Rice haplotype combination against rice false smut and breeding application thereof
Patent Information
- Application Number
- CN202611104283.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-07-24
- Publication Date
- 2026-08-21
AI Technical Summary
[0005]另外,现有水稻抗稻曲病育种对降低抗性的反向研究较小,降低抗性的研究在田间生态调控、对照实验设置、低抗病模型构建等方面同样具有重要价值
[0034] This invention isolates and clones an immune co-receptor encoding gene from rice. SOBIR1 This gene was knocked out and overexpressed, clarifying its biological function in regulating rice resistance to rice false smut. This invention determined that SOBIR1 interacts with the rice false smut resistance protein Ruv1, jointly regulating rice false smut resistance. Ruv1 The mainstream haplotype in contemporary rice varieties is Ruv1 Hap2 These varieties are generally susceptible to rice blast, but Ruv1 Hap2 and SOBIR1 Hap5 Specific haplotype combinations significantly enhance resistance to rice false smut. This invention constructs a population of recombinant inbred lines and, through marker-assisted selection, creates lines containing… Ruv1 Hap2 and SOBIR1 Hap5 Haplotype combinations of rice blast-resistant materials.
Smart Images

Figure CN122609629A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of bioengineering technology, and in particular to a rice haplotype combination resistant to rice false smut and its breeding application. Background Technology
[0002] Rice is one of the world's most important food crops, and its stable and high yields are directly related to public health. In recent years, with the large-scale promotion of high-yield hybrid rice, increased nitrogen fertilizer application, and intensive farming practices, the frequency and severity of rice false smut have increased significantly, evolving from an occasional minor disease into a major panicle fungal disease in major rice-producing areas worldwide. Caused by the ascomycete *Aspergillus oryzae*, this disease not only leads to grain abortion, reduced thousand-grain weight, and yield loss, but more seriously, the pathogen produces various mycotoxins during infection, harming human and animal health. Currently, field control of rice false smut still heavily relies on chemical fungicides. However, these fungicides have a narrow control window, require strict timing of application, and long-term use can easily lead to environmental residues and pathogen resistance, which is inconsistent with the direction of green agriculture and sustainable development. Therefore, breeding disease-resistant rice varieties is considered the most economical, environmentally friendly, and efficient solution.
[0003] However, breeding rice blast resistance has long faced severe challenges. On the one hand, germplasm resources with disease resistance and excellent agronomic traits are extremely scarce in nature; on the other hand, although a large number of studies have used different genetic populations to locate multiple quantitative trait loci (QTLs) for rice blast resistance, the major resistance genes at these loci have not yet been cloned due to the complex genetic basis of this resistance trait and the fact that phenotypic identification is easily interfered with by developmental traits such as heading date.
[0004] The applicant filed an invention patent application at the same time, in which, Ruv1 An antiviral gene encoding a receptor-like protein family (LRR-RLP) enhances rice false smut resistance when overexpressed. In studies of other plants, such as Arabidopsis, LRR-RLP resistance typically requires the synergistic effect of its co-receptor SOBIR1. While some studies in rice have shown SOBIR1's involvement in regulating virus resistance, no research has revealed a link between it and rice false smut resistance, nor have there been reports of its synergistic regulation of rice false smut resistance with Ruv1. Furthermore, Ruv1 and SOBIR1 It is unclear whether there are powerful haplotype combinations. Therefore, constructing... Ruv1 and SOBIR1 An efficient haplotype combination model, along with a supporting molecular marker-assisted selection system, can provide core germplasm and technical support for overcoming the current technical bottlenecks in breeding rice blast resistance and cultivating a new generation of rice varieties that combine high yield, high quality, and disease resistance.
[0005] In addition, there is relatively little research on the reverse effect of existing rice blast resistance breeding to reduce resistance. Research on reducing resistance is also of great value in terms of field ecological regulation, setting up control experiments, and constructing low disease resistance models. Summary of the Invention
[0006] In view of this, the present invention provides a rice haplotype combination resistant to rice false smut and its breeding application. The present invention establishes an interaction between SOBIR1 and the rice false smut resistance protein Ruv1, which jointly regulate rice false smut resistance.
[0007] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0008] In a first aspect, this invention provides rice genes. SOBIR1 Application in regulating rice resistance to rice false smut.
[0009] In some specific embodiments of the present invention, the rice gene is overexpressed. SOBIR1 This enhances the resistance of rice to rice false smut.
[0010] In some specific embodiments of the present invention, knocking out the rice gene SOBIR1 This reduces the resistance of rice to rice false smut.
[0011] Reducing the resistance of rice to rice false smut has the following uses: (1) serving as a key control for resistance evaluation in large-scale comparative experiments of rice false smut resistance breeding; (2) In field production, planting low-disease-resistant varieties in a planned small area can play the role of "inducing pathogens" or "pathogen shelters". (3) By using instantaneous transformation and other methods, low disease resistance models can be built for basic research, and low-resistance materials for rice false smut can be created quickly.
[0012] Secondly, the present invention also provides Ruv1 and SOBIR1 Application of protein-protein interactions in regulating rice resistance to rice false smut.
[0013] In some specific embodiments of the present invention, the rice gene is overexpressed in the application. SOBIR1 and Ruv1 This enhances the resistance of rice to rice false smut.
[0014] In some specific embodiments of the present invention, the rice gene described in the application is... SOBIR1 It has the nucleotide sequence shown in SEQ ID No. 1.
[0015] In some specific embodiments of the present invention, the rice gene described in the application is... Ruv1 It has the nucleotide sequence shown in SEQ ID No. 16.
[0016] Thirdly, the present invention also provides rice resistant to rice false smut, comprising any of the following: (I) Overexpression of the exogenous inserted gene; the exogenous inserted gene is a rice gene. SOBIR1; (II) Overexpression of the exogenous inserted gene; the exogenous inserted gene is a rice gene. SOBIR1 and Rice genes Ruv1 .
[0017] In some specific embodiments of the present invention, the rice gene... SOBIR1 It has the nucleotide sequence shown in SEQ ID No. 1.
[0018] In some specific embodiments of the present invention, the rice gene... Ruv1 It has a nucleotide sequence as shown in SEQ ID No. 16.
[0019] Fourthly, the present invention also provides amplification of rice genes. SOBIR1 The primer set has the following characteristics: (I) The upstream primer has the nucleotide sequence shown in SEQ ID No. 17; and (II) The downstream primer has the nucleotide sequence shown in SEQ ID No. 18.
