLA2 as a molecular switch. Summary of the Invention

[0005] The purpose of this invention is to provide a blueberry VdDELLA2 Application of genes in improving plant salt tolerance.

[0006] To achieve the above objectives, the technical solution of the present invention is as follows: This invention relates to the sequencing of the blueberry variety evergreen blueberry ( Vacciniumdarrowii A discovery was made in Vd) VdDELLA2 Genes, the blueberry VdDELLA2 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein it encodes is shown in SEQ ID NO.2.

[0007] During the resistance screening process, this invention discovered that blueberries... VdDELLA2 Genes can enhance the salt tolerance of plants, so the primary objective of this invention is to provide the aforementioned blueberry. VdDELLA2 Application of genes in improving plant salt tolerance.

[0008] The functions of the genes protected by this invention include not only those described above. VdDELLA2 The gene, including the function of homologous genes with high homology (such as above 80%; more preferably above 90%; more preferably above 95%; more preferably above 98%) in improving plant salt tolerance.

[0009] Contains blueberries VdDELLA2 Gene overexpression vector pK2GW7-eYGFP- VdDELLA2 It also enhances the salt tolerance of plants. The constructed plant expression vectors can be directly used for Agrobacterium-mediated crop genetic transformation to create new salt-tolerant plant varieties, which can be used for crop improvement.

[0010] To improve the desirable traits of plants, this invention also discloses a method for improving the salt tolerance of plants, wherein the aforementioned... VdDELLA2 Genes are introduced into a target plant to obtain transgenic plants, which exhibit higher salt tolerance than the target plant.

[0011] Specifically, VdDELLA2Specifically, the gene can be introduced into the target plant via the overexpression vector. In this method, the overexpression vector can be transformed into plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, and Agrobacterium-mediated transformation, and the transformed plant tissues can be cultured into plants.

[0012] In addition, a plant breeding method is also disclosed, the method being as follows (1) and (2): (1) By increasing the activity of VdDELLA2 protein in the target plant, plants with higher salt tolerance than the target plant were obtained; (2) By promoting the growth of target plants VdDELLA2 Gene expression was used to obtain plants with higher salt tolerance than the target plant.

[0013] Among them, promoting the target plant VdDELLA2 Gene expression is achieved through methods including... VdDELLA2 Genes are introduced into the target plant or strong promoters or enhancers are introduced.

[0014] Preferably, the target plant is Arabidopsis thaliana or blueberry.

[0015] In this invention, there are no particular limitations on the plants suitable for gene transformation, as long as they are suitable for gene transformation operations, such as various crops, flowering plants, or forestry plants. The plants may be (but are not limited to): dicotyledons, monocotyledons, or gymnosperms.

[0016] As one implementation method, the "plant" or "target plant" includes, but is not limited to, Arabidopsis thaliana and blueberry; any gene possessing this gene or a homologous gene is applicable. It is particularly suitable for plants requiring improved salt tolerance. In practical applications, for plants requiring improved salt tolerance, strains incorporating this gene can be cultivated through transgenic methods.

[0017] The term "plant" as used in this invention includes the whole plant, its parent and offspring plants, and different parts of the plant, including seeds, fruits, buds, stems, leaves, roots (including tubers), flowers, tissues, and organs, all of which contain our target gene or nucleic acid. The term "plant" also includes plant cells, suspension cultures, callus tissue, embryos, meristematic regions, gametophytes, sporophytes, pollen, and microspores; similarly, each of these objects contains the target gene / nucleic acid.

[0018] This invention includes any plant cell, or any plant obtained or obtainable by the methods described herein, as well as all plant parts and their propagules. This invention also includes transfected cells, tissues, organs, or whole plants obtained by any of the foregoing methods. The only requirement is that the offspring exhibit the same genotype or phenotypic characteristics, and that offspring obtained using the methods of this patent have identical characteristics.

[0019] This invention also extends to the harvestable parts of the plants as described above, but is not limited to seeds, leaves, fruits, flowers, stems, roots, rhizomes, tubers, and bulbs. It further relates to other derivatives of the plant after harvest, such as dried granules or powders, oils, fats and fatty acids, starches, or proteins. This invention also relates to foods or food additives obtained from the relevant plants.

