Application of pear transcription factor PbMYB62 gene in inhibiting pear fruit tiger skin disease

Abstract

The application discloses application of a pear transcription factor PbMYB62 gene in inhibition of tiger stripe disease of pear fruits and belongs to the technical field of plant genetic engineering. A MYB transcription factor PbMYB62 isolated from 'Shali' pear has a nucleotide sequence as shown in SEQ ID NO. 1. Through transient injection experiment, disease incidence statistics, scanning electron microscope observation, wax content determination and gene expression analysis of 'Shali' pear, it is shown that overexpression of the PbMYB62 gene promotes wax synthesis and reduces the occurrence of tiger stripe disease. Through transient injection experiment, disease incidence statistics, scanning electron microscope observation, wax content determination and gene expression analysis of 'Shali' pear, it is shown that silencing of a specific fragment of the PbMYB62 gene reduces the wax content and promotes the occurrence of tiger stripe disease, which indicates that the PbMYB62 can promote the synthesis of wax and inhibit the occurrence of tiger stripe disease of pear, and provides a gene reserve for tiger stripe disease regulation and pear fruit quality improvement molecular breeding.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, specifically to the application of the pear transcription factor PbMYB62 gene in inhibiting the occurrence of tiger skin disease in pear fruit. Background Technology

[0002] Pear (Pyrus L.) is one of my country's important cultivated fruit trees, occupying a pivotal position in the global pear industry. National statistics show that Shandong Province's pear production ranked sixth in the country for several consecutive years from 2020 to 2024. Superficial scald is a major physiological disease causing browning of the fruit peel during post-harvest low-temperature storage, severely affecting the fruit's appearance and commercial value, causing significant economic losses and hindering the efficient development of my country's pear industry. 'Chili Pear' (Pyrus bretschneideri Rehd.) is a traditional famous and high-quality specialty of Laiyang, Shandong Province, and superficial scald is one of the main physiological diseases affecting its long-term cold storage and shelf-life quality. Therefore, a deeper understanding of the underlying mechanisms leading to superficial scald in pear fruit is of significant scientific importance and application value for improving pear fruit quality and pear genetic improvement.

[0003] The waxy layer of the fruit epidermis is an important component of the fruit's skin, directly contacting the external environment and forming the first line of defense against environmental threats. It plays a crucial role in fruit development, storage, and adaptation to environmental stress. To date, research on tiger skin disease has largely focused on the pathogenicity of α-farnesene and its oxidation products, such as the close relationship between the content of conjugated trienols and 6-methyl-5-hepten-2-one and the occurrence of tiger skin disease. α-Farnesene mainly accumulates in the waxy layer, rather than the cuticle or epidermal cell walls, while tiger skin disease symptoms occur in the subcutaneous and epidermal cells, not the cuticle. The susceptibility of pear fruit to tiger skin disease is highly correlated with the type of its surface waxy structure, but not significantly correlated with the thickness of the cuticle.

[0004] MYB transcription factors are widely involved in the regulation of plant secondary metabolism, cell morphogenesis, and hormone signal transduction. They also play a crucial regulatory role in plant responses to environmental stresses, effectively coordinating the balance between plant growth and development and adaptation to adversity. Research on the function of MYB transcription factors mainly focuses on the regulation of biosynthesis of plant secondary metabolites, cell differentiation and development, and defense responses to biotic and abiotic stresses. Whether MYB proteins regulate the occurrence of tiger skin disease has not yet been reported. Summary of the Invention

[0005] To reduce the incidence of pear fruit scab disease and significantly inhibit its occurrence, this invention provides the application of a transcription factor gene that inhibits the occurrence of postharvest pear fruit scab disease.

[0006] An application of a functional gene, as shown in SEQ ID NO.1 of the nucleotide sequence listing, in inhibiting the occurrence of postharvest pear fruit tiger skin disease is described as follows: In 'Chili' pear, the transcription factor gene shown in SEQ ID NO.1 of the nucleotide sequence listing is cloned into an overexpression vector to promote the biosynthesis of wax in pears and thus inhibit the occurrence of postharvest pear fruit tiger skin disease.