[0020] Fifthly, the present invention also provides amplification of rice genes. SOBIR1 The reagents include the primer set described above.
[0021] Sixthly, the present invention also provides amplification of rice genes. SOBIR1 The kit includes the primer set or the reagents described herein.
[0022] In a seventh aspect, the present invention also provides a method for improving the resistance of rice to rice false smut, by improving the resistance of rice to rice false smut through any of the following: (I) Overexpression of rice genes SOBIR1 ;or (II) Overexpression of rice genes SOBIR1 and rice genes Ruv1 .
[0023] In some specific embodiments of the present invention, the method includes the rice gene. SOBIR1 It has the nucleotide sequence shown in SEQ ID No. 1.
[0024] In some specific embodiments of the present invention, the method includes the rice gene. Ruv1It has a nucleotide sequence as shown in SEQ ID No. 16.
[0025] In some specific embodiments of the present invention, the method transfers rice genes SOBIR1 and Rice genes Ruv1 A vector was constructed and transferred into rice cells using Agrobacterium-mediated transformation to realize the rice gene. SOBIR1 and the rice gene Ruv1 Overexpression.
[0026] Eighthly, the present invention also provides a method for detecting rice genes. SOBIR1 and rice genes Ruv1 A primer set for expressing the rice gene at a certain level. SOBIR1 Quantitative primer set and the rice gene Ruv1 Quantitative primer set; The rice gene SOBIR1 The quantitative primer set has the following characteristics: (I) The upstream primer has the nucleotide sequence shown in SEQ ID No. 9; and (II) The downstream primer has the nucleotide sequence shown in SEQ ID No. 10; The rice gene Ruv1 The quantitative primer set has the following characteristics: (I) The upstream primer has the nucleotide sequence shown in SEQ ID No. 44; and (II) The downstream primer has the nucleotide sequence shown in SEQ ID No. 45.
[0027] In some specific embodiments of the present invention, the primer set further includes a rice internal reference gene. Ubiquitin Quantitative primer set; The rice internal reference gene Ubiquitin The quantitative primer set has the following characteristics: (I) The upstream primer has the nucleotide sequence shown in SEQ ID No. 11; and (II) The downstream primer has the nucleotide sequence shown in SEQ ID No. 12.
[0028] Ninthly, the present invention also provides methods for detecting rice genes. SOBIR1 and rice genes Ruv1 Reagents for expressing levels in rice, including the primer set described above.
[0029] In a tenth aspect, the present invention also provides methods for detecting rice genes. SOBIR1 and rice genes Ruv1A kit for expressing levels in rice, comprising the primer set or the reagents described herein.
[0030] Eleventhly, the present invention also provides a method for identifying resistance to rice false smut, using the genome of the rice sample to be tested as a template, and performing detection according to any of the following items; (I) The primer set described above; (II) The reagents described above; and / or (III) The aforementioned reagent kit; If the expression level of the rice gene SOBIR1 is increased in the test sample compared to the wild type, or if the rice gene SOBIR1 and the rice gene Ruv1 are co-expressed, then the test sample has strong resistance to rice false smut. Conversely, the rice sample tested has weak resistance to rice false smut; The rice gene SOBIR1 has the nucleotide sequence shown in SEQ ID No. 1; The rice gene Ruv1 has a nucleotide sequence as shown in SEQ ID No. 16.
[0031] In a twelfth aspect, the present invention also provides a method for breeding rice resistant to rice false smut, comprising the following steps: Using the genome of the rice sample to be tested as a template, the following tests were performed: (I) The primer set described above; (II) The reagents described above; and / or (III) The aforementioned reagent kit; If the expression of the rice gene SOBIR1 is increased in the test sample compared to the wild type, or if the rice gene SOBIR1 and the rice gene Ruv1 are co-expressed, then the test sample will be retained for breeding. The rice gene SOBIR1 has the nucleotide sequence shown in SEQ ID No. 1; The rice gene Ruv1 has a nucleotide sequence as shown in SEQ ID No. 16.
[0032] In a thirteenth aspect, the present invention also provides Ruv1 Hap2 and SOBIR1 Hap5 Application in enhancing resistance to rice false smut; The Ruv1 Hap2 It has the nucleotide sequence shown in SEQ ID No. 16; The SOBIR1 Hap5 It has a nucleotide sequence as shown in SEQ ID No. 1.
[0033] In a fourteenth aspect, the present invention also provides rice resistant to rice false smut, comprising... Ruv1 Hap2 and SOBIR1 Hap5 Haplotype combinations; The Ruv1 Hap2 It has the nucleotide sequence shown in SEQ ID No. 16; The SOBIR1 Hap5 It has a nucleotide sequence as shown in SEQ ID No. 1.
[0034] This invention isolates and clones an immune co-receptor encoding gene from rice. SOBIR1 This gene was knocked out and overexpressed, clarifying its biological function in regulating rice resistance to rice false smut. This invention determined that SOBIR1 interacts with the rice false smut resistance protein Ruv1, jointly regulating rice false smut resistance. Ruv1 The mainstream haplotype in contemporary rice varieties is Ruv1 Hap2 These varieties are generally susceptible to rice blast, but Ruv1 Hap2 and SOBIR1 Hap5 Specific haplotype combinations significantly enhance resistance to rice false smut. This invention constructs a population of recombinant inbred lines and, through marker-assisted selection, creates lines containing… Ruv1 Hap2 and SOBIR1 Hap5 Haplotype combinations of rice blast-resistant materials. Attached Figure Description
[0035] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.