[0020] Advantages of this invention: This invention uses the blueberry sequencing variety evergreen blueberry ( Vacciniumdarrowii Using Vd as the research material, cloned VdDELLA2 The gene was constructed into the plant expression vector pK2GW7-eYGFP and transformed into Arabidopsis thaliana. Driven by the 35S promoter, the gene was expressed. VdDELLA2 The gene can be overexpressed in Arabidopsis thaliana, and is overexpressed under salt stress compared to wild-type Arabidopsis thaliana. VdDELLA2 Arabidopsis plants showed increased plant height, increased fresh weight, and increased salt tolerance, indicating that VdDELLA2 The gene is an important regulatory gene that enhances the salt stress tolerance of Arabidopsis thaliana and has important application value in the field of plant genetic engineering. It also provides a reference for the research of DELLAs in woody fruit trees and provides new gene resources for improving the salt tolerance of crops. Attached Figure Description

[0021] Figure 1 It is a plant overexpression vector pK2GW7-eYGFP- VdDELLA2 A structural diagram.

[0022] Figure 2 This is an image of eYGFP autofluorescence observed under a handheld UV lamp after genetic transformation.

[0023] Figure 3 It is overexpression VdDELLA2 Image showing the PCR identification and detection of transgenic Arabidopsis thaliana.

[0024] Figure 4 It is overexpression VdDELLA2 A graph showing real-time quantitative detection of transgenic Arabidopsis thaliana at the transcriptional level.

[0025] Figure 5 The wild-type Arabidopsis thaliana cultured in soil for 12 days under salt stress is compared with the overexpressed [symbol / symbol / symbol] in Example 4 of this invention. VdDELLA2Phenotypic comparison of transgenic Arabidopsis thaliana (#OE1, #OE2, #OE6).

[0026] Figure 6 The wild-type Arabidopsis thaliana cultured in soil for 12 days under salt stress is compared with the overexpressed [symbol / symbol / symbol] in Example 4 of this invention. VdDELLA2 A comparison of plant heights of transgenic Arabidopsis thaliana (#OE1, #OE2, #OE6).

[0027] Figure 7 The wild-type Arabidopsis thaliana grown for 12 days under normal growth conditions and salt stress treatment is compared with the overexpressed [symbol / ... VdDELLA2 Fresh weight comparison of transgenic Arabidopsis thaliana (#OE1, #OE2, #OE6).

[0028] Figure 8 The wild-type Arabidopsis thaliana grown for 12 days under normal growth conditions and salt stress treatment is compared with the overexpressed [symbol / ... VdDELLA2 Potassium ion content, sodium ion content, and potassium-sodium ion ratio in transgenic Arabidopsis thaliana (#OE1, #OE2, #OE6). Detailed Implementation

[0029] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, unless otherwise specified, the specific experimental methods involved in the following embodiments are conventional methods or implemented according to the conditions recommended in the manufacturer's instructions.

[0030] Unless otherwise specified, the techniques used in the embodiments are conventional methods well known to those skilled in the art. Unless otherwise specified, the experimental methods in the following embodiments are all conventional methods. Unless otherwise specified, the reagents and materials used can be purchased commercially.

[0031] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0032] Example 1: Blueberries VdDELLA2 Cloning of genes Using 3-month-old evergreen blueberry tissue culture seedlings as material, total RNA was extracted using the FastPure Plant Total RNA Isolation Kit (NovaZyn Biosciences Co., Ltd.). 1.0 µg of RNA was taken from each sample and analyzed using PrimeScript. TMThe RT reagent kit (Perfect Real Time) (Takara Bio Engineering (Dalian) Co., Ltd.) was used to synthesize the first strand of cDNA, based on data from the evergreen blueberry database. VdDELLA2 Primers were designed based on the gene's CDS (Coding Sequence) for amplification, PCR was performed, the amplification product was recovered and subjected to a BP reaction, and... VdDELLA2 Genes were constructed into the Gateway introductory vector pDONR207; Forward primer F1: GGGGACAAGTTTGTACAAAAAAGCAGGCTACATGAAGAGAGATCGTGAAAGG (SEQ ID NO.3); Reverse primer R1: GGGGACCACTTTGTACAAGAAAGCTGGGTCAGACTCGGTGGTAGCGAGTTG (SEQ ID NO. 4).

[0033] The BP reaction system was as follows: 75 ng of PCR product, 150 ng of pDONR207 vector, 0.8 μL of BP Clonase II enzyme, and ddH2O to a final volume of 3 μL; the reaction conditions were 25℃ for at least 3 h.