[0007] The regulatory steps for a transcription factor gene, as shown in SEQ ID NO.1, to suppress postharvest pear fruit scab disease are as follows:

[0008] (1) The transcription factor gene shown in SEQ ID NO.1 was cloned into the overexpression vector pSuper1300:GFP to obtain the recombinant plasmid;

[0009] (2) 5 μL of recombinant plasmid was transferred into 50 μL of Agrobacterium tumefaciens GV3101 strain cells by freeze-thaw method to obtain strain cell A; 5 μL of empty vector plasmid was transferred into 50 μL of Agrobacterium tumefaciens GV3101 strain cells by freeze-thaw method to obtain strain cell B.

[0010] Cell strain A and cell strain B were added to 500 μL of Luria-Bertani liquid broth, respectively, and cultured by shaking at 28°C and 200 rpm for 6 hours to obtain shake flask culture A and shake flask culture B.

[0011] 150 μL of shake flask culture A and shake flask culture B were respectively spread on Luria-Bertani plate solid medium containing 50 mg / L kanamycin and 25 mg / L rifampin. After screening and culture for 2 days at 28℃, strain cell clone A and strain cell clone B were obtained.

[0012] (3) Pick one cell clone A and one cell clone B of strain A and inoculate them into 700 μL of lysed broth (Luria-Bertani) containing 50 mg / L kanamycin and 25 mg / L rifampin, respectively. Incubate the culture at 28℃ and 200 rpm for 24 hours to obtain Agrobacterium tumefaciens culture A and Agrobacterium tumefaciens culture B.

[0013] (4) Add Agrobacterium bacterial suspension A and Agrobacterium bacterial suspension B to Luria-Bertani liquid culture medium containing 50 mg / L kanamycin and 25 mg / L rifampin at a volume ratio of 1:100. Incubate at 28°C and 200 rpm until the absorbance at 600 nm is 0.8-1.0. Collect bacterial cells A and B by centrifugation.

[0014] (5) After discarding the supernatant, resuspend twice with an equal volume of MMA solution to adjust the OD. 600 The concentration was 0.8-1.0, and the injection solution was then incubated in a dark incubator at 28°C for 3 hours.

[0015] (6) Using a 1 ml sterile disposable syringe, draw 0.5 ml of the infection solution and slowly inject it into the equatorial region of the 'Chili' pear. Note that when injecting, the needle should be tilted at about 45° to the peel and inserted into the peel to a depth of about 1 mm. Inject four points evenly at the equatorial region of each fruit, for a total of 2 ml of infection solution.

[0016] Further technical solutions are as follows:

[0017] In step (5), the MMA infiltration solution is prepared by mixing 976 mL of distilled water, 10 mL of 1 mol / L magnesium chloride, 10 mL of 1 mol / L fatty acid methyl ester sulfonate and 4 mL of 50 mmol / L acetylsuccinone. The pH value of the infiltration solution is 5.6.

[0018] The beneficial technical effects of this invention are reflected in the following aspects:

[0019] (1) This invention helps to elucidate the molecular mechanism of the pear MYB gene in regulating the occurrence of postharvest pear scab disease, providing a theoretical basis and gene resources for molecular-assisted breeding and genetic engineering breeding of pears. Through pear transient injection experiments, incidence statistics, scanning electron microscopy observation, wax content determination and gene expression analysis, it was shown that: overexpression of PbMYB62 increases the wax content of the peel and inhibits the occurrence of scab disease, while silencing PbMYB62 decreases the wax content of the peel and promotes the occurrence of scab disease, indicating that PbMYB62 has a significant role in regulating the occurrence of postharvest pear scab disease.

[0020] (2) Genetic engineering techniques can be used to introduce the PbMYB62 gene into pear varieties that are prone to tiger skin disease to improve the pear varieties and suppress the occurrence of tiger skin disease. Attached Figure Description

[0021] Figure 1Phenotypic diagrams, wax content, relative expression level of PbMYB62 gene, and correlation analysis diagram of PbMYB62 and wax content of 'Chili' pear treated with unbagging, PE bagging, and non-woven fabric bagging;

[0022] Figure 2 Subcellular localization map of the PbMYB62-pSuper1300:GFP fusion protein in the lower epidermal cells of Nicotiana benthamiana;

[0023] Figure 3 The diagram shows the gene expression pattern of PbMYB62 after overexpression of PbMYB62 in pear fruit, the phenotypic diagram of pear fruit, and the statistical diagram of disease incidence.