[0036] Figure 1 Show SOBIR1 Identification of gene-edited and overexpression lines; among which, A indicates SOBIR1 A schematic diagram of gene structure and gene editing target sites; black boxes represent exons, gray boxes represent UTRs; B shows wild-type TP309 and SOBIR1 Overexpression lines SOBIR1-OX3 / OX5 In SOBIR1 Gene expression analysis, housekeeping genes in rice Ubiquitin As an internal reference gene; significant differences were observed. t test, express P <0.05, express P <0.01; Figure 2 Show SOBIR1 Phenotypes of gene-edited strains; wild-type TP309 and SOBIR1 Gene-edited strains sobir1 Photographs of panicles and diseased grain percentage after inoculation with *Aspergillus oryzae*; statistical significance of differences was determined. t test, express P <0.01; Figure 3 Show SOBIR1 Phenotype of overexpression lines of the gene; wild-type TP309 and SOBIR1 Gene overexpression lines SOBIR1-OX3 / OX5 Photographs of panicles and diseased grain percentage after inoculation with *Aspergillus oryzae*; statistical significance of differences was determined. t test, express P <0.05, express P <0.01; Figure 4 This diagram illustrates the interaction between SOBIR1 and Ruv1 proteins. Input represents the total protein sample, IP-GFP represents the sample after immunoprecipitation with anti-GFP antibody, α-GFP and α-HA represent Western blot detection using anti-GFP and anti-HA antibodies, respectively. "+" indicates the protein has been transformed into the corresponding fusion protein expression vector, and "-" indicates it has not been transformed into the corresponding expression vector. The numbers on the right represent the protein molecular weight (kDa). Figure 5 Show Ruv1 Haplotype analysis of genes; where A represents Ruv1 A schematic diagram of gene structure and haplotype variation sites. Black boxes represent exons, and gray boxes represent UTRs. The table below shows the base composition of the five haplotypes Hap1 to Hap5; B indicates... Ruv1 The distribution proportion of different haplotypes of a gene in each rice subgroup is shown. The number in parentheses below the horizontal axis represents the total number of samples for that haplotype. The legend on the right represents different rice subgroup classifications. Ind I, Ind II, and Ind III represent three indica rice subgroups, and Ind X represents other indica rice that was not classified into the three indica rice subgroups. TeJ represents temperate japonica rice, TrJ represents tropical japonica rice, and Jap X represents other japonica rice that was not classified into two japonica rice subgroups. In addition, Aus represents the autumn rice subgroup, Aro represents the fragrant rice subgroup, and Mix represents the mixed type. C indicates the proportion of each haplotype in 1937 resource materials. Figure 6 Show SOBIR1 Haplotype analysis of genes and its relationship with Ruv1 Phenotypic analysis of haplotype combinations; where A represents SOBIR1 Base composition of haplotypes Hap1 to Hap6 of the gene; B indicates SOBIR1 The distribution proportion of different haplotypes of a gene in each rice subgroup is shown. The number in parentheses below the horizontal axis represents the total number of samples for that haplotype. The legend on the right represents different rice subgroup classifications. Ind I, Ind II, and Ind III represent three indica rice subgroups, and Ind X represents other indica rice that has not been classified into the three indica rice subgroups. TeJ represents temperate japonica rice, TrJ represents tropical japonica rice, and Jap X represents other japonica rice that has not been classified into two japonica rice subgroups. In addition, Aus represents the autumn rice subgroup, Aro represents the fragrant rice subgroup, and Mix represents the mixed type. C indicates carrier. Ruv1 The percentage of diseased grains in resource materials with different haplotype combinations of the Hap2 and SOBIR1 genes after inoculation with *Aspergillus oryzae*; the number before the "&" symbol represents... Ruv1 The haplotype of a gene, the number after the '&' represents SOBIR1 Gene haplotype; Figure 7 Demonstrating the verification of genetically modified organisms Ruv1 Hap2 and SOBIR1 Hap5 Rice false smut resistance in haplotype combinations; wild-type TP309 and Ruv1 Hap2 and SOBIR1 Hap5 Diseased grain rates of transgenic lines 2 and 6 after inoculation with *Aspergillus oryzae*; significant differences were observed. t test, express P <0.01; Figure 8 Demonstrates the creation of recombinant self-introduction systems Ruv1 Hap2 - SOBIR1 Hap5 Haplotype combinations of rice blast-resistant materials; panicle photographs and diseased grain percentages of parental materials YZW2 and TP309 and their recombinant inbred lines F6-224 and F6-293 after inoculation with *Aspergillus oryzae*; significant differences were verified by one-way ANOVA, with different letters representing... P Significant difference at the level <0.05; Figure 9 This invention demonstrates the expression vector constructed according to the present invention. Ruv1 -Diagram of OE construction; Figure 9 Figure A in the diagram: Insertion of expression vector Ruv1 -OE contains the highly expressed promoter Ruv1Pro R2115 and Ruv1Schematic diagram of DNA fragments in the gene region; RB and LB represent the right and left boundaries of T-DNA, respectively; HygR represents the hygromycin phosphotransferase gene; Ruv1Pro R2115 Indicates that rice variety Ya Hui 2115 is in Ruv1 The promoter of the gene, CaMV35S represents the promoter of cauliflower mosaic virus, NOS represents the polyadenylation signal sequence terminator, and EcoRI and SalI are restriction endonucleases. Figure 9 Figure B in the diagram: Expression vector in the background of rice TP309. Ruv1 -OE obtained from genetically modified rice Ruv1 Gene expression level detection; Figure 10 CRISPR knockout vector Ruv1 - Cas9 construction diagram; Figure 10 Figure A in the text: Ruv1 - Vector map of Cas9; U3 represents an RNA polymerase III promoter, Ubi represents a ubiquitin gene promoter, and Cas9 represents a CRISPR-related endonuclease gene; Figure 10 Figure B in the text: Ruv1 Design sites for CRISPR target TS1 and TS2 gRNAs and Ruv1 The number and location of deoxyribonucleotides missing in gene knockout rice lines compared to wild-type. Detailed Implementation
[0037] This invention discloses a rice haplotype combination resistant to rice false smut and its breeding application. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired result. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.
[0038] In rice SOBIR1 The gene encodes a receptor-like kinase, with the gene number LOC_Os06g18000 / Os06g0288100 in the Japanese Haru reference genome.
[0039] The rice haplotype combination resistant to rice false smut provided by this invention and the raw materials and reagents used in its breeding application are all commercially available.
[0040] The present invention will be further illustrated below with reference to the embodiments: Example 1 Construction SOBIR1 CRISPR-Cas9 gene editing vector Using the online gene editing site design tool TargetDesign (http: / / skl.scau.edu.cn / targetdesign / ), the gene editing sites were designed... SOBIR1 The gene region sequence (SEQ ID No. 1) was analyzed to identify candidate editing targets, and the success rate of targeting candidate sites was evaluated using the accompanying offTarget tool (http: / / skl.scau.edu.cn / offtarget / ). Ultimately, SEQ ID No. 2 was selected as the editing target. SOBIR1 The target sequence of the gene. Using the sgRNA expression cassette plasmid pYLsgRNA-OsU6a as a template, and SEQ ID No. 3 and SEQ ID No. 4 as amplification primers, an sgRNA expression cassette driven by the OsU6a promoter was constructed. The sgRNA expression cassette was ligated into the gene editing vector pYLCRISPR / Cas9Pubi-H using the BsaI restriction site and T4 ligase, and constructed... SOBIR1 The gene was edited using a CRISPR-Cas9 vector. The sequence accuracy of the knockout vector was ultimately verified through E. coli transformation, colony PCR identification, plasmid extraction, and Sanger sequencing.
