A method of obtaining a plant having pink leaves

Abstract

The present application relates to the technical field of gene engineering editing, and particularly relates to a method for obtaining a plant with pink leaves, comprising simultaneously introducing a gene editing element for reducing chlorophyll accumulation and an exogenous expression element for enhancing plant pigment accumulation into a plant cell or plant tissue. By inhibiting carotenoid biosynthesis and reducing chlorophyll accumulation, and simultaneously enhancing the betalain and / or anthocyanin biosynthesis pathway, a stable pink leaf or a phenotype with different pink color gradient is formed, and the precise regulation of plant leaf color is realized. Compared with the prior art, the present application has the advantages of simple operation, high construction efficiency, short breeding cycle, easy acquisition of stable pink phenotype, wide application range and the like.

Description

Technical Field

[0001] This invention relates to the field of gene editing technology, and specifically to a method for obtaining plants with pink leaves. Background Technology

[0002] Plant color is a crucial phenotypic factor in the breeding of horticultural and ornamental plants, its formation primarily depending on the types, amounts, and distribution of various pigments within the plant and in different tissues. Leaf color is mainly determined by chlorophyll, carotenoids, and pigments such as anthocyanins and betalains. Chlorophyll is the primary source of the green phenotype in plants; carotenoids participate in plant coloration and also act as photosynthetic auxiliary and photoprotective pigments to maintain the stable accumulation of chlorophyll; anthocyanins and betalains impart red to purple hues. By coordinating and regulating the accumulation levels of green and red pigments, precise control of leaf color can be achieved. By regulating the biosynthetic pathways of these pigments, plants can exhibit different colors and color gradients, thus becoming a key direction in plant color improvement research.

[0003] Traditional methods for improving plant color primarily rely on conventional hybridization breeding, mutation breeding, or chemical treatments. While these methods have yielded variants of different colors in some species, they typically suffer from long breeding cycles, complex genetic backgrounds, low selection efficiency, and poor trait stability. Furthermore, limitations such as incompatibility in distant hybridization and genetic barriers restrict the rapid and targeted improvement of target traits in many plants through conventional methods. In addition, some chemical treatments may have potential adverse effects on the environment or the plants themselves, limiting their widespread application. Therefore, relying on traditional methods makes it difficult to achieve rapid, precise, and controllable improvement of plant color traits, especially to obtain plant materials with stable pink phenotypes or different pink color gradients.

[0004] In recent years, with the rapid development of molecular biology and genetic engineering, regulating pigment metabolism pathways through methods such as exogenous gene introduction, endogenous gene overexpression, or gene knockout has become an important technical direction for plant color improvement. For example, by regulating the expression of transcription factors in the anthocyanin synthesis pathway, plant leaves or petals can be made to appear red or purple; by introducing genes related to betalain biosynthesis (such as the Ruby gene), red or purple phenotypes can be obtained in some plants. On the other hand, chlorophyll biosynthesis is regulated by a number of key structural genes, such as ChlH and ChlI. In addition, phytopenic lycopene dehydrogenase (PDS) in the carotenoid biosynthesis pathway is also an important rate-limiting enzyme. Weakening or loss of the function of these genes often leads to reduced chlorophyll or plant bleaching, thus significantly affecting the plant's color phenotype.

[0005] Although current technologies can alter plant color through genetic engineering, most studies employ multi-gene, multi-step transformation or stepwise composite material construction strategies. These processes are cumbersome, time-consuming, and often require multiple rounds of screening or genetic backcrossing, leading to problems such as complex genetic backgrounds, severe phenotypic segregation, and unstable progeny traits. Furthermore, existing publicly available technologies primarily focus on obtaining red or purple plants, while reports on pink plants, especially plant materials with adjustable pink color gradients, remain relatively scarce. Summary of the Invention

[0006] To address the lack of a stable and efficient technical system for obtaining pink leaves or plant materials with different pink color gradients in existing technologies, this invention provides a method for obtaining plants with pink leaves. This method simultaneously introduces gene-editing elements and exogenous pigment expression elements to inhibit carotenoid biosynthesis and reduce chlorophyll accumulation, while enhancing the biosynthetic pathways of betalains and / or anthocyanins. This results in stable pink leaves or phenotypes with different pink color gradients, achieving precise control over plant leaf color. Compared with existing technologies, this invention has advantages such as simple operation, high construction efficiency, short breeding cycle, easy acquisition of stable pink phenotypes, and wide applicability.