[0024] Figure 4 A diagram showing the gene expression pattern of PbMYB62 after PbMYB62 silencing in pear fruit, a phenotypic diagram of pear fruit, and a statistical diagram of disease incidence.

[0025] Figure 5 Scanning electron microscopy (SEM) images and wax content determination images of pear fruits after PbMYB62 overexpression;

[0026] Figure 6 Scanning electron microscopy (SEM) images and wax content determination images of pear fruit after PbMYB62 silencing; Detailed Implementation

[0027] The present invention will now be described in further detail with reference to the accompanying drawings and specific embodiments.

[0028] This invention involved in-depth research, resulting in the isolation and cloning of the pear PbMYB62 (Pbr020295.1) gene from the fruit of the 'Chili' pear. The full-length cDNA is 879 bp and is documented in the Rosaceae database (https: / / www.rosaceae.org). As shown in SEQ ID NO.1 of the nucleotide sequence listing, ATG represents the start codon and TAG represents the stop codon.

[0029] To investigate the function of the gene PbMYB62, this invention constructed the overexpression vector pSuper1300:GFP and the silencing vector pTRV2 for the gene PbMYB62. Wherein:

[0030] The gene expression vector was constructed as follows:

[0031] Forward and reverse primers for PbMYB62 were designed, and the gene sequence was cloned from the cDNA of *Pyrus pyrifolia*. The recombinant plasmid was then constructed into the plant expression vector pSuper1300:GFP using XbaⅠ and SmaⅠ double restriction sites, and transformed into *Agrobacterium tumefaciens* GV3101 cells via freeze-thaw transformation. The primer sequences are as follows:

[0032] First forward primer: GCTCTAGAATGTCCACTAATACTAAAACCCTAA

[0033] First reverse primer: TCCCCCGGGACATGAAAAAATCACTGTCAAACCAG

[0034] The gene silencing vector was constructed as follows:

[0035] A 200-400 bp fragment of the non-conserved region of the PbMYB62 gene cDNA, as shown in SEQ ID NO.1, was selected as a specific fragment, the sequence of which is shown in SEQ ID NO.2. Then, using XbaⅠ and SmaⅠ double restriction enzyme sites, the transcription factor gene-specific fragment shown in SEQ ID NO.2 was cloned into the viral silencing vector pTRV2 to form a recombinant plasmid, which was then transformed into Agrobacterium tumefaciens GV3101 cells using a freeze-thaw method. The primer sequences are as follows:

[0036] Second forward primer: ggttaccgaattctctagAGCAGAGAGTTTCAAAATATGATAAGGTGC

[0037] Second reverse primer: tgtcttcgggacatgcccTGCATGAACTTGTGCAGTAATCTGC

[0038] Through instantaneous injection experiments, incidence rate statistics, scanning electron microscopy observation, wax content determination, and gene expression analysis in pears, it was found that overexpression of PbMYB62 increased the wax content of the peel and inhibited the occurrence of tiger skin disease, while silencing PbMYB62 decreased the wax content of the peel and promoted the occurrence of tiger skin disease. This indicates that PbMYB62 has a significant role in regulating the occurrence of tiger skin disease in postharvest pears.

[0039] Example 1: Expression level of PbMYB62 gene in 'Chili' pear fruit under different bagging treatments

[0040] To investigate the transcription factor genes influencing the occurrence of postharvest tiger skin disease in pears, 'Chili' pears were treated with unbagging, PE bagging, and non-woven fabric bagging. Peel samples from 'Chili' pears with different bagging treatments (unbagging, PE bagging, and non-woven fabric bagging) were rapidly fixed in liquid nitrogen, and the phenotype and wax content of 'Chili' pears were observed. Figure 1 The transcriptome data were analyzed to identify the transcription factor gene PbMYB62, which showed downregulation at at least one time point in PE-bagged fruit and upregulation in non-woven fabric-bagged fruit. Total RNA was extracted from the peel of fruit treated with bagging at different time points and reverse transcribed into cDNA. The expression level of the PbMYB62 gene in 'Chili' pear fruit was then determined. The specific steps are as follows:

[0041] 1. Extraction of total RNA from plants

[0042] A novel plant RNA rapid extraction kit, manufactured by Shandong Cisco Technology Co., Ltd., was used to extract total RNA from pear peel. The specific steps are as follows:

[0043] 1) Homogenization treatment. 50-100 mg of plant pericarp was rapidly ground into powder in liquid nitrogen, 500 μL of lysis buffer RLT Plus was added, and the mixture was immediately vortexed vigorously to mix. The mixture was then centrifuged at 12,500 rpm for 5 minutes.