[0041] SEQ ID No. 1: SEQ ID No. 2: GCGGCAGTACGTGCGCCACC SEQ ID No. 3: CGGCAGTACGTGCGCCACCGTTTTAGAGCTAGAAAT SEQ ID No. 4: GGTGGCGCACGTACTGCCGCGGCAGCCAAGCCAGCA Example 2 Construction SOBIR1 Gene overexpression vector Fresh young panicles from the japonica rice variety Taipei 309 (TP309) were used to extract total RNA using the TRIzol method. Genomic DNA removal and first-strand cDNA synthesis were performed using the NovoScript® Plus All-in-one 1st Strand cDNA Synthesis SuperMix (novoprotein, E047) reverse transcription kit. Using the synthesized cDNA as a template and SEQ ID No. 5 and SEQ ID No. 6 as primers, amplification was performed... SOBIR1 The full-length coding sequence (CDS) of the gene was recovered and ligated into the vector pCAMBIA1300-35S via homologous recombination to obtain 35S-driven expression. SOBIR1 Gene overexpression vectors were developed. The sequence accuracy of the overexpression vectors was ultimately verified through E. coli transformation, colony PCR identification, plasmid extraction, and Sanger sequencing.
[0042] SEQ ID No. 5: CGGGGGACGAGCTCGGTACCTCTCACACTGGACTAGAGACA SEQ ID No. 6: AACGAAAGCTCTGCAGGTCGACAGTCTAATCCTCCTGTGTAT Example 3: Isolation of Clones Ruv1 DNA fragments of the complete coding region of a gene Genomic DNA was extracted from leaves of rice variety Taipei 309 (TP309) using the CTAB method as a template. SEQ ID No. 52 and SEQ ID No. 53 were used as amplification primers to clone [a specific DNA sequence]. Ruv1 DNA sequence of the complete coding region (SEQ ID No. 22).
[0043] SEQ ID No. 52: TACACTCGTCCTTGAGCCATGCCCCTTTTTCATCAGATCC SEQ ID No. 53: AACGAAAGCTCTGCAGGTCGACCTACTGCAAAGGCGTCCTATGGTCG SEQ ID No. 22: Example 4 Separation Ruv1 DNA fragments of gene-high expression promoters Genomic DNA was extracted from leaves of rice variety YH2115 using the CTAB method and used as a template. Using SEQ ID No. 36 and SEQ ID No. 54 as amplification primers, PCR was used to isolate and clone samples containing... Ruv1 The promoter DNA sequence of the 5'UTR of the gene (SEQ ID No. 38).
[0044] SEQ ID No. 36: GCTATGACCATGATTACGAATTCATTGCACAGTGTAGGAGACAACCC SEQ ID No. 54: GGATCTGATGAAAAAGGGGCATGGCTCAAGGACGAGTGTA SEQ ID No. 38: Example 5 Construction Ruv1 Gene overexpression vector The vector pCAMBIA1300 was digested with EcoRI and SalI, and then ligated together with the PCR products obtained in Examples 1 and 2 using a multi-fragment recombinase (C113, Nanjing Novizan Biotechnology Co., Ltd.). The ligation product was transformed into competent *E. coli* Tran-DH5α cells (purchased from Beijing TransGen Biotech Co., Ltd.) by heat-activated transformation, and then incubated in 600 μL of LB medium for 45-60 min. The cells were then plated on LA medium containing 50 mg / L kanamycin and incubated at 37°C for 16-20 h (LB and LA formulations referenced from: MR. Green, J. Sambrook, *Molecular Cloning: A Laboratory Manual*, 4th Edition, Science Press, Beijing, 2017-03). After bacterial growth, single clones were picked and identified by PCR. Positive clones were transferred to test tubes for amplification and plasmid extraction. The resulting expression vector was named. Ruv1 -OE (e.g.) Figure 9 (As shown in A).
[0045] Example 6 Construction Ruv1 CRISPR-Cas9 gene editing vector For rice Ruv1 Gene design based on target sequences of the CRISPR / Cas9 system, located in Ruv1 The two target sequences are located near the 5' end of the gene's exons, as shown in SEQ ID No. 28 and SEQ ID No. 29, respectively (e.g.). Figure 10 (As shown in B). Based on the sequences of sgRNA TS1 and TS2, the following primers were designed (the primer design method can be found in the published article, Xie et al., Boosting CRISPR / Cas9 multiplex editing capability with the endogenous tRNA processing system. PNAS. 2015, 112(11): 3570-3575.): TS1-F (SEQ ID No. 46), TS1-R (SEQ ID No. 47), TS2-F (SEQ ID No. 48), and TS2-R (SEQ ID No. 49).
[0046] (1) Construction of tRNA-gRNA fragments Using plasmid pGTR (containing a gRNA-tRNA fusion fragment, which enables efficient expression and processing of multiple gRNAs using an endogenous tRNA processing system) as a template, fragment P1 was amplified using primers S5AD5-F (SEQ ID No. 50) and TS1-R (SEQ ID No. 47), fragment P2 was amplified using primers TS1-F (SEQ ID No. 46) and TS2-R (SEQ ID No. 49), and fragment P3 was amplified using primers TS2-F (SEQ ID No. 48) and S3AD5-R (SEQ ID No. 51).
[0047] SEQ ID No. 28: AATTCTTGGACAGAGTGATA SEQ ID No. 29: AACCTGACAGGAAGTATAAG SEQ ID No. 46: taGGTCTCGACAGAGTGATAgttttagagctagaa SEQ ID No. 47: cgGGTCTCTGTCCAAGAATTtgcaccagccggg SEQ ID No. 48: taGGTCTCAGGAAGTATAAGgttttagagctagaa SEQ ID No. 49: cgGGTCTCTCCTGTCAGGTTtgcaccagccggg SEQ ID No. 50: CGGGTCTCAGGCAACAAAGCACCAGTGG SEQ ID No. 51: TAGGTCTCCAAACAAAAAAAAAAGCACCGACTCG (2) Construction of knockout vector Using the restriction endonuclease BsaI and T4 ligase, the tRNA-gRNA fragments of P1, P2, P3 and the vector pRGEB32-Cas9-gRNA (vector information can be found in the published article, Xie et al., Boosting CRISPR / Cas9 multiplex editing capability with the endogenous tRNA processing system. PNAS. 2015, 112(11): 3570-3575) were inserted into the BsaI site of the vector pRGEB32-Cas9-gRNA through a method of enzyme digestion and ligation simultaneously, thus obtaining the knockout vector. Ruv1 -Cas9 (e.g.) Figure 10 (As shown in A).