[0007] The specific technical solution is as follows: A method for obtaining plants with pink leaves includes simultaneously introducing a gene-editing element for reducing chlorophyll accumulation and an exogenous expression element for enhancing plant pigment accumulation into plant cells or plant tissues; wherein the gene-editing element targets a conserved region sequence of a phytoene dehydrogenase gene or a chlorophyll biosynthesis-related gene; and wherein the exogenous expression element is used to express genes related to the betaine biosynthesis pathway and / or genes regulating anthocyanin biosynthesis in the plant tissues.

[0008] By reducing chlorophyll content through gene editing elements to weaken the green background, and by increasing the accumulation of red or purple pigments through the exogenous expression elements, the plant leaves exhibit a pink phenotype.

[0009] Furthermore, the gene editing element includes a Cas protein coding sequence and an sgRNA expression cassette.

[0010] Furthermore, the Cas protein is a Cas9 or Cas12a nuclease.

[0011] Furthermore, the target sequence of the sgRNA is as shown in SEQ ID NO:1, or a variant sequence thereof that does not affect the function of targeting the conserved region of the PDS gene.

[0012] Furthermore, the exogenous expression element includes an expression cassette for expressing a key enzyme in betaine biosynthesis, the key enzyme including one or more of CYP76AD1, DODA, and glycosyltransferase.

[0013] Furthermore, the exogenous expression element includes an Arabidopsis MYB transcription factor expression cassette, used to activate the anthocyanin biosynthesis pathway.

[0014] Furthermore, the gene editing element and the exogenous expression element are constructed in two separate plant expression vectors and introduced into plant cells through co-transformation.

[0015] Furthermore, the gene editing element and the exogenous expression element are constructed in the same binary expression vector or multi-gene expression vector and introduced into plant cells through a single transformation.

[0016] Furthermore, the transformation method includes any one of Agrobacterium-mediated transformation, gene gun transformation, or protoplast transformation.

[0017] Furthermore, the plant with pink leaves is any one of tobacco, tomato, potato, pepper, Arabidopsis thaliana, or ornamental flowering plants.

[0018] The beneficial effects of this invention are as follows: 1. This invention simultaneously introduces a leaf green background weakening module and a plant pigment synthesis enhancement module into the same plant, synergistically regulating the carotenoid synthesis pathway and the betalain or anthocyanin synthesis pathway. This reconstructs the plant pigment composition at the metabolic level, resulting in a pink hue or a color difference phenotype exhibiting varying shades within the plant. Compared to existing technologies that only regulate a single pigment synthesis pathway, this invention avoids color shifts or extreme phenotypes caused by single-pathway regulation through multi-pathway synergistic regulation. It achieves stable expression of the pink phenotype while maintaining normal plant growth and development, significantly reducing the probability of non-target extreme phenotypes such as complete whitening, deep red, or deep purple.

[0019] 2. This invention employs a dual-module synergistic design, combining a green background weakening module and a pigment enhancement module. This allows for the simultaneous synergistic regulation of two metabolic pathways through a single genetic transformation operation, significantly simplifying the technical process of traditional plant polygenic trait improvement, which requires multiple rounds of transformation, stepwise superposition, or backcross screening. This method significantly shortens the breeding cycle, reduces genetic background interference and the risk of trait segregation, and improves the efficiency of obtaining the target phenotype. Furthermore, by adjusting target gene selection, promoter strength, and expression element combinations, the designability and controllability of the pink phenotype in terms of color depth and spatial distribution can be achieved, thereby obtaining plant materials with different pink color difference gradients.

[0020] 3. The method of this invention has good versatility and applicability, and can stably achieve the construction of the target phenotype in Solanaceae plants such as tobacco and black nightshade, as well as model plants such as Arabidopsis thaliana, indicating that this dual-module regulatory strategy is transferable in different plant genetic backgrounds. At the same time, this method is characterized by its simplicity, high transformation efficiency, and good phenotypic stability, making it suitable for various applications such as plant functional gene research, metabolic engineering modification, and targeted improvement of ornamental traits.

[0021] 4. This invention achieves a technological upgrade from single-gene regulation to multi-pathway synergistic regulation through the systematic reconstruction of the plant pigment metabolism network, providing a new technical path for the genetic improvement of plant color, expanding the application space of plant metabolic engineering in the field of ornamental trait creation, and has good prospects for industrial application and promotion value. Attached Figure Description

[0022] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, for those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0023] Figure 1 This is a schematic diagram of the structure of the green background weakening carrier pDC45-NtPDS and the betaine red pigment synthesis enhancing carrier HTBpro-RUBY in Example 1; where a is the green background weakening carrier diagram and b is the plant pigment enhancing carrier diagram.

