Application of pinus yunnanensis pywox3 gene in plant multi-trait regulation

Abstract

The application provides application of a Yunnan pine PyWOX3 gene in plant multi-traits regulation, and relates to the technical field of plant genetic engineering and forestry breeding. The PyWOX3 gene is overexpressed in a target plant to regulate plant dwarfing, promote lateral bud maturation, promote vascular tissue thickening, improve wood density, and inhibit plant height, ground diameter, root growth and / or rosette leaf number. The application overcomes the defects of the prior art, obtains the PyWOX3 related gene from the Yunnan pine, and verifies the function of the PyWOX3 related gene in plant growth inhibition / dwarfing plant through transgenic poplar / Arabidopsis, thereby providing a new genetic tool for plant genetic improvement.

Description

Technical Field

[0001] This invention relates to the fields of plant genetic engineering and forestry breeding technology, specifically to the application of the Yunnan pine PyWOX3 gene in the regulation of multiple traits in plants. Background Technology

[0002] In forest tree breeding, different morphological forms of plants have certain market demands. Existing plant variety improvement mainly focuses on promoting plant growth and increasing plant yield. However, for landscape art and increasing land utilization, dwarfing and limiting the growth of plants are also important directions for variety improvement.

[0003] In existing technologies, most methods suppress plant height by using exogenous hormones (such as paclobutrazol), but this often comes with side effects such as poor development of lateral buds. Moreover, the methods for regulating plant growth inhibition mostly involve the use of exogenous hormones, which are chemically synthesized substances and pose risks of environmental pollution and residues.

[0004] Molecular breeding is a technical system that integrates modern technologies such as molecular biology, genomics, and bioinformatics into classical breeding methods. It is used to accurately identify, select, and improve biological traits at the gene or molecular level. Molecular breeding provides stable overall traits and can specifically obtain the desired varietal performance. Based on this, finding genes that can regulate plant dwarfing and growth inhibition to achieve the corresponding goals is a major research direction at present. Summary of the Invention

[0005] To address the shortcomings of existing technologies, this invention provides an application of the Yunnan pine PyWOX3 gene in the regulation of multiple plant traits. The relevant gene of PyWOX3 is obtained from Yunnan pine, and its function in inhibiting plant growth / dwarfing plants is verified through transgenic poplar / Arabidopsis, providing a new genetic tool for plant genetic improvement.

[0006] To achieve the above objectives, the present invention provides the following technical solution: An application of the Yunnan pine PyWOX3 gene in the regulation of multiple plant traits, the application including: By overexpressing the PyWOX3 gene in target plants, plant dwarfing was regulated, lateral bud maturation was promoted, vascular tissue thickening was promoted, wood density was increased, and at least one of plant height, diameter at root, root growth and / or number of rosette leaves was inhibited.

[0007] Preferably, the nucleotide sequence of the Yunnan pine PyWOX3 gene is shown in SEQ ID NO:1.

[0008] Preferably, the target plant is poplar or Arabidopsis thaliana.

[0009] Preferably, the overexpression of the PyWOX3 gene is achieved by constructing a recombinant expression vector containing the PyWOX3 gene coding sequence and a promoter, and transforming the recombinant expression vector into the target plant to achieve gene overexpression.

[0010] Preferably, the promoter is a 35S promoter.

[0011] The method used to regulate plant growth involves introducing an overexpression vector containing the Yunnan pine PyWOX3 gene into plants to promote lateral bud maturation, thicken vascular tissue, increase wood density, and inhibit plant height, diameter at root, root growth, and / or the number of rosette leaves.

[0012] This invention provides an application of the Yunnan pine PyWOX3 gene in the regulation of multiple plant traits, and its advantages compared with existing technologies are as follows: This invention provides a PyWOX3 gene from Yunnan pine. Transforming 84K poplar trees with a PyWOX3 overexpression vector can significantly reduce the tree height, inhibit internode length, suppress overall plant growth, promote more mature lateral bud development, thicken vascular tissue, and increase wood density. Furthermore, transforming Arabidopsis thaliana with the PyWOX3 overexpression vector can effectively shorten bolting time and reduce the number of rosette leaves and rosette branches, providing a new direction for plant breeding. Attached Figure Description