[0048] Example 7 Construction and Identification of Transgenic Rice Plants (1) Obtaining genetically modified rice overexpression vector Ruv1 -OE (from Example 3) and knockout vector Ruv1 -Cas9 (from Example 4) was sent to Weimi Biotechnology Co., Ltd. and transformed into the callus tissue of rice variety TP309 through Agrobacterium EHA105-mediated genetic transformation. After conventional pre-culture, infection culture, co-culture and screening culture, followed by differentiation culture, rooting culture, seedling hardening and transplanting to the field, transgenic plants were obtained.
[0049] (2) Identification of genetically modified rice for Ruv1 In this invention, the transgenic rice plants with overexpressed genes were extracted using the Trizol extraction kit manufactured by Invitrogen (the specific operating steps were performed according to the instructions provided with the kit). Ruv1 RNA overexpressing from the tillering leaves of transgenic plants was reverse transcribed using a reverse transcription kit manufactured by Takara (specific operating procedures were performed according to the kit's instructions). The resulting cDNA was used as a template for further processing. Ruv1 The gene was detected by qRT-PCR using the quantitative primers Ruv1-RT-F (SEQ ID No. 15) and Ruv1-RT-R (SEQ ID No. 16) and a quantitative kit (the specific operating steps were performed according to the instructions provided with the kit). Rice Ubiquitin As an internal reference gene, its quantitative primer sequences are shown in SEQ ID No. 11 and SEQ ID No. 12.
[0050] SEQ ID No. 44:ACTAGATGTGTCCCAAAATCGG; SEQ ID No. 45:GCTGAGATCAACATCCTGGAG; SEQ ID No. 11: GCCCAAGAAGAAGATCAAGAAC; SEQ ID No. 12: AGATAACAACGGAAGCATAAAAGTC.
[0051] The method described in Example 2 was used for transformation with Agrobacterium. SOBIR1The CRISPR-Cas9 editing vector and overexpression vector of the SOBIR1 gene were transformed into TP309 to obtain transgenic plants with SOBIR1 gene editing and overexpression. For the edited plants, genomic DNA was extracted using the CTAB method as a template, and primers SEQ ID No. 7 and SEQ ID No. 8 were used to... SOBIR1 Fragments near the edit site were amplified by PCR and sequenced by Sanger sequencing to confirm successful editing and identify the mutation mode. For overexpressing plants, DNA (CTAB method) and RNA (TRIzol method, extraction and reverse transcription methods as in Example 2) were extracted and subjected to hygromycin-labeled PCR identification and... SOBIR1 qPCR expression analysis of the gene was used to screen for positive plants with increased expression levels. SOBIR1 The quantitative primers for the gene are shown in SEQ ID No. 9 and SEQ ID No. 10. (Rice internal reference gene) Ubiquitin The quantitative primers are shown in SEQ ID No. 11 and SEQ ID No. 12. The methods for extracting plant genomic DNA using CTAB and for Agrobacterium-mediated transformation are existing, well-established technologies and will not be described in detail here.
[0052] SEQ ID No. 7: ACCAAGCCGAGCAAGTCTC SEQ ID No. 8:CGACCACGAACCCGATGAT SEQ ID No. 9: GGCGATGTCGGTGCTGTTCC SEQ ID No. 10: GCCAGTGCTCCTTGCTCTTG SEQ ID No. 11: GCCCAAGAAGAAGATCAAGAAC SEQ ID No. 12: AGATAACAACGGAAGCATAAAAGTC SEQ ID No. 13:
[0053] After identification, SOBIR1 Gene-edited strains sobir1 A 1 bp base (A) insertion was generated at the target site (e.g. Figure 1 As shown in Figure A), this leads to premature termination of frameshift and translation, resulting in the mutation. SOBIR1 The gene sequence is shown in SEQ ID No. 13. SOBIR1 overexpression positive strains SOBIR1-OX3 and SOBIR1-OX5 middle, SOBIR1 Gene expression levels were significantly higher than those of wild-type TP309 (e.g., Figure 1 (See B in the table below).
[0054] Table 1 SOBIR1 Gene expression level in overexpression lines
[0055] Example 8: Identification of rice false smut resistance in transgenic rice Rice blast resistance was identified using an artificial inoculation method. The inoculated strain was *Aspergillus oryzae* PJ52, isolated by our team from naturally occurring rice blast balls in the field. The inoculation concentration was 1 × 10⁻⁶. 6 cells / mL. Grown in the field. SOBIR1 On gene-edited and overexpression-promoted rice plants, select young panicles (enclosed in the sheath of the flag leaf) approximately one week after the inoculation point. Inject the inoculum into the leaf sheath using a syringe, stopping once the bacterial solution overflows. On the day of inoculation, erect a shade net above the inoculated rice plants to prevent excessive sunlight and temperature. Simultaneously, spray water for the first 7 days after inoculation to maintain suitable humidity conditions for disease development. After 7 days, remove the shade net and stop watering. Finally, 24 days after inoculation, harvest the entire panicle for diseased grain percentage analysis.
[0056] After vaccination and testing, it was found that SOBIR1 Gene-edited strains sobir1 The blast rate was significantly increased compared to wild-type TP309, exhibiting a more susceptible phenotype. Figure 2 ); while overexpression strains SOBIR1-OX3 and SOBIR1-OX5 The disease incidence rate was significantly lower in the wild type than in the wild type, and the disease condition was significantly improved. Figure 3 This series of results indicates SOBIR1 Genes positively regulate rice resistance to rice false smut.