[0024] Figure 2 The images show the detection results of the RUBY and HPT fragments in the molecular identification of Example 1; where a is the detection result of the RUBY fragment and b is the detection result of the HPT fragment.

[0025] Figure 3 This is a graph showing the NtPDS gene sequencing analysis results in the molecular identification of Example 1; where a is the wild-type detection result and b is the mutant detection result.

[0026] Figure 4 This is a diagram showing the phenotypic observation results of tobacco in the S3 regeneration stage of Example 1; where WT is wild-type tobacco, and P1 to P5 are strains with different pink color numbers.

[0027] Figure 5 The figures show phenotypic observations of pink tobacco plants at different stages in Example 1. The scale bars in the figures all represent 1 cm. Among them, a is pink independent plant 1 in the rooting stage, b is pink plant in the clustering stage, c is pink plant in the vigorous growth stage, and d is pink independent plant 2 in the rooting stage.

[0028] Figure 6This is a schematic diagram of the structure of the bifunctional expression vector pDC45-PAP-PDS in Example 2.

[0029] Figure 7 The graph shows the detection results of the HYB and Cas fragments in the molecular identification of Example 2; where a is the detection result of the HYB fragment and b is the detection result of the Cas fragment.

[0030] Figure 8 The figures show the phenotypic observation results of different pink tobacco strains in Example 2; where a represents the observation results of tobacco during the S3 regeneration stage, and b represents the observation results of tobacco during the rooting stage.

[0031] Figure 9 The graph shows the detection results of the RUBY and Cas fragments in the molecular identification of Example 3; where a is the detection result of the RUBY fragment and b is the detection result of the Cas fragment.

[0032] Figure 10 The image shows the phenotypic observation results of the pink nightshade plants in Example 3; where a represents the phenotypic observation results of pink line 1 and b represents the phenotypic observation results of pink line 2. Detailed Implementation

[0033] To enable those skilled in the art to better understand the technical solutions of this invention, the technical solutions of the embodiments of this invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of this invention, and not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of this invention.

[0034] This invention provides a method for obtaining plants with pink leaves, specifically including the following steps: S1, Green Background Reduction Module Construction This module targets and regulates key genes in the chlorophyll and / or carotenoid biosynthesis pathways, weakening the green background of the plant as a whole or specific tissues. This provides a more prominent background for pigments such as betalains or anthocyanins, promoting the formation of a pink phenotype. Target genes are preferably key enzyme genes in the carotenoid synthesis pathway, such as phytopenic oleoresin (PDS), or chlorophyll biosynthesis-related genes ChlH, ChlI, or their functionally equivalent genes, with their conserved coding regions selected as the sites of action.

[0035] Reducing the expression or function of target genes through gene silencing or gene editing, including CRISPR / Cas9, CRISPR / Cas12 systems, or RNA interference technology. Taking the CRISPR / Cas9 system as an example... Figure 1As shown, sgRNA expression cassettes (targeting the conserved region of the PDS gene) are driven by 35Spro or CmYLCVpro, while spCas9 protein expression is driven by promoters such as PCE8pro, 35Spro, or UBQpro. Hygromycin phosphotransferase (HPT) gene is used as a plant selection marker to facilitate subsequent selection of positive transforming lines through antibiotics. Through this regulation, the content of carotenoids in plant leaves is reduced, indirectly leading to decreased chlorophyll stability and thus weakening the green phenotype.

[0036] S2, Plant Pigment Enhancement Module Construction A plant pigment enhancement module was constructed to significantly increase the synthesis and accumulation of red or purple pigments, resulting in a stable pink phenotype with varying color gradations.

[0037] like Figure 1 As shown, in terms of betalain pathway enhancement, betalain synthesis-related gene expression cassettes are introduced, preferably RUBY expression cassettes or their functionally equivalent sequences, and expression is driven by promoters such as HTBpro, 35Spro, G10pro or UBQpro, while terminators such as E9, EU, NOS or HSP terminators can be selected.

[0038] To enhance the anthocyanin pathway, key transcription factors in the anthocyanin biosynthesis pathway, such as R2R3-MYB, bHLH, and members of the WD40 complex, can be introduced or overexpressed. Alternatively, one or more anthocyanin structural genes can be directly overexpressed. dCas9-mediated transcriptional activation systems (such as dCas9-TV or dCas9-ACT systems) can also be used to activate the expression of endogenous anthocyanin synthesis genes.

[0039] The betaine red pigment enhancement module and the anthocyanin enhancement module can be used individually or in combination to obtain different shades and light and dark gradients of pink.