[0013] Figure 1 This invention presents a morphological comparison between 10-week-old wild-type (WT) poplar trees and transgenic poplar trees overexpressing PyWOX3 (L2, L7; L2 represents transgenic line 2, and L7 represents transgenic line 7) (scale bar 10 cm). Figure 2 This invention presents a comparison of the morphological growth of 10-week-old wild-type poplar and transgenic poplar overexpressing PyWOX3 in this embodiment; A represents plant height statistics; B represents ground diameter statistics; error bars indicate standard errors, and ns indicates no significant difference (the same applies below). ; Figure 3 This is a statistical representation of the internode length and lateral bud number of poplar trees in an embodiment of the present invention, where A is the average internode length and B is the number of lateral buds; , ; Figure 4 This is a histological analysis of a longitudinal section of a lateral bud at the 7th node of a poplar tree in an embodiment of the present invention; the black asterisk indicates the embryonic leaf layer. Figure 5 This is a statistical analysis of the morphological indicators of poplar lateral buds in this embodiment of the invention, where A is bud height; B is bud width; and C is the number of ovule layers. Figure 6 Comparison of poplar root growth morphology in embodiments of the present invention (scale bar 10 cm); Figure 7 For the determination of poplar root development indicators in this embodiment of the invention, A is the total root length; B is the average root diameter; and C is the root surface area. ; Figure 8 This is a cross-section of the 7th internode of a 10-week-old poplar stem and its xylem phenotype in an embodiment of the present invention. The red line segments indicate the xylem region; scale bar: 200 μm (top) and 100 μm (bottom). Figure 9 For the vascular tissue statistics in this embodiment of the invention, A is the number of xylem cell layers; B is the xylem area percentage; C is the developing xylem area percentage. Figure 10 This is a magnified view of the cambium phenotypic region in an embodiment of the present invention (Ph: phloem, Ca: cambium, Xy: xy), with a scale bar of 50 μm. Figure 11 This is a statistical representation of the cambium layer in this embodiment of the invention (number of cambium cell layers and frequency of cambium cell layer distribution). Figure 12 The number of cambium cell layers during development in this embodiment of the invention; , ; Figure 13 This is a schematic diagram of Arabidopsis thaliana phenotypes in an embodiment of the present invention, wherein A is a schematic diagram of the growth of 30-day-old seedlings (WT) and various transgenic lines; B is a statistical diagram of the number of rosette leaves; , . Detailed Implementation

[0014] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0015] Example 1: 1. Cloning and overexpression vector construction of the PyWOX3 gene Using cDNA from the lateral buds and shoot tips of *Pinus yunnanensis* as templates, the full-length coding sequence of PyWOX3 was amplified using specific primers (GenBank: PP660560). After purification, the PCR product was cloned via homologous recombination into the BsaI-digested 35S:pBWA(V)HS-eGFP vector to obtain the recombinant plasmid 35S:PyWOX3-eGFP. After sequencing verification, the plasmid was transformed into *Agrobacterium* EHA105.

[0016] Specific primers for amplifying the PyWOX3 gene: PyWOX3-F: atgaagaaaacaaagagcttcgccattctgaatc PyWOX3-R:taagccactgcatgttggaaacaattccag The nucleotide sequence of the PyWOX3 gene is shown in SEQ ID NO:1 below: PyWOX3-clone-CDS atgaagaaaacaaagagcttcgccattctgaatccaagggagaatgaagaagccattagtactggcgtggtttccagagcccgtctcagagttccaactgctatgcctcagcctgcaactacacggtggaatccaa cgccagagcagttgatgatactggaagaaatgtatagaggcgggattcgaactccgaacgccgatcagatccagcaaatcacagcccatctggctttgtatggtaagatagaaggaaaaaatgttttctactggttc cagaatcacaaagctcgagacaggcagaagctgagacgtaaaatggagagcaaacaggaacccaagagaagtacatttgaagacgaatctgctctgaacatcaacaatggctggaggcttagcacactcgagtcaa gagaaggatgctgcaactctttcaattgtgggagcgtagaagaatatgactgtgaaattgatacagtacatgcaataagtaggagagccaggcctcttaaaactctggaattgtttccaacatgcagtggcttatag 2. Genetic transformation of 84K poplar Transformation of 84K poplar using the leaf disc method ( Populus alba × P. glandulosaAgrobacterium tumefaciens bacterial suspension (OD600 = 0.4-0.6) was used to infect poplar leaf explants for 10 min. After co-culturing for 2 days, the plants were transferred to selection medium containing 3 mg / L hygromycin to induce resistant callus. After subculturing, differentiation, shoot and root formation, genomic DNA of transgenic poplar was extracted. Using wild-type poplar genome as a negative control and recombinant plasmid 35S:PyWOX3 as a positive control, PCR amplification was performed using vector-specific primers to obtain 10 positive poplar lines overexpressing PyWOX3, named L1~L10.

[0017] Vector-specific primers: Vector-specific primer-F: CTGCCCGCTGTTCTACAACCGG Vector-specific primer-R: GGAGCATATACGCCCGGAGTC The expression level of PyWOX3 in the transgenic positive lines was further detected by RT-qPCR. The results showed that the PyWOX3 expression levels in the L2 and L7 lines were 3.65-fold and 3.45-fold higher than those in the wild type, respectively. Plants from these two lines were selected for subsequent analysis.

[0018] 3. Arabidopsis genetic transformation The inflorescence inoculation method was used: the 35S:PyWOX3 vector was transformed into Agrobacterium GV3101 and used to inoculate Arabidopsis Col-0 inflorescences. After harvesting seeds, positive T1 generation was screened on MS medium containing 35 mg / L hygromycin. The T3 homozygous line was obtained by self-pollination. 100-200 mg of plant leaves were collected, and Arabidopsis genomic DNA was extracted. Wild-type Arabidopsis genomic DNA was used as a negative control, and recombinant plasmid 35S:PyWOX3 was used as a positive control. PCR amplification was performed using vector-specific primers to obtain 10 positive Arabidopsis lines overexpressing PyWOX3, named L1-L10. Two independent positive transgenic lines (L3 and L5) were selected from these lines for subsequent analysis.