[0044] 2) Transfer the supernatant to a genome clearance column (place the clearance column in the collection tube), centrifuge at 12,500 rpm for 2 minutes, and collect the filtrate.

[0045] 3) Use a micropipette to accurately estimate the volume of the filtered liquid, and add an equal volume of 70% ethanol (check before use whether anhydrous ethanol has been added). Precipitation may occur, so immediately pipette to mix.

[0046] 4) Add the mixture to an adsorption column RA in two portions (place the adsorption column in the collection tube), centrifuge at 12,500 rpm for 2 minutes, and discard the waste liquid in the collection tube.

[0047] 5) Add 700 μL of protein removal solution RW1 to the adsorption column RA, let it stand at room temperature for 1 minute, centrifuge at 12,500 rpm for 30 seconds, discard the waste liquid in the collection tube, and put the adsorption column RA back into the collection tube.

[0048] 6) Add 500 μL of wash buffer RW (check that anhydrous ethanol has been added before use), centrifuge at 12,500 rpm for 30 seconds, and discard the waste liquid in the collection tube. Add 500 μL of wash buffer RW and repeat once.

[0049] 7) Place the adsorption column RA back into the empty collection tube, centrifuge at 12,500 rpm for 2 minutes to remove as much of the wash solution as possible.

[0050] 8) Remove the adsorption column RA and place it in an RNase-free collection tube. Add 30-50 μL of RNase-free H2O to the middle of the adsorption membrane (preheating in a 70-90℃ water bath beforehand can increase the yield). Let it stand at room temperature for 1 minute and centrifuge at 12,500 rpm for 1 minute.

[0051] 9) Use the first elution buffer to return to the adsorption column and repeat once to obtain the RNA solution.

[0052] Store at -80°C. Before storage, RNA integrity was checked by agarose gel electrophoresis and RNA concentration was determined on an Agilent 2100 bioanalyzer.

[0053] 2. RNA reverse transcription into cDNA

[0054] The samples were reverse transcribed using the HiScript II Q RT SuperMix for qPCR kit, manufactured by Nanjing Novizan Biotechnology Co., Ltd. The specific steps are as follows:

[0055] 1) Genomic DNA removal.

[0056]

[0057] Gently pipette to mix. React at 42°C for 2 minutes.

[0058] 2) Prepare the reverse transcription reaction system.

[0059]

[0060] Gently pipette to mix.

[0061] 3) Perform reverse transcription.

[0062]

[0063] Obtain the reverse transcription product. The product can be used immediately for real-time quantitative reverse transcription polymerase chain reaction, or stored at -20°C and used within six months; for long-term storage, it is recommended to aliquot and store at -70°C. Repeated freeze-thaw cycles should be avoided with cDNA.

[0064] 3. Determination of PbMYB62 gene expression in 'Chili' pear fruit

[0065] 1) Design specific primers for the non-conserved region of the PbMYB62 gene and internal reference primers for pear. The sequences are as follows:

[0066] Third forward primer (PbMYB62): GCCTAGGTTGAAGCAGAAGATAG

[0067] Third reverse primer (PbMYB62): CTGGGATACTGTTGCCGTTAG

[0068] Fourth forward primer (PbActin): CCCAGAAGTGCTCTTCCAAC

[0069] Fourth reverse primer (PbActin): TTGATCTTCATGCTGCTTGG

[0070] 2) Using the cDNA obtained in step 2 of Example 1 as a template, adjust these cDNA templates with the fourth forward primer (PbActin) and the fourth reverse primer (PbActin) of the pear internal reference primers to make the concentration of each cDNA template consistent.