[0040] S3, Plant genetic transformation The green background reduction module and the plant pigment enhancement module can be constructed separately in independent expression vectors and introduced into plant cells via co-transformation; or they can be integrated into the same multi-gene expression vector and introduced into plant cells via a single transformation. By rationally setting the linker sequences and expression regulatory units, the two modules can be synergistically expressed in the same plant.

[0041] All of the following transformation schemes can effectively introduce the target vector into the plant. The specific transformation method can be flexibly selected based on factors such as the type of recipient plant, the type of explant, the maturity of the regeneration system, and the purpose of the experiment or application.

[0042] (1) Agrobacterium-mediated transformation: Agrobacterium carrying the target vector is used to infect plant explants, and transgenic plants are obtained through co-culture, screening and regeneration. It is applicable to plants such as Arabidopsis thaliana, tobacco and rice.

[0043] (2) Gene gun transformation method: DNA is introduced into plant tissues by bombardment with microparticles. It is applicable to plants such as corn, wheat and tomatoes.

[0044] (3) Protoplast transformation method: DNA is introduced into protoplasts through PEG-mediated or electroporation methods, and plants are obtained through regeneration or used for transient expression analysis.

[0045] (4) Transient expression method: Transient expression was achieved by foliar spraying of Agrobacterium tumefaciens to quickly verify the pink phenotype formation effect.

[0046] S4. Molecular identification and phenotypic evaluation Under the synergistic effect of green background attenuation and red / purple pigment enhancement, the plants exhibited stable pink leaves or a phenotype with varying shades of pink. Molecular and phenotypic identification of the obtained plants was performed, including: PCR or qPCR detection of exogenous genes, Southern blot verification of gene integration, assessment of leaf color changes using a colorimeter or visual analysis, and evaluation of the pink phenotype and color gradient formation.

[0047] Specifically, the effectiveness of the above-described method for obtaining plants with pink leaves is verified through the following examples.

[0048] Example 1: A method for creating pink leaf tobacco based on CRISPR-Cas technology This embodiment provides a method for creating pink-leaved tobacco plants through genetic engineering. This method achieves the stable formation of the pink leaf phenotype by weakening the synthesis of carotenoid / chlorophyll precursors and enhancing the synthesis of betalains.

[0049] 1. Constructing a green background attenuation vector pDC45-NtPDS Using the genomic DNA of the common cultivated tobacco variety Honghua Dajinyuan (abbreviated as "Hongda", HD) as a template, the gene sequence of phytoene desaturase (PDS) was retrieved and compared. A 20bp sequence located in the conserved region of PDS was selected as the target sequence, as follows: gctgcatggaaagatgatga (SEQ ID NO: 1).

[0050] Based on the CRISPR / Cas9 plant expression vector pDC45 backbone (see Chinese Patent CN113667689B), the target sequence was inserted into the BsaI restriction site of the pDC45 vector using Golden Gate cloning technology to construct the plant expression vector pDC45-NtPDS targeting the NtPDS gene. The sequence integrated into the plant genome is as follows:

[0051] The constructed pDC45-NtPDS plant expression vector includes: a Cas9 nuclease expression cassette driven by the calreticulin promoter (PCE8pro), an sgRNA expression cassette targeting the NtPDS gene, and a hygromycin resistance selection marker (HPT). Restriction endonuclease digestion and sequencing verification confirmed that the sgRNA sequence and its insertion direction were consistent with the design, indicating that the CRISPR / Cas9 plant expression vector targeting the NtPDS gene was successfully constructed. This vector can be used to mediate site-specific editing of the tobacco NtPDS gene, reduce carotenoid biosynthesis, thereby weakening the green background of leaves and providing a basis for the subsequent formation of a pink phenotype.

[0052] 2. Construction of the betaine synthesis enhancement vector HTBpro-RUBY In the previously reported synthetic betalain expression cassette, Ruby (He Yubing et al.) Horticulture Research Based on [reference needed], 2020; 7:152. doi:10.1038 / s41438-020-00390-1), the HTBpro-RUBY plant expression vector of this invention was constructed. The Ruby expression cassette includes a polycistronic expression structure encoding CYP76AD1, DODA, and glucosyltransferase (GT). [Example from another source:] Figure 1 As shown, in this embodiment, the Ruby expression cassette was placed downstream of the tobacco histone H2B promoter (HTBpro) to obtain high and relatively stable transcriptional activity in vegetative tissues such as leaves. Restriction endonuclease digestion and sequencing verification showed that the RUBY expression cassette insertion sequence was correct and the orientation was accurate, successfully obtaining the HTBpro-RUBY plant expression vector. Its T-DNA region sequence is as follows:

[0053] 3. Plant genetic transformation (1) The vectors pDC45-NtPDS and HTBpro-RUBY were transformed into Agrobacterium EHA105 strain by freeze-thaw method. Positive single clones were picked and cultured overnight in LB liquid medium at 28°C on a shaker. After centrifugation to collect the bacterial cells, they were resuspended in liquid MSO medium (containing 4.4 g / L MS basal medium, 30 g / L sucrose, 0.5 g / L MES, pH 5.8) and the OD of the bacterial suspension was adjusted. 600 To a final concentration of 0.7, add acetylsuccinone to a final concentration of 20 mg / L. Mix the Agrobacterium suspension carrying the pDC45-NtPDS vector with the Agrobacterium suspension carrying the HTBpro-RUBY vector at a volume ratio of 1:1 to obtain the Agrobacterium mixture for co-transformation.

[0054] (2) Select healthy, disease-free, sterile tobacco K326 seedlings and cut a hypocotyl segment of about 1.0 cm as explant. Immerse the explant in the above Agrobacterium mixture and gently shake for 10 min. After removing the excess bacterial solution, place the explant on sterile filter paper and blot it dry slightly. Then transfer it to co-culture medium (MS basal medium, 1.0 mg / L 6-BA, 0.1 mg / L NAA, pH 5.8, 0.8% agar) and co-culture for 2 days in the dark at 25℃.

[0055] (3) After co-culture, the explants were transferred to a differentiation screening medium containing selective antibiotics and antibacterial agents for callus induction and shoot differentiation. The differentiation medium contained 10 mg / L hygromycin, pH 5.8, and 0.8% agar. The plants were cultured at 25°C for 5 weeks under 16 h light / 8 h dark conditions, and transferred to fresh medium of the same formulation every 2 weeks until regenerated shoots were produced. The regenerated shoots, which had grown to 1-2 cm, were transferred to a rooting medium (MS basal medium containing 0.7% agar and 20 mg / L hygromycin, pH 5.8) containing the same antibiotic combination and cultured for another 5 weeks to obtain transgenic regenerated plants with complete root systems. The well-rooted plants were then transplanted into nutrient soil and acclimatized under controlled greenhouse conditions.

[0056] 4. Molecular identification and phenotypic observation of regenerated plants (1) Molecular identification Genomic DNA was extracted from leaves, and the RUBY and HPT fragments in HTBpro-RUBY were amplified using vector-specific primers, respectively. The results are as follows: Figure 2 As shown, the aforementioned specific bands were simultaneously amplified, indicating successful transformation of the HTBpro-RUBY vector. PCR amplification and sequencing analysis of the NtPDS gene target site yielded the following results: Figure 3As shown, this indicates the presence of base insertion or deletion mutations near the sgRNA target site, leading to frameshifts or premature stop codon generation, thus demonstrating that the NtPDS gene function is disrupted or significantly weakened. Plants exhibiting both of these results are considered double-positive.

[0057] (2) Phenotypic observation like Figure 4 As shown, wild-type tobacco seedlings have uniformly bright green leaves. The P1-P5 transgenic lines obtained through the one-step transformation exhibit a continuous pink gradient from deep magenta to nearly white. With increasing chlorophyll inhibition, the leaf color transitions sequentially from deep pink, light magenta, pale pink, pinkish-white, to complete chlorosis. Figure 5 As shown, the green background of the leaves of positively transformed tissue culture seedlings at the 4-6 true leaf stage is significantly reduced, and the base color fades to light green. The pink pigment can be evenly distributed throughout the leaf or accumulate in a mottled pattern along the veins. Some plants have pink to light pink coverings on both sides of the leaves. The pink coloring effect is most prominent in the new young leaves. After the leaves mature, the pink color deepens moderately and the trait is stable.

[0058] (3) Quantitative assessment To verify the effect of gene editing technology on the color transformation of plant leaves, this study used eight gene-edited plant leaves as experimental materials and unedited plant leaves as controls. The CIE Lab color space parameters of the leaves were measured using an LS172 handheld colorimeter (L is the brightness value, a is the red-green magenta index (positive values ​​indicate redness, negative values ​​indicate greenness); b is the yellow-blue magenta index (positive values ​​indicate yellowness, negative values ​​indicate blueness). Three replicate measurements were performed for each sample. The results were characterized by mean ± standard deviation. Referring to the international botanical standard (ISO / CIE 11664-4:2019), the measurement results were matched and named using the Pantone TCX textile standard color chart as a reference to verify the pink phenotype of the gene-edited plant leaves. The measurement results are shown in Table 1.