[0019] 4. Measurement of the phenotypic characteristics of transgenic poplar trees: Wild-type (WT) and transgenic poplar tissue culture seedlings were simultaneously transplanted into the same substrate (peat:vermiculite = 1:1) and grown in an artificial climate chamber (25°C, 16 h light / 8 h dark, 70% humidity) for 10 weeks. The following tests were performed (at least 3 biological replicates for each line).

[0020] Plant height was measured with a ruler, and diameter at ground level was measured with a vernier caliper. The number of lateral buds and internode length were counted (results are shown below). Figure 2 and Figure 5 (As shown).

[0021] Root growth of wild-type and transgenic types was examined (results are shown in the figure). Figure 6 and Figure 7 (as shown) Paraffin sections were prepared from lateral buds of the 7th internode, stained with safranin-fast green, and the bud height, bud width, and number of cotyledon layers were measured (results are shown in the figure). Figure 4 and Figure 5 (as shown) A stem segment approximately 5 mm long from the middle of the 7th internode was taken, fixed with FAA fixative, routinely embedded in paraffin, sectioned to a thickness of 8 μm, stained with safranin-fast green, and observed and photographed under a microscope. The number of xylem cell layers, xylem area percentage, and cambium cell layers were measured using ImageJ software (results are shown in the figure). Figures 8-12 (As shown).

[0022] Plant height was significantly reduced: the wild type was 28.76 cm, while the transgenic lines (L2 and L7) were reduced to 21.23 cm and 16.6 cm, respectively, with a reduction of 26.2%-42.3% (P<0.05). Internode length was significantly shortened: the average internode length of the wild type was 1.89 cm, while that of the transgenic lines was reduced to 1.41 cm (L2) and 1.31 cm (L7), a reduction of 25.6%-30.7% (P<0.01). Lateral buds develop more maturely: bud height increases by 26.2%-28.6%, bud width increases by 6.7%-8.4%, the number of cotyledon layers increases from 3 layers in the wild type to 4-5 layers, and meristematic tissue division activity is enhanced; The ground diameter was significantly reduced: the wild type was 2.48 mm, while the transgenic lines (L2 and L7) were reduced to 2.19 mm and 1.85 mm, respectively, a reduction of 11.7%-25.4%. Total root length was significantly shortened: approximately 513 cm in the wild type, and reduced to 421 cm (L7) and 399 cm (L2) in the transgenic lines, a decrease of 17.99%-22.1%; Furthermore, the root surface area of ​​the transgenic lines was reduced by 33.1%-34.2% and the average root diameter was reduced by 15.5%-16.2% compared to the wild type.

[0023] The number of xylem cell layers increased from 15-19 in the wild type to 24-28. The percentage of xylem area increased from 15.54% in the wild type to 18.71%-20.34% (a relative increase of 20.4%-30.9%). The number of cambium cell layers increased from 2-3 layers in the wild type to 4-5 layers, and the cambium region was significantly widened, indicating enhanced cambium mitotic activity.

[0024] 5. Performance determination of related traits in transgenic Arabidopsis thaliana: Wild-type and transgenic seeds of Arabidopsis thaliana were sown simultaneously and cultured at 22°C under 16h light / 8h darkness conditions.

[0025] The bolting time was recorded, and the number of rosette leaves and rosette branches were counted at 30 days. Results showed that the transgenic Arabidopsis lines bolted approximately 8 days earlier, the number of rosette leaves decreased from 23.4 to 12-14.8 (a reduction of 40%-49%), and the number of rosette branches was also significantly reduced (e.g., ...). Figure 13 (As shown).

[0026] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. An application of the Yunnan pine PyWOX3 gene in the regulation of multiple traits in plants, characterized in that, The applications include: By overexpressing the PyWOX3 gene in target plants, plant dwarfing was regulated, lateral bud maturation was promoted, vascular tissue thickening was promoted, wood density was increased, and at least one of plant height, diameter at root, root growth and / or number of rosette leaves was inhibited.

2. The application according to claim 1, characterized in that: The nucleotide sequence of the Yunnan pine PyWOX3 gene is shown in SEQ ID NO:

1.

3. The application according to claim 1, characterized in that: The target plant is poplar or Arabidopsis thaliana.

4. The application according to claim 1, characterized in that: The method of overexpressing the PyWOX3 gene involves constructing a recombinant expression vector containing the PyWOX3 gene coding sequence and a promoter, and then transforming the recombinant expression vector into the target plant to achieve gene overexpression.

5. The application according to claim 4, characterized in that: The promoter is a 35S promoter.

6. A method for regulating plant growth, characterized in that: The method involves introducing an overexpression vector containing the Yunnan pine PyWOX3 gene into plants to promote lateral bud maturation, thicken vascular tissue, increase wood density, and inhibit plant height, diameter at root, root growth, and / or the number of rosette leaves.

Images