[0071] 3) Real-time quantitative reverse transcription polymerase chain reaction was performed using cDNA templates of consistent concentration to detect the PbMYB62 gene. The relative expression level of the PbMYB62 gene was significantly higher in fruits bagged with non-woven fabric than in fruits bagged with PE. (See...) Figure 1 C. Correlation analysis of wax content and relative expression level of PbMYB62 gene revealed a significant positive correlation between PbMYB62 and wax content. Figure 1 The expression pattern of the D. PbMYB62 gene in the study was consistent with the expected function of the PbMYB62 gene in this experiment, therefore further research on PbMYB62 is warranted.

[0072] Example 2: Full-length cloning of the pear PbMYB62 gene and construction of related vectors

[0073] 1. Cloning of the full-length PbMYB62 gene

[0074] Using the cDNA from step 2 of Example 1 as a template, amplification was performed using 2×SparkHiFi Max Master Mix (with dye) high-fidelity enzyme, which was purchased from Shandong Cisco Technology Co., Ltd. The upstream and downstream primers for PbMYB62 are as follows:

[0075] Fifth forward primer: ATGTCCACTAATACTAAAAC

[0076] Fifth reverse primer: CTACATGAAAAAATCACTGTC

[0077] The amplification steps are as follows: 1)

[0079]

[0080] Template usage:

[0081]

[0082] 2) PCR reaction program: 95℃ pre-denaturation for 3 minutes; cycling parameters are 95℃ denaturation for 15 seconds, 58℃ annealing for 15 seconds, 72℃ extension for 30 seconds, for 35 cycles; 72℃ extension for 5 minutes.

[0083] After the PCR reaction, the PCR product was recovered, ligated into the cloning vector pMD19-T, transformed into Escherichia coli DH5α cells, plated onto Luria-Bertani solid medium containing 50 mg / L ampicillin, and incubated overnight at 37°C. Single colonies were selected and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. The sequencing results were compared with the Rosaceae plant database using BLAST, and the cloned sequence was consistent with the Pbr020295.1 sequence.

[0084] 2. Construction of PbMYB62 gene-related vectors

[0085] The nucleotide sequence of the PbMYB62 gene obtained in step 1 of Example 2 (SEQ ID NO.1) was amplified using primer sequences containing first forward and first reverse primers with XbaI and SamI restriction sites, respectively. The overexpression vector pSuper1300:GFP was digested with restriction endonucleases XbaI and SamI, followed by agarose gel electrophoresis, gel extraction, and ligation of the linear overexpression vector pSuper1300:GFP and the specific fragment of the target gene PbMYB62 using the ClonExpress® II One Step Cloning Kit (C112) (Novizan, Nanjing) homologous recombinase. The resulting fragment was transformed into Escherichia coli DH5α cells. For single colonies with correct sequencing, recombinant plasmids were extracted and transformed into Agrobacterium tumefaciens GV3101 cells using the freeze-thaw method.

[0086] Similarly, using primers with second forward and second reverse primers containing XbaI and SmaI restriction sites respectively, the silencing vector of the PbMYB62 transcription factor gene specific fragment nucleotide sequence listed in SEQ ID NO.2 was cloned into the empty vector pTRV2 to form a recombinant plasmid. The recombinant plasmid was then transformed into Agrobacterium tumefaciens GV3101 cells using the freeze-thaw method.

[0087] Add 5 μL of recombinant plasmid to 50 μL of competent Agrobacterium tumefaciens GV3101 cells, incubate on ice for 30 minutes, flash freeze in liquid nitrogen for 5 minutes, heat shock at 37°C for 5 minutes, and incubate on ice for 5 minutes. Add 500 μL of Luria-Bertani liquid broth to a 1.5 mL centrifuge tube, then add the transformed product, and incubate at 28°C, 200 rpm for 3-5 hours. Spread 150 μL of the culture onto Luria-Bertani solid broth containing 50 mg / L kanamycin and 25 mg / L rifampin, and incubate at 28°C for 2-3 days. Pick a single white colony from the Luria-Bertani solid broth plate and add it to 700 μL of Luria-Bertani liquid broth containing 50 mg / L kanamycin and 25 mg / L rifampin, and incubate at 28°C, 200 rpm for 24 hours. The amplified bacterial solution was used as a template for polymerase chain reaction amplification and verification, resulting in a bacterial solution containing Agrobacterium tumefaciens GV3101 strain cells with recombinant plasmid.