[0034] Transformation was performed using the freeze-thaw method into competent E. coli DH5α cells. Positive clones were picked from selection plates containing gentamicin for PCR detection and sequencing verification. VdDELLA2 The gene was constructed into the entry vector pDONR207 via the Gateway system, and the final gene CDS sequence length was 1746 bp, named... VdDELLA2 The gene, CDS sequence is shown in SEQ ID NO.1, and amino acid sequence is shown in SEQ ID NO.2.

[0035] Example 2: VdDELLA2 Construction of plant gene expression vectors The LR reaction system is as follows: pDONR207- VdDELLA 2 75 ng, pK2GW7-eYGFP vector 150 ng, LRClonase II enzyme 0.8 μL, TE buffer (pH 8.0) to 3 μL; reaction conditions: 25℃ for at least 3 h; Transformation was performed using the freeze-thaw method into competent E. coli DH5α cells. Positive clones were picked from selection plates containing gentamicin for PCR detection and sequencing verification. VdDELLA2 Genes were constructed from the initial vector to the plant expression vector pK2GW7-eYGFP; After the LR reaction, VdDELLA2The gene was introduced into the plant expression vector pK2GW7-eYGFP, such as... Figure 1 As shown, starting from the left-handed twisting at the apex, they are respectively the strong terminator NOS, and the one resistant to kanamycin. NPTⅡ Gene, NOS promoter, promoter 35S, COR47-5' UTR, enhanced fluorescent protein eYGFP, HSP-T878, promoter 35S and target gene VdDELLA2 PCR detection and sequencing confirmed the successful construction of the overexpression vector, which was named pK2GW7-eYGFP- VdDELLA2 .

[0036] Example 3: VdDELLA2 Genetic transformation The constructed pK2GW7-eYGFP- was subjected to thermal shock. VdDELLA2 The overexpression vector was transformed into Agrobacterium GV3101, and the expression was carried out via Agrobacterium-mediated flower dipping method. VdDELLA2 Genes were transferred into Arabidopsis thaliana.

[0037] Arabidopsis flower buds were soaked in a solution containing pK2GW7-eYGFP- VdDELLA2 Agrobacterium overexpression vector resuspension (OD) 600 = 0.8-1.0) for 90 seconds, after which the Arabidopsis plants were placed in the dark overnight, and then transferred to normal culture conditions (25±3℃, 16 hours light / 8 hours dark) for culture. The seeds were collected after full maturity. After sterilization, the seeds were sown in a clean bench in a solution containing 50 mg / mL K + In MS solid medium, with wild-type Arabidopsis seeds as a negative control, the seedlings were vernalized at 4°C for 2 days and then cultured under normal conditions. Since the overexpression vector contains eYGFP enhanced fluorescent protein, Arabidopsis seedlings can be irradiated with a handheld UV lamp; if the vector is successfully transformed, autofluorescence can be observed. Figure 2 As shown, the left image shows wild-type Arabidopsis seedlings that do not fluoresce under handheld UV light, while the right image shows transgenic Arabidopsis seedlings that fluoresce under handheld UV light. DNA was extracted from leaves of rooted plants that exhibited autofluorescence and was identified by PCR to further confirm whether they were transgenic plants.

[0038] Following the experimental method of Example 3, leaf DNA was extracted from the six fluorescent resistant lines obtained. PCR amplification was performed using a vector fragment as the forward primer and the gene as the reverse primer. The vector plasmid served as a positive control, while wild-type Arabidopsis and H2O served as negative controls. Based on the band size detected by electrophoresis, all six fluorescent lines were confirmed to be positive plants. Figure 3 As shown; based on the results of real-time quantitative PCR, such as Figure 4As shown, #OE1, #OE2, and #OE6, which had the highest transcriptional expression levels, were selected for subsequent salt tolerance experiments.

[0039] Example 4: VdDELLA2 Verification of the salt tolerance function of the gene Wild type (WT) and VdDELLA2 Overexpressing Arabidopsis thaliana seeds (#OE1, #OE2, #OE6) were sown on MS solid medium and vernalized at 4℃ for 2 days. After being cultured under normal conditions until two true leaves emerged, the seeds were transplanted into nutrient soil. The control group was watered normally, while the treatment group was irrigated with 200 mM NaCl solution.