[0057] Table 2 SOBIR1 Phenotypic characteristics of gene-edited strains after inoculation with Aspergillus oryzae
[0058] Table 3 SOBIR1 Phenotypic characteristics of gene overexpression lines after inoculation with Aspergillus oryzae
[0059] Example 9: Construction of a Ruv1 and SOBIR1 protein interaction system Genomic DNA from YH2115 was extracted using the CTAB method and used as a template. SEQ ID No. 14 and SEQ ID No. 15 were used as... Ruv1 Amplification primers, amplification Ruv1 The full-length gene sequence (SEQ ID No. 16) was obtained and recombined into the pCAMBIA1300 vector to construct the Ruv1-eYFP fusion protein expression vector. Simultaneously, genomic DNA of TP309 was extracted as a template, and SEQ ID No. 17 and SEQ ID No. 18 were used as... SOBIR1 Amplification primers, amplification SOBIR1 The full-length gene sequence (SEQ ID No. 1) was obtained and recombined into the pCAMBIA1300 vector to construct the SOBIR1-3HA fusion protein expression vector. The sequence accuracy of the overexpression vector was finally verified by E. coli transformation, colony PCR identification, plasmid extraction, and Sanger sequencing.
[0060] SEQ ID No. 14:TTTCATTTGGAGAGGACAGAGCTCATGCCCCTTTTTCATCAGATCC SEQ ID No. 15: CTCGCCCTTGCTCACCATGGTACCCTGCAAAGGCGTCCTATGGTCG SEQ ID No. 16: SEQ ID No. 17: GAGAACACGGGGGACGAGCTCATGGCGTTCGCGGCGAC SEQ ID No. 18: AACATCGTATGGGGTATTCGAAGTTCTTGATCTGGGAGAGCA The constructed vector was transformed into Agrobacterium GV3101 and validated by colony PCR before being used for subsequent tobacco leaf infection. The CTAB method for extracting plant genomic DNA is a well-established and mature technique, and will not be described in detail here.
[0061] Example 10: Immunoprecipitation experiment demonstrates the interaction between Ruv1 and SOBIR1 proteins. Ruv1-eYFP and SOBIR1-3HA were transiently expressed in *Nicotiana benthamiana* leaves using *Agrobacterium* infection. Leaves were harvested after 48 h, flash-frozen in liquid nitrogen, and ground into powder. The powder was lysed on ice for approximately 30 min using IP buffer (10 mmol / L HEPES, pH 7.5, 150 mmol / L KCl, 1 mmol / L EDTA, 0.5% Triton X-100, and a protease inhibitor cocktail). The mixture was centrifuged at 12000 rpm for 10 min, and the supernatant was transferred to a new EP tube. IP buffer was added again, and the above steps were repeated three times. 50 μl of the extract was collected as the input sample. GFP affinity gel beads (Lablead) were added to the remaining protein extract and incubated at 4 °C for 3 h. The beads were washed six times with IP buffer to obtain the IP sample. SDS-PAGE loading buffer was added to both the input and IP samples, and the samples were denatured in a 99 °C metal bath for 10 min. Finally, after SDS-PAGE gel electrophoresis and membrane transfer, Western blotting (WB) analysis was performed using anti-GFP antibody (Sangon Biotech) and anti-HA antibody (Sigma) to verify the interaction between Ruv1 and SOBIR1 proteins.
[0062] Experiments showed that the SOBIR1-3HA fusion protein could be co-precipitated with the Ruv1-eYFP fusion protein, confirming the interaction between Ruv1 and SOBIR1 proteins. Figure 4 ).
[0063] Example 11 Ruv1 and SOBIR1 Haplotype analysis Natural variation data from 4726 rice resource materials were downloaded from the RiceVarMap (http: / / ricevarmap.ncpgr.cn / ) rice variation database, and BCFTools software was used to extract the data. Ruv1 and SOBIR1 Variations within gene regions were identified and functionally annotated using SnpEff software. Subsequently, haplotype analysis was performed using the geneHapR package in R, and the variations were... Ruv1 and SOBIR1 Variations in the gene region are classified into different haplotypes. Simultaneously, variation data of major rice varieties were downloaded from the RiceAtlas database (https: / / www.cgris.net / RiceAtlas) to identify the haplotypes of contemporary mainstream varieties. Finally, analysis was performed. Ruv1 and SOBIR1 The study investigated haplotype combinations and identified the resistance of different combinations to rice false smut, exploring the synergistic effect of both in regulating rice resistance to false smut.
[0064] Analysis revealed that Ruv1 Natural variations in gene regions can be divided into five main haplotypes (such as...) Figure 5 As shown in Figure A), its sequence is shown in SEQ ID No. 19 ( Ruv1 Hap1 ), SEQ ID No. 16 ( Ruv1 Hap2 ), SEQ ID No. 20 ( Ruv1 Hap3 ), SEQ ID No. 21 ( Ruv1 Hap4 ), SEQ ID No. 22 ( Ruv1 Hap5 (Among them, indica rice mainly carries haplotypes) Ruv1 Hap1 , Ruv1 Hap2 and Ruv1 Hap3 Japonica rice mainly contains haplotypes. Ruv1 Hap4 and Ruv1 Hap5 (like Figure 5 (As shown in B) Among the major indica rice varieties cultivated in the 21st century, haploid types Ruv1 Hap2 The proportion is as high as 57.51% (e.g.) Figure 5 As shown in C), this is currently the most mainstream haplotype. SOBIR1 Natural variations in gene regions are mainly divided into six haplotypes (such as...) Figure 6As shown in Figure A), its sequence is shown in SEQ ID No. 23 ( SOBIR1 Hap1 ), SEQ ID No. 24 ( SOBIR1 Hap2 ), SEQ ID No. 25 ( SOBIR1 Hap3 ), SEQ ID No. 26 ( SOBIR1 Hap4 ), SEQ ID No. 1 ( SOBIR1 Hap5 ), SEQ ID No. 27 ( SOBIR1 Hap6 ); among which haplotype SOBIR1 Hap1 , SOBIR1 Hap2 , SOBIR1 Hap4 and SOBIR1 Hap6 It is mainly found in indica rice, while SOBIR1 Hap3 and SOBIR1 Hap5 It appears more often in japonica rice (such as...) Figure 6 (As shown in B).
[0065] SEQ ID No. 19: SEQ ID No. 20: SEQ ID No. 21: SEQ ID No. 22: SEQ ID No. 23: SEQ ID No. 24: SEQ ID No. 25: SEQ ID No. 26: SEQ ID No. 27: A collection of mainstream Ruv1 haplotype Ruv1 Hap2 The resources and varieties, carrying different SOBIR1 Rice false smut resistance was identified and phenotypic association analysis was performed on various haplotype combinations, revealing that those carrying the virus... Ruv1 Hap2 and SOBIR1 Hap5 Haplotype combinations of resource materials exhibit strong resistance to rice false smut (e.g., Figure 6 (See C in the table, and Table 4).