[0059] Table 1. Results of Lab color values ​​of leaves from gene-edited plants (mean ± standard deviation)

[0060] In the CIE Lab color space, red hue is the core phenotypic characteristic of pink leaves, and the key to its determination is a positive a value that significantly deviates from the negative range of green leaves. In this study, the a values ​​of all eight gene-edited plant leaf samples were positive, ranging from 13.40±0.16 to 46.59±2.77, with an overall mean of 30.65±11.63. None of the samples showed the typical negative a value of green leaves, directly proving that the gene-edited plant leaves had completely broken away from the green hue and successfully transformed into a color phenotype based on red hue, meeting the core color determination criteria for pink leaves. Wild-type plants are predominantly green, exhibiting a low a value and a positively high b value. After gene editing, the a value of the strains increased significantly, with a large accumulation of red pigment; the b value changed from positive to negative, with an increase in blue hue, together forming the typical pink color. The L value remained stable in the mid-to-high range, ensuring a bright and transparent pink color without any green residue.

[0061] All strains matched the Pantone TCX pink series, covering a complete gradient from light pink to deep rose pink, exhibiting pure color and high consistency, confirming the successful targeted conversion of green plants to standard pink through gene editing. This study successfully transformed green plants into pink strains using gene editing technology. Quantitative analysis using a colorimeter and verification with the Pantone TCX color chart showed that the strains' Lab parameters conformed to the characteristics of standard pink, with a complete color gradient and stable phenotype. This research demonstrates that the gene editing provided by this invention can efficiently regulate plant color, offering a reliable technical solution and quantitative evaluation system for molecular breeding of ornamental plants.

[0062] The above results demonstrate that co-transformation of the pDC45-NtPDS vector and the HTBpro-RUBY expression vector can simultaneously achieve green background reduction and enhanced betalain biosynthesis in tobacco. Specifically, NtPDS gene editing reduces carotenoid accumulation and weakens the green background of leaves, while the HTBpro-driven RUBY expression cassette promotes betalain accumulation in leaves. The synergistic effect of both results in a pink leaf phenotype, thus validating the proposed strategy of combining a green background reduction module and a pigment enhancement module to effectively obtain plant materials with pink leaves.

[0063] Example 2: A method for creating pink-leaved plants based on PDS gene editing and AtPAP1 overexpression In this embodiment, the tobacco NtPDS gene was targeted and edited using the CRISPR / Cas9 system to reduce the level of carotenoid biosynthesis, inhibit chlorophyll accumulation, and weaken the green background of the leaves. At the same time, the Arabidopsis AtPAP1 gene (R2R3-MYB transcription factor) was introduced to promote anthocyanin biosynthesis. The two worked synergistically to enable the tobacco leaves to form a stable pink phenotype.

[0064] 1. Constructing a dual-functional vector pDC45-PAP1-PDS The vector contains an NtPDS targeted editing module and an AtPAP1 overexpression module. The specific construction steps are as follows: (1) Using the genomic DNA of common cultivated tobacco safflower (HD) as a template, a 20 bp sequence of the conserved coding region of the NtPDS gene (as shown in SEQ ID NO:1) was selected as the sgRNA target sequence. The target sequence was inserted into the BsaI restriction site in the pDC45 vector using the Golden Gate cloning method to construct the NtPDS gene-targeted CRISPR / Cas9 editing expression cassette. The vector also contains a Cas9 nuclease expression cassette driven by the PCE8 promoter and a hygromycin resistance selection marker (HPT).

[0065] (2) The AtPAP1 expression cassette CmYLCVpro-AtPAP1-35Sterm, driven by the CmYLCVpro promoter, was constructed and synthesized by Beijing Liuhe BGI Genomics Co., Ltd. The specific sequence is as follows:

[0066] Using CmYLCVpro-AtPAP1-35Sterm as a template, amplification primer F1 with homologous recombination adapter and reverse primer R1 were designed for PCR amplification. The amplification products were recovered by agarose gel electrophoresis.

[0067] The sequence of amplification primer F1 is as follows: gccagtgccaagcttactagttggcagacatactgtcccacaa (SEQ ID NO: 5); The reverse primer R1 sequence is as follows: tgtttgacctccgtaactagttaattcgggggatctggattttagtactgg (SEQ ID NO: 6).