[0088] Example 3: Subcellular localization of the PbMYB62 gene

[0089] Similar to the transient overexpression method for fruits described above, the PbMYB62 fragment digested with restriction endonucleases XbaI and SmaI was inserted into the pSuper1300:GFP vector to generate a recombinant plasmid of the PbMYB62 fusion protein with green fluorescent protein (GFP). The resulting recombinant plasmid was transformed into Agrobacterium tumefaciens GV3101 cells and infected with Nicotiana benthamiana leaves. EVOS was used... TM FL AUTO2 (Thermo Fisher Scientific, Massachusetts, USA) observed infected *Nicotiana benthamiana* leaves. The specific steps are as follows:

[0090] 1) Preparation of MMA infiltration solution. 100 mL of infiltration solution is prepared by mixing 97.6 mL of distilled water, 1 mL of 1 mol / L magnesium chloride, 1 mL of 1 mol / L fatty acid methyl ester sulfonate and 0.4 mL of 50 mmol / L acetylsuccinone. The pH of the infiltration solution is 5.6. It should be prepared and used immediately.

[0091] 2) At a volume ratio of 1:100, Agrobacterium GV3101 containing PbMYB62-pSuper1300:GFP, pSuper1300:GFP, mCherry (a nuclear localization marker), and P19 (promoting infection) were placed in Luria-Bertani liquid broth containing 50 mg / L kanamycin and 25 mg / L rifampicin. The culture was carried out at 28°C and 200 rpm until OD (occurrence limit) was reached. 600 The value was 1.0. Two treatments were set up: PbMYB62 - pSuper1300: GFP (PbMYB62 - pSuper1300: GFP mixed with mCherry and P19 at a volume ratio of 5:5:3); and pSuper1300: GFP (pSuper1300: GFP mixed with mCherry and P19 at a volume ratio of 5:5:3). The infection solutions were then incubated in a dark incubator at 28°C for 3 hours.

[0092] 3) Inject 1 ml of sterile disposable syringe (without needle) into the back of the tobacco leaf, darken for 1 day, and then expose to light.

[0093] 4) Two days after exposure to light, peel off the lower epidermis of the injected tobacco leaves, place them on a clean glass slide, and observe the localization of the target protein at the subcellular level under an AUTO2 microscope.

[0094] The results showed that the fusion protein was located in the cell nucleus. (See [link]) Figure 2 The scale is 125 µm.

[0095] Figure 2 The AD in the data indicates that pSuper1300:GFP is localized to the nuclear membrane. Figure 2 The letter E in the figure indicates the distribution of the target protein within the cell after fusion with green fluorescent protein, which gives it a green color. Figure 2 Figure F in the figure indicates that the protein containing nuclear localization markers and mCherry is located in the cell nucleus and is shown in red; Figure G illustrates the structural integrity and state of the cell. Figure 2 The "H" indicates the result of overlaying the GFP map and the nuclear marker map. Both are located in the cell nucleus, so the overlay appears yellow.

[0096] Example 4: Transient transformation of pear fruit with the PbMYB62 gene

[0097] 1. Injection of a vector containing the PbMYB62 gene overexpression

[0098] 1) Preparation of MMA inoculation solution. 1000 mL of inoculation solution was prepared by mixing 976 mL of distilled water, 10 mL of 1 mol / L magnesium chloride, 10 mL of 1 mol / L fatty acid methyl ester sulfonate and 4 mL of 50 mmol / L acetylsyl syringone. The pH of the inoculation solution was 5.6. It was prepared and used immediately.

[0099] 2) Prepare the injection solution. At a volume ratio of 1:100, place GV3101 Agrobacterium containing PbMYB62-pSuper1300:GFP and pSuper1300:GFP respectively into Luria-Bertani liquid broth containing 50 mg / L kanamycin and 25 mg / L rifampicin. Incubate at 28°C and 200 rpm until OD500. 600 The concentration was 0.8–1, then transferred to a 50 ml centrifuge tube, centrifuged at 200 rpm for 10 minutes to collect the bacterial cells, and resuspended twice in MMA solution to adjust the OD value. 600 The concentration was set to 0.8-1, and the injection solution was then incubated in a dark incubator at 28°C for 3 hours. Specific procedures for obtaining GV3101 Agrobacterium containing recombinant and empty plasmids are detailed in Example 2, Section 2, on the construction of related vectors.