[0066] Table 4 Carry Ruv1 and SOBIR1 Phenotypic characteristics of resource materials with different haplotype combinations after inoculation with Aspergillus oryzae
[0067] Example 12 Construction Ruv1 Hap2 and SOBIR1 Hap5 Haplotype combinations of transgenic rice resistant to rice false smut Constructed using the same method as in Example 1 Ruv1 The gene-editing vector was transformed into TP309 (carrying gene editing vector). Ruv1 Hap5 and SOBIR1 Hap5 ), to knock out Ruv1 Hap5 The gene and target sequences are shown in SEQ ID No. 28 and SEQ ID No. 29 (dual target sites), and the primers are shown in SEQ ID No. 30 (target site 1), SEQ ID No. 31 (target site 1), SEQ ID No. 32 (target site 2), and SEQ ID No. 33 (target site 2). Genomic DNA was extracted from transgenic plants using the CTAB method as a template, and SEQ ID No. 34 and SEQ ID No. 35 were used as primers to... Ruv1 Fragments near the edit site were amplified by PCR and sequenced by Sanger sequencing to confirm successful editing and identify the mutation mode.
[0068] Furthermore, the CTAB method was used to extract YH2115 (carrying...) Ruv1 Hap2 Using genomic DNA as a template, and SEQ ID No. 36 and SEQ ID No. 37 as amplification primers, amplification was performed. Ruv1 The promoter and gene region sequence (SEQ ID No. 38) of the gene were obtained and recombined into the pCAMBIA1300 vector to construct... Ruv1 Hap2 Haplotype complementation vector. The sequence accuracy of the complementation vector was finally verified by *E. coli* transformation, colony PCR identification, plasmid extraction, and Sanger sequencing. Subsequently, *Agrobacterium* transformation was used to... Ruv1 Hap2 Transformation of complementary vectors into the aforementioned TP309 background Ruv1 Edited strains (carrying) SOBIR1 Hap5 ),get Ruv1 Hap2 and SOBIR1 Hap5 Transgenic rice plants of haplotype combinations. Positive plants were screened using hygromycin marker detection combined with qPCR expression analysis and subjected to rice false smut resistance identification (identification method same as in Example 4). Simultaneously, wild-type TP309 ( Ruv1 Hap5 , SOBIR1 Hap5 As a control, verify the haplotype combination. Ruv1 Hap2 and SOBIR1 Hap5 The contribution to rice false smut resistance. The methods for extracting plant genomic DNA using CTAB and the Agrobacterium-mediated transformation are existing, well-established technologies and will not be elaborated upon further.
[0069] In the context of TP309 Ruv1 The strains were edited for identification, and several successfully knocked-out strains were identified. One of these strains was selected. ruv1-5 As the recipient material for subsequent experiments, this strain produced a 1 bp deletion at target site 1 and a 22 bp deletion at target site 2, leading to frameshift mutations and premature translation termination. Ruv1 The gene region sequence is shown in SEQ ID No. 39. Transformed into this strain... Ruv1 Hap2 Subsequently, a total of stable positive results were obtained. Ruv1 Hap2 and SOBIR1 Hap5 Two haplotype transgenic lines were developed. Compared with the control TP309, the transgenic lines showed a significantly reduced rate of diseased grains, exhibiting significantly enhanced resistance to rice false smut (e.g., Figure 7 (and as shown in Table 5).
[0070] Table 5 Ruv1 Hap2 and SOBIR1 Hap5 Phenotypic characteristics of haplotype transgenic lines inoculated with Aspergillus oryzae
[0071] SEQ ID No. 28:AATTCTTGGACAGAGTGATA SEQ ID No. 29:AACCTGACAGGAAGTATAAG SEQ ID No. 30:AATTCTTGGACAGAGTGATAGTTTTAGAGCTAGAAAT SEQ ID No. 31:TATCACTCTGTCCAAGAATTCGGCAGCCAAGCCAGCA SEQ ID No. 32:AACCTGACAGGAAGTATAAGGTTTTAGAGCTAGAAAT SEQ ID No. 33:CTTATACTTCCTGTCAGGTTCGGCAGCCAAGCCAGCA SEQ ID No. 34:TACACTCGTCCTTGAGCCATGCC SEQ ID No. 35:TTCCAGCCTTGAACTGTCTAAGCC SEQ ID No. 36: GCTATGACCATGATTACGAATTCATTGCACAGTGTAGGAGACAACCC SEQ ID No. 37: ATTGAGAGCCCTGGCATGCCTGCACTACTGCAAAGGCGTCCTATGGT SEQ ID No. 38: SEQ ID No. 39: Example 13: Creation of Recombinant Inbred Lines Ruv1 Hap2 - SOBIR1 Hap5 Haplotype combinations of rice blast-resistant materials YZW2 ( Ruv1 Hap2 , SOBIR1 Hap4 ) is the parent, TP309 ( Ruv1 Hap5 , SOBIR1 Hap5 The female parent was used for hybridization to obtain the F1 generation, which was then self-pollinated to produce the F2 segregating population. Subsequently, single-seed transfer (i.e., harvesting seeds from a single panicle of each plant) was used, and five generations of continuous self-pollination were conducted starting from the F2 generation to finally construct the F6 recombinant inbred lines (RILs-F6), which were used for subsequent haplotype identification and rice false smut resistance evaluation. Haplotype identification of the two genes was performed using PCR amplification combined with Sanger sequencing. Ruv1 The amplification primer sequences for SOBIR1 are shown in SEQ ID No. 40 and SEQ ID No. 41, and the amplification primer sequences for SOBIR1 are shown in SEQ ID No. 42 and SEQ ID No. 43. The method for evaluating rice blast resistance is the same as in Example 4.
[0072] SEQ ID No. 40: TGCTGTGTTTCTTCAACAGCT SEQ ID No. 41: TGCAAAGGCGTCCTATGGTC SEQ ID No. 42: CGAGCAAGTCTCCCCTTCTC SEQ ID No. 43:GAGGACGAGGAGGATCTGCT Two samples carrying the virus were identified through haplotype identification. Ruv1 Hap2 - SOBIR1 Hap5 Stable, homozygous haplotype combinations F6-224 and F6-293. Rice false smut resistance evaluation showed that the diseased grain rate of both lines was significantly lower than that of their parents YH2115 and TP309, demonstrating significantly enhanced resistance to rice false smut (e.g., Figure 8 (and as shown in Table 6). The newly created disease-resistant materials are expected to be applied to actual rice production.