[0068] The linearized pDC45-NtPDS vector, digested with SpeI, was ligated with the recovered product using the homologous recombinase C112 (purchased from Nanjing Novizan Biotechnology Co., Ltd.) to obtain the bifunctional expression vector pDC45-PAP1-PDS, the structure of which is shown below. Figure 6 As shown.

[0069] (3) Escherichia coli DH5α was transformed using the bifunctional expression vector pDC45-PAP1-PDS. After verification by sequencing, Agrobacterium tumefaciens EHA105 was transformed using the freeze-thaw heat shock method. Tobacco K326 was transformed using the Agrobacterium-mediated transformation method, with the following specific steps: a. Culture positive Agrobacterium-positive bacteria to OD. 600 The concentration was 0.6–0.8, and after centrifugation, the medium was resuspended in MS liquid medium and the OD was adjusted. 600 When the temperature reaches 0.7, add 20 mg / L acetylsalicylic acid and let stand at room temperature for 30 min to obtain the infected bacterial solution; b. Take hypocotyls of 3-4 week old sterile seedlings as explants, immerse them in bacterial solution for 10-15 min, and then place them in co-culture medium (MS + 1.0 mg / L 6-BA + 0.1 mg / L NAA) and co-culture in the dark at 25℃ for 2 days; c. Transfer to differentiation medium containing 10 mg / L hygromycin and 200 mg / L cefotaxime, and culture at 25°C for 5-6 weeks to induce shoot regeneration; d. The regenerated shoots are transferred to rooting medium and cultured for 4-5 weeks to obtain complete plants, which are then transplanted for acclimatization.

[0070] 2. Molecular identification and phenotypic observation of regenerated plants The effectiveness of the treatment was confirmed through molecular identification and phenotypic observation, with the following results: (1) Positive screening: Genomic DNA was extracted from leaves, and the Cas9 fragment and HPT fragment were amplified using vector-specific primers, respectively. The results are as follows: Figure 7 As shown, more than 80% of the regenerated plants can amplify specific bands and are identified as positive plants.

[0071] (2) Phenotypic observation: such as Figure 8 As shown, the leaves of positive plants gradually turn pink from the regeneration bud stage, and the phenotype is stable in the mature stage. More than 90% of qualified plants show a stable pink color and grow normally.

[0072] Example 3: Method for obtaining pink nightshade using hybridization Black nightshade (Solanum nigrum) is a herbaceous plant belonging to the Solanaceae family, possessing both horticultural ornamental and medicinal value. This embodiment first constructs a green background-weakening vector pDC45-SnPDS and a betaine-enhancing vector HTBpro-RUBY, then performs co-transformation using Agrobacterium-mediated tissue culture. Employing the Agrobacterium-mediated tissue culture transformation method, multi-gradient pink hues in black nightshade leaves are achieved by weakening chlorophyll accumulation and regulating and enhancing betaine synthesis, expanding the applicable crops and transformation examples, and further clarifying the plant-wide applicability of the method of this invention.

[0073] 1. Constructing a green background attenuation vector pDC45-SnPDS The conserved SnPDS sequence of *Solanum nigrum* was selected as the sgRNA target sequence (as shown in SEQ ID NO:1). Using the Golden Gate cloning method, this target sequence was inserted into the expression cassette driven by the sgRNA expression promoter in the pDC45 vector to construct a SnPDS gene-targeting CRISPR / Cas9 editing expression cassette.

[0074] The vector contains a Cas9 nuclease expression cassette driven by the calreticulin promoter PCE8 and a hygromycin resistance selection marker (HPT). This system enables Cas9 to specifically recognize and cleave the SnPDS gene target site under sgRNA guidance, thereby generating insertion or deletion mutations through a non-homologous end joining repair mechanism, which inhibits carotenoid biosynthesis and reduces the green background of leaves.

[0075] 2. Construction of the betaine-enhancing carrier HTBpro-RUBY An HTBpro-RUBY expression module was constructed, where HTBpro is the plant histone H2B promoter used to drive high-level expression of the RUBY expression cassette in plant vegetative tissues. The RUBY expression cassette includes polycistronic expression structures encoding CYP76AD1, DODA, and UDP-glucosyltransferase (GT), and transcription is terminated by the E9 terminator, thereby reconstructing and enhancing the betalain biosynthesis pathway.

[0076] 3. Cultivation of aseptic seedlings of Solanum nigrum Black nightshade seeds were disinfected with 3.5% sodium hypochlorite solution for 8 minutes, rinsed with sterile water, and then subjected to low-temperature stratification to break dormancy. They were then inoculated onto MS solid medium and cultured for 1 week at 25°C under 16h light / 8h dark conditions. Cotyledons were selected as explants for genetic transformation.

