Rice blast resistance gene Ruv1 and its encoded protein and application

Abstract

The present application relates to the field of biological genetic engineering technology, in particular to a rice smut resistance gene Ruv1 and the encoded protein and application thereof. The present application clones a gene from rice Ruv1 , aiming to improve the rice resistance to smut through the research on the rice Ruv1 gene, and to provide new gene resources and technical means for rice disease resistance breeding. The present application provides the Ruv1 gene and the encoded protein, and researches the biological function of the gene and the application in the improvement of smut resistance, and knocking out the gene reduces the rice resistance to smut, and improving the expression of the gene significantly enhances the rice resistance to smut.

Description

Technical Field

[0001] This invention relates to the field of bioengineering technology, and in particular to a rice blast resistance gene. Ruv1 Its encoded proteins and applications. Background Technology

[0002] Ensuring global food production is increasingly challenged by emerging and recurring crop diseases, and the widespread cultivation of susceptible varieties further exacerbates this problem. Among these, the fungus *Strombus oryzae* (rice false smut), belonging to the Ascomycota phylum, is particularly problematic. Ustilaginoidea virens Rice blast disease, caused by fungal infections, is a prime example of a rapidly escalating agricultural crisis. Historically considered a minor and sporadic disease, it has evolved into a devastating threat in major rice-producing regions worldwide over the past few decades. In China alone, the disease has affected an average of 3.06 million hectares annually, with fungicides applied to control it covering an even larger area of ​​6.92 million hectares each year. Besides causing severe yield losses and declining rice quality, rice blast disease also poses a serious threat to human and animal health through fungal toxin contamination. For example, the pathogen produces a class of cyclic peptides called "ustiloxins," which are significantly toxic to mammalian viscera and also possess plant cytotoxicity. Worryingly, because these toxins are hydrophilic, they readily penetrate the environment and have even been detected in urine samples from populations in areas with high rates of rice blast disease.

[0003] Despite the escalating threat of rice false smut, molecular breeding efforts for resistance have been severely hampered by a lack of resistance genes and high-quality resistant materials. Although studies have identified multiple quantitative trait loci associated with rice false smut resistance using various genetic populations, no resistance genes from these loci have been successfully cloned to date. This bottleneck is primarily attributed to the highly complex genetic structure of rice false smut resistance and the susceptibility of phenotypic identification to interference from environmental conditions and the rice's growth stage.

[0004] In addition, existing rice breeding for resistance to rice false smut mainly focuses on enhancing resistance, but reverse research on reducing resistance should not be ignored. It is also of great value in setting up control experiments, regulating field ecology, and constructing low-resistance models. Summary of the Invention

[0005] In view of this, the present invention provides a rice blast resistance gene. Ruv1 And its encoded proteins and applications. Through the study of rice Ruv1 Gene research will improve rice resistance to rice false smut and provide new genetic resources and technical means for rice disease-resistant breeding.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0007] In a first aspect, the present invention provides rice genes. Ruv1In the application of regulating rice resistance to rice false smut, the rice gene... Ruv1 The coding region has a nucleotide sequence as shown in SEQ ID No. 3.

[0008] In some specific embodiments of the present invention, the rice gene is overexpressed. Ruv1 This enhances the resistance of rice to rice false smut.

[0009] In some specific embodiments of the present invention, knocking out the rice gene Ruv1 This reduces the resistance of rice to rice false smut.

[0010] In breeding research, reducing the resistance of rice to rice false smut has the following uses: (1) As a key control for resistance evaluation, low-resistance seeds are important susceptible control materials in large-scale comparative experiments of rice false smut resistance breeding. (2) Field ecological regulation: In field production, planting low insect (disease) resistant varieties in a planned small area can play the role of "inducing pathogens" or "pathogen shelter". (3) Build low disease resistance models for basic research. Through instantaneous transformation and other methods, low resistance materials to rice false smut can be quickly created and stable disease-susceptible models can be constructed.

[0011] In some specific embodiments of the present invention, the rice is rice TP309.

[0012] Secondly, the present invention also provides gene expression elements, including rice genes. Ruv1 The encoding area and containing Ruv1 Promoter of the 5'UTR of the gene; The rice gene Ruv1 The coding region has a nucleotide sequence as shown in SEQ ID No. 3; The inclusion Ruv1 The promoter of the 5'UTR of the gene has a nucleotide sequence as shown in SEQ ID No. 6.

[0013] Thirdly, the present invention also provides an overexpression vector comprising the aforementioned gene expression element.

[0014] Fourthly, the present invention also provides a host, characterized in that it contains the overexpression vector described above.

[0015] In some specific embodiments of the present invention, the host is a recombinant strain.

[0016] Fifthly, the present invention also provides the application of improving rice blast resistance by the following method; (I) The gene expression element described above; (II) the overexpression vector; and / or (III) The host mentioned above.