[0073] Table 6 Ruv1 Hap2 and SOBIR1 Hap5 Phenotypic characteristics of haplotype hybrid strains and their parents after inoculation with Aspergillus oryzae
[0074] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. Rice genes SOBIR1 In the application of regulating rice resistance to rice false smut, the rice gene... SOBIR1 It has the nucleotide sequence shown in SEQ ID No.
1.
2. The application as described in claim 1, characterized in that, Overexpression of the rice gene SOBIR1 This enhances the resistance of rice to rice false smut.
3. The application as described in claim 1, characterized in that, Knock out the rice gene SOBIR1 This reduces the resistance of rice to rice false smut.
4. Application of Ruv1 and SOBIR1 protein interaction in regulating rice resistance to rice false smut; Rice gene encoding Ruv1 protein Ruv1 It has the nucleotide sequence shown in SEQ ID No. 16; Rice gene encoding SOBIR1 protein SOBIR1 It has a nucleotide sequence as shown in SEQ ID No.
1.
5. The application as described in claim 4, characterized in that, Overexpression of the rice gene SOBIR1 and Ruv1 This enhances the resistance of rice to rice false smut.
6. Rice resistant to rice false smut, characterized by: Contains any of the following: (I) Overexpression of the exogenous inserted gene; the exogenous inserted gene is a rice gene. SOBIR1; (II) Overexpression of exogenous inserted genes; The exogenous inserted gene is a rice gene. SOBIR1 and Rice genes Ruv1 ; The rice gene SOBIR1 It has the nucleotide sequence shown in SEQ ID No. 1; The rice gene Ruv1 It has a nucleotide sequence as shown in SEQ ID No.
16.
7. Amplifying rice genes SOBIR1 The primer set is characterized by, It has the following characteristics: (I) The upstream primer has the nucleotide sequence shown in SEQ ID No. 17; and (II) The downstream primer has the nucleotide sequence shown in SEQ ID No.
18.
8. Amplifying rice genes SOBIR1 The reagent is characterized by, Includes the primer set as described in claim 7.
9. Amplifying rice genes SOBIR1 The reagent kit is characterized by, Includes the primer set as described in claim 7 or the reagent as described in claim 8.
10. A method for improving resistance to rice false smut, characterized in that, Improve rice's resistance to rice false smut by any of the following: (I) Overexpression of rice genes SOBIR1; or (II) Overexpression of rice genes SOBIR1 and rice genes Ruv1 ; The rice gene SOBIR1 It has the nucleotide sequence shown in SEQ ID No. 1; The rice gene Ruv1 It has a nucleotide sequence as shown in SEQ ID No.
16.
11. The method as described in claim 10, characterized in that, Rice genes SOBIR1 and Rice genes Ruv1 A vector was constructed and transferred into rice cells using Agrobacterium-mediated transformation to realize the rice gene. SOBIR1 and the rice gene Ruv1 Overexpression.
12. Detection of rice genes SOBIR1 and rice genes Ruv1 A primer set for expressing levels in rice, characterized by: It includes the rice gene. SOBIR1 Quantitative primer set and the rice gene Ruv1 Quantitative primer set; The rice gene SOBIR1 The quantitative primer set has the following characteristics: (I) The upstream primer has the nucleotide sequence shown in SEQ ID No. 9; and (II) The downstream primer has the nucleotide sequence shown in SEQ ID No. 10; The rice gene Ruv1 The quantitative primer set has the following characteristics: (I) The upstream primer has the nucleotide sequence shown in SEQ ID No. 44; and (II) The downstream primer has the nucleotide sequence shown in SEQ ID No.
45.
13. The primer set as described in claim 12, characterized in that, Also includes rice internal reference genes Ubiquitin Quantitative primer set; The rice internal reference gene Ubiquitin The quantitative primer set has the following characteristics: (I) The upstream primer has the nucleotide sequence shown in SEQ ID No. 11; and (II) The downstream primer has the nucleotide sequence shown in SEQ ID No.
12.
14. Detection of rice genes SOBIR1 and rice genes Ruv1 A reagent for expressing levels in rice, characterized in that, Includes the primer set as described in claim 12 or 13.
15. Detection of rice genes SOBIR1 and rice genes Ruv1 A kit for expressing levels in rice, characterized in that, Includes the primer set as described in claim 12 or 13 or the reagent as described in claim 14.
16. A method for identifying resistance to rice false smut, characterized in that, Using the genome of the rice sample to be tested as a template, the following tests were performed: (I) The primer set as described in claim 12 or 13; (II) The reagent as described in claim 14; and / or (III) The kit as described in claim 15; If the rice gene is relative to the wild type in the sample being tested... SOBIR1 Increased expression levels, or rice genes SOBIR1 and rice genes Ruv1 If co-expression occurs, the tested sample will have strong resistance to rice false smut; Conversely, the rice sample tested has weak resistance to rice false smut; The rice gene SOBIR1 It has the nucleotide sequence shown in SEQ ID No. 1; The rice gene Ruv1 It has the nucleotide sequence shown in SEQ ID No.
16.
17. A method for breeding rice resistant to rice false smut, characterized in that, Includes the following steps: Using the genome of the rice sample to be tested as a template, the following tests were performed: (I) The primer set as described in claim 12 or 13; (II) The reagent as described in claim 14; and / or (III) The kit as described in claim 15; If the rice gene is relative to the wild type in the sample being tested... SOBIR1 Increased expression levels, or rice genes SOBIR1 and rice genes Ruv1 If co-expression occurs, the sample to be tested will be retained for breeding. The rice gene SOBIR1 It has the nucleotide sequence shown in SEQ ID No. 1; The rice gene Ruv1 It has the nucleotide sequence shown in SEQ ID No.
16.
18. Ruv1 Hap2 and SOBIR1 Hap5 Application in enhancing resistance to rice false smut; The Ruv1 Hap2 It has the nucleotide sequence shown in SEQ ID No. 16; The SOBIR1 Hap5 It has a nucleotide sequence as shown in SEQ ID No.
1.
19. Rice resistant to rice false smut, characterized in that, for Ruv1 Hap2 and SOBIR1 Hap5 Haplotype combinations; The Ruv1 Hap2 It has the nucleotide sequence shown in SEQ ID No. 16; The SOBIR1 Hap5 It has a nucleotide sequence as shown in SEQ ID No. 1.