[0077] 4. Agrobacterium-mediated co-transformation pDC45-SnPDS and HTBpro-RUBY were transformed into EHA105 Agrobacterium and cultured at 28°C until OD200. 600 The concentration was 0.6–0.7. After centrifugation to collect the bacterial cells, they were resuspended in MS liquid medium and a final concentration of 20 mg / L acetylsylgenone was added. The mixture was then incubated at room temperature for 30 min. Subsequently, the two bacterial suspensions were mixed in equal volumes to obtain a mixed infection solution.

[0078] Explants were placed in pre-medium (MS + 2 mg / L 6-BA + 0.5 mg / L tZT) and cultured in the dark for 1 day. They were then immersed in mixed bacterial solution for 10 min, and excess bacterial solution was blotted with sterile filter paper. They were then placed in co-medium with the same formulation as the pre-medium and co-cultured in the dark at 25°C for 2 days.

[0079] The explants were then transferred to differentiation selection medium (MS + 2 mg / L 6-BA + 0.5 mg / L tZT + 3 mg / L hygromycin + 250 mg / L cephalosporin), and subcultured every 14 days. The concentration of hygromycin was gradually increased in subsequent subcultures. Adventitious shoots were induced after 5-7 weeks of culture. When the shoots reached 1-1.5 cm in length, they were cut off and transferred to rooting medium. After rooting, the seedlings were hardened off and transplanted into substrate to obtain T0 generation transgenic plants.

[0080] 5. Molecular identification and phenotypic observation (1) Molecular identification Genomic DNA was extracted from leaves of regenerated plants, and specific fragments of RUBY and Cas9 were amplified using specific primers, respectively. The results are as follows: Figure 9 As shown, both bands were detected, and the plant was identified as a double-module positive plant; the leaves of the positive plant showed efficient RUBY transcription and a large accumulation of betalains.

[0081] (2) Phenotypic observation like Figure 10 As shown, unlike wild-type plants whose leaves remain normal green, the new leaves of positive plants are light pink, and no plants are white or extremely dark purple.

[0082] Although the present invention has been described in detail with reference to the accompanying drawings and preferred embodiments, the present invention is not limited thereto. Various equivalent modifications or substitutions can be made to the embodiments of the present invention by those skilled in the art without departing from the spirit and essence of the invention, and such modifications or substitutions should all be within the scope of the present invention. Any variations or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should also be covered within the protection scope of the present invention.

Claims

1. A method for obtaining plants with pink leaves, characterized in that, This includes simultaneously introducing gene-editing elements to reduce chlorophyll accumulation and exogenous expression elements to enhance plant pigment accumulation into plant cells or plant tissues; the gene-editing elements target conserved regions of the phytoene dehydrogenase gene or chlorophyll biosynthesis-related genes; and the exogenous expression elements are used to express genes related to the betaine biosynthesis pathway and / or anthocyanin biosynthesis regulation genes in plant tissues.

2. The method according to claim 1, characterized in that, Gene editing elements include the Cas protein coding sequence and the sgRNA expression cassette.

3. The method according to claim 2, characterized in that, The Cas protein is either Cas9 or Cas12a nuclease.

4. The method according to claim 2, characterized in that, The target sequence of the sgRNA is shown in SEQ ID NO:1, or a variant sequence thereof that does not affect the function of the conserved region of the PDS gene.

5. The method according to claim 1, characterized in that, The exogenous expression element includes an expression cassette for expressing key enzymes in betaine biosynthesis, including one or more of CYP76AD1, DODA, and glycosyltransferases.

6. The method according to claim 1, characterized in that, Exogenous expression elements include Arabidopsis thaliana MYB transcription factor expression cassettes, which are used to activate anthocyanin biosynthesis pathways.

7. The method according to claim 1, characterized in that, Gene editing elements and exogenous expression elements were constructed in two separate plant expression vectors and introduced into plant cells through co-transformation.

8. The method according to claim 1, characterized in that, Gene editing elements and exogenous expression elements are constructed in the same binary expression vector and introduced into plant cells through a single transformation.

9. The method according to claim 7 or 8, characterized in that, The transformation methods include any one of Agrobacterium-mediated transformation, gene gun transformation, or protoplast transformation.

10. The method according to any one of claims 1 to 8, characterized in that, Plants with pink leaves include any one of the following: tobacco, tomato, potato, pepper, Arabidopsis thaliana, or ornamental flowering plants.

Images