[0100] 3) Injection. Using a 1 ml sterile disposable syringe, draw 0.5 ml of the infection solution and slowly inject it into the equatorial region of the 'Chili' pear. Note that when injecting, the needle should be tilted at approximately 45° to the peel and inserted to a depth of approximately 1 mm. Inject four points evenly at the equatorial region on each fruit, for a total of 2 ml of infection solution.

[0101] 2. Injection of a silencing vector containing the PbMYB62 gene

[0102] 1) Preparation of MMA infiltration solution. 1000 mL of infiltration solution is prepared by mixing 976 mL of distilled water, 10 mL of 1 mol / L magnesium chloride, 10 mL of 1 mol / L fatty acid methyl ester sulfonate and 4 mL of 50 mmol / L acetylsuccinone. The pH of the infiltration solution is 5.6. It should be prepared and used immediately.

[0103] 2) Prepare the injection solution. At a volume ratio of 1:100, place GV3101 Agrobacterium containing PbMYB62-pTRV2, pTRV2, and pTRV1 (the helper expression vector for pTRV2) into Luria-Bertani liquid broth containing 50 mg / L kanamycin and 25 mg / L rifampicin. Incubate at 28°C and 200 rpm until OD500. 600The bacterial cells were collected at an OD value of 1.0 to 2.0, then transferred to 50 ml centrifuge tubes and centrifuged at 200 rpm for 10 minutes. The cells were then resuspended once with MMA solution to adjust the OD value. 600 For a concentration of 1.0-2.0, two treatments were set up: PbMYB62-pTRV (PbMYB62-pTRV2 and pTRV1 mixed at a volume ratio of 1:1); and pTRV (pTRV2 and pTRV1 mixed at a volume ratio of 1:1). The injection solutions were then incubated at 28°C in the dark for 3 hours. The specific steps for obtaining GV3101 Agrobacterium containing the recombinant plasmid and the empty vector plasmid are detailed in Example 2, Section 2, on the vector construction steps.

[0104] 3) Injection. Using a 1 ml sterile disposable syringe, draw 0.5 ml of the infection solution and slowly inject it into the equatorial region of the 'Chili' pear. Note that when injecting, the needle should be tilted at approximately 45° to the peel and inserted to a depth of approximately 1 mm. Inject four points evenly at the equatorial region on each fruit, for a total of 2 ml of infection solution.

[0105] Example 5: Relative expression level of PbMYB62 gene in transiently transformed pear fruit

[0106] 1) Pear pulp samples were taken from the four experimental groups and rapidly fixed in liquid nitrogen. Total RNA was extracted from the peels of the different groups and reverse transcribed into cDNA, using the same method as steps 1 and 2 in Example 1.

[0107] 2) Using the cDNA obtained in step 1) as a template, adjust the cDNA template with the fifth forward primer (PbActin) and the fifth reverse primer (PbActin) of the pear internal reference primer to make the concentration of each cDNA template consistent.

[0108] 3) Real-time quantitative reverse transcription polymerase chain reaction was performed using cDNA templates of consistent concentration to detect the expression differences of the PbMYB62 gene in the pericarp of different experimental groups.

[0109] The results showed that PbMYB62 expression was significantly increased in overexpression fruits compared to control fruits (empty vector pSuper1300:GFP). (See [link to relevant documentation]). Figure 3 In A. Compared with the control fruit (empty vector pTRV), the expression of PbMYB62 was significantly reduced in the silenced fruit. See [reference needed]. Figure 4 A in the middle.

[0110] Example 6: Phenotypic analysis, disease incidence statistics, wax content determination, and scanning electron microscopy observation of 'Chili' fruit after transient transformation.