[0040] like Figure 5 The figure shows a phenotypic comparison between the control group (normal watering for 12 days) and the treatment group (watered with 200 mM NaCl solution for 12 days); Figure 6 As shown in the figure, the plant height and fresh weight are compared between the control group that received normal watering for 12 days and the treatment group that received 200 mM NaCl solution for 12 days; Figure 7 The image shows a comparison of the fresh weight of the control group (watered normally for 12 days) and the treatment group (watered with 200 mM NaCl solution for 12 days). Figure 8 As shown, the potassium ion (K) levels in the control group (normal watering for 12 days) and the treatment group (watered with 200 mM NaCl solution for 12 days) were significantly different. + ) content, sodium ions (Na + Content of potassium and sodium ions, ratio of potassium to sodium ions (K) + / Na + (Comparison chart). By comparing the growth phenotypes of the experimental group with normal watering and the control group irrigated with 200 mM NaCl solution, it was found that under normal culture conditions, overexpression... VdDELLA2 The plant height and fresh weight of Arabidopsis thaliana were significantly lower than those of wild-type Arabidopsis thaliana under salt stress, while the plant height, fresh weight, and overexpression of wild-type Arabidopsis thaliana were significantly lower. VdDELLA2 Compared to wild-type Arabidopsis, the expression level was significantly lower; furthermore, potassium and sodium ion content measurements showed that, compared to wild-type Arabidopsis, overexpression under salt stress was significantly lower. VdDELLA2 K in Arabidopsis leaves + The content increased significantly, Na + The content increased significantly and decreased significantly, K + / Na + Similarly, a significant increase; all the above results indicate that... VdDELLA2 Overexpression of this substance enhances Arabidopsis' tolerance to salt stress and plays an important regulatory role in this process.

[0041] This invention will... VdDELLA2 Genes transferred into Arabidopsis thaliana showed overexpression under salt stress compared to the wild type. VdDELLA2 The Arabidopsis thaliana with the gene showed increased plant height, increased fresh weight, and increased salt tolerance, indicating that VdDELLA2 The gene is an important regulatory gene that enhances the salt stress tolerance of Arabidopsis thaliana and has important application value in the field of plant genetic engineering. It also provides a reference for the study of DELLAs in woody fruit trees.

[0042] The embodiments described above are merely preferred embodiments of the present invention and are only used to explain the present invention. They are not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.

Claims

1. Blueberries VdDELLA2 The application of genes in improving plant salt tolerance is characterized by, The blueberries VdDELLA2 The nucleotide sequence of the gene is shown in SEQ ID NO.

1. Overexpression of the blueberry VdDELLA2 The plant exhibited improved salt tolerance after gene modification; the plant in question is Arabidopsis thaliana.

2. The application according to claim 1, characterized in that, By constructing the overexpression vector pK2GW7–eYGFP– VdDELLA2 The transgenic Arabidopsis thaliana was introduced into Arabidopsis thaliana to obtain transgenic Arabidopsis thaliana overexpressed with higher salt tolerance than wild type.

3. The application according to claim 2, characterized in that, Starting with wild-type Arabidopsis thaliana, the overexpression vector pK2GW7-eYGFP- was constructed using a heat shock method. VdDELLA2 Transfected with Agrobacterium GV3101, and then subjected to Agrobacterium-mediated flower dipping method. VdDELLA2 Genes were transferred into Arabidopsis thaliana and overexpressed through resistance selection. VdDELLA2 Transgenic Arabidopsis thaliana.

4. The application according to claim 1, characterized in that, Under salt stress, compared with the wild type, overexpression VdDELLA2 Transgenic Arabidopsis thaliana plants showed increased height, increased fresh weight, and higher potassium content in leaves. + The content increased significantly, Na + The content was significantly reduced, K + / Na + Significant increase.

5. A plant breeding method, characterized in that, The method is as follows (1) or (2): (1) By increasing the activity of VdDELLA2 protein in the target plant, plants with stronger salt tolerance than the target plant were obtained; (2) By promoting the growth of target plants VdDELLA2 Gene expression was used to obtain plants with stronger salt tolerance than the target plant. The VdDELLA2 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence of the VdDELLA2 protein is shown in SEQ ID NO.2; the target plant is Arabidopsis thaliana.

6. The method according to claim 5, characterized in that, Promote the target plant VdDELLA2 The gene is expressed in the form of overexpression. VdDELLA2 Gene.

7. A method for improving the salt tolerance of plants, characterized in that, Will VdDELLA2 Genes were introduced into a target plant to obtain transgenic plants. The transgenic plants exhibited higher salt tolerance than the target plant, which was Arabidopsis thaliana. VdDELLA2 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

Images