[0017] Sixthly, the present invention also provides rice resistant to rice false smut, comprising any of the following: (I) Overexpressed exogenous inserted genes; the exogenous inserted genes include rice genes. Ruv1; (II) Transfection of the gene expression element described herein; (III) the overexpression vector; and / or (IV) Transformation of the host described above; The rice contains the rice gene. Ruv1 The coding region has a nucleotide sequence as shown in SEQ ID No. 3.

[0018] In a seventh aspect, the present invention also provides an amplified rice receptor protein encoding gene. Ruv1 The primer set has the following characteristics: (I) The upstream primer has the nucleotide sequence shown in SEQ ID No. 1; and (II) The downstream primer has the nucleotide sequence shown in SEQ ID No.2.

[0019] Eighthly, the present invention also provides amplification of rice genes. Ruv1 The reagents include the primer set described above.

[0020] Ninthly, the present invention also provides amplification of rice genes. Ruv1 The kit includes the primer set or the reagents described herein.

[0021] In a tenth aspect, the present invention also provides a method for improving rice resistance to rice false smut, by overexpressing rice genes. Ruv1 To improve the resistance of rice to rice false smut; The rice gene Ruv1 The coding region has a nucleotide sequence as shown in SEQ ID No. 3.

[0022] In some specific embodiments of the present invention, the rice in the method is rice TP309.

[0023] In some specific embodiments of the present invention, the method includes: transferring the overexpression vector into rice cells using Agrobacterium EHA105-mediated genetic transformation to realize the rice gene. Ruv1 Overexpression.

[0024] Eleventhly, the present invention also provides a method for detecting rice genes. Ruv1The primer set for expressing levels in rice includes Ruv1 Quantitative primer set; The Ruv1 The quantitative primer set has the following characteristics: (I) The upstream primer has the nucleotide sequence shown in SEQ ID No. 15; and (II) The downstream primer has the nucleotide sequence shown in SEQ ID No. 16.

[0025] In some specific embodiments of the present invention, the primer set further includes a rice internal reference gene. Ubiquitin Quantitative primer set; The rice internal reference gene Ubiquitin The quantitative primer set has the following characteristics: (I) The upstream primer has the nucleotide sequence shown in SEQ ID No. 17; and (II) The downstream primer has the nucleotide sequence shown in SEQ ID No. 18.

[0026] In a twelfth aspect, the present invention also provides a method for detecting rice genes. Ruv1 Reagents for expressing levels in rice, including the primer set described above.

[0027] In a thirteenth aspect, the present invention also provides a method for detecting rice genes. Ruv1 A kit for expressing levels in rice, comprising the primer set or the reagents described herein.

[0028] In a fourteenth aspect, the present invention also provides a method for identifying resistance to rice false smut, using genomic DNA of a rice sample as a template and performing qRT-PCR according to any of the following: (I) The primer set described above; (II) The reagents described above; and / or (III) The aforementioned reagent kit; If the expression level of the test sample is significantly or extremely significantly increased compared to the wild type, then the test sample has strong resistance to rice false smut. If the expression level of the test sample does not increase significantly compared to the wild type, then the test sample has weak resistance to rice false smut.

[0029] In a fifteenth aspect, the present invention also provides a method for breeding rice resistant to rice false smut, comprising the following steps: Using genomic DNA from rice samples as a template, qRT-PCR was performed via any of the following methods; (I) The primer set described above; (II) The reagents described above; and / or (III) The aforementioned reagent kit; If the expression level of the test sample increases significantly or extremely significantly compared to the wild type, the test sample is retained for breeding.

[0030] This invention isolates and clones a [type of organism] from rice. Ruv1 Genes, designed to improve rice Ruv1 Gene research aims to improve rice resistance to rice false smut, providing new genetic resources and technical means for disease-resistant rice breeding. This invention provides... Ruv1 The gene and its encoded protein were investigated, along with the biological function of the gene and its application in improving rice false smut resistance. Knocking out the gene reduced rice resistance to rice false smut, while increasing the expression of the gene significantly enhanced rice resistance to rice false smut. Attached Figure Description

[0031] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.

[0032] Figure 1 The expression vector constructed in this invention Ruv1 -Diagram of OE construction; Figure 1 Figure A in the diagram: Insertion of expression vector Ruv1 -OE contains the highly expressed promoter Ruv1Pro R2115 and Ruv1 Schematic diagram of DNA fragments in the gene region; RB and LB represent the right and left boundaries of T-DNA, respectively; HygR represents the hygromycin phosphotransferase gene; Ruv1Pro R2115 Indicates that rice variety Ya Hui 2115 is in Ruv1 The promoter of the gene, CaMV35S represents the promoter of cauliflower mosaic virus, NOS represents the polyadenylation signal sequence terminator, and EcoRI and SalI are restriction endonucleases. Figure 1 Figure B in the diagram: Expression vector in the background of rice TP309. Ruv1 -OE obtained from genetically modified rice Ruv1 Gene expression level detection; Figure 2 