[0111] 1. Statistics on the incidence of disease in 'Chili' fruit

[0112] The 'Chili' pears from the four experimental groups were placed in a small photography studio, and the injected surfaces of the 'Chili' pears were photographed. The number of diseased 'Chili' pears from each of the four experimental groups was counted, and the incidence rate of tiger skin disease was calculated as (number of diseased fruits / total number of fruits) × 100%.

[0113] The results showed that pSuper1300:GFP pears exhibited more browning on the pericarp surface than pbMYB62-pSuper1300:GFP pears, and the incidence rate was higher in pSuper1300:GFP pears. (See [link to relevant documentation]). Figure 3 BC; pTRV pears showed less browning on the pericarp surface than PbMYB62-pTRV fruits, and had a lower incidence of disease. See [link to relevant documentation]. Figure 4 BC in the middle.

[0114] 2. Scanning electron microscopy observation of the pericarp of 'Chili' fruit

[0115] Select fruit peel samples measuring 3 mm × 3 mm × 1 mm from the injection site, completely remove the pulp beneath the peel, leaving a peel thickness of approximately 1 mm, place them in 1.5 ml test tubes, and immediately immerse them in liquid nitrogen. Dry the samples using a freeze dryer (Alpha 1-2 LDplus, Germany) for 24 hours, then fix them on a gold-spraying stage. After three gold-spraying cycles, observe the samples under a scanning electron microscope (JSM-7500F, Japan) at 500 and 2000x magnification.

[0116] The results showed that the surface of pSuper1300:GFP pear fruit was not covered with spherical and granular wax and had more cracks, while the surface of PbMYB62-pSuper1300:GFP fruit was more intact. (See [link to relevant documentation]). Figure 5 The surface of A;pTRV pear fruit has a small amount of spherical and granular wax covering it, while the surface of PbMYB62-pTRV fruit has more cracks. See [link to relevant documentation]. Figure 6 A in the middle.

[0117] 3. Determination of wax content in the pericarp of 'Chili' fruit

[0118] Peel pieces with a diameter of 1.0 cm were taken from each fruit, and the pulp underneath was completely removed. The peel thickness was approximately 1 mm. A total of 15 peel discs were taken from three fruits as one replicate, and three replicates were measured for each sample. The samples were placed in pre-weighed 50 mL centrifuge tubes, with the empty centrifuge tube mass being m1. The samples were completely immersed in 20 mL of chloroform in a fume hood for 30 minutes. The wax extract was dried using a nitrogen blower, and the total mass of the centrifuge tubes was weighed again. The mass of the centrifuge tube containing the extracted wax was m2. Wax content (mg / cm³) 2 = (mass of centrifuge tubes containing wax extraction m2 - mass of empty centrifuge tubes m1) / total blade area.

[0119] The results showed that the wax content of pSuper1300 pear fruit was lower than that of PbMYB62-pSuper1300:GFP fruit. (See [link to relevant documentation]). Figure 5 The wax content of B;pTRV pear fruit is higher than that of PbMYB62-pTRV fruit. See [link to relevant documentation]. Figure 6 B in the middle.

[0120] Based on the above technology, a PbMYB62 was isolated from pear. Functional verification and physiological phenotypic determination through pear instantaneous injection experiments showed that PbMYB62 can play a positive regulatory role in inhibiting tiger skin disease by promoting wax synthesis. This provides a basis for the regulation of tiger skin disease and the improvement of pear fruit quality, and has important economic and social benefits for improving pear quality.

[0121] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. The application of the pear transcription factor PbMYB62 gene in inhibiting the occurrence of tiger skin disease in pear fruit, characterized in that, In 'Chili' pear, an overexpression vector was constructed using the gene shown in SEQ ID NO.1 with the nucleotide sequence described above. Overexpression of the functional gene PbMYB62 increased wax biosynthesis in pear and inhibited the occurrence of tiger skin disease. A silencing vector was constructed using a transcription factor gene-specific fragment shown in SEQ ID NO.2 with the nucleotide sequence described above. Silencing of the functional gene PbMYB62 reduced wax biosynthesis in pear and promoted the occurrence of tiger skin disease.

2. The application of the pear transcription factor PbMYB62 gene according to claim 1 in inhibiting the occurrence of pear fruit scab disease, characterized in that: The overexpression vector is pSuper1300:GFP, and the silencing vector is pTRV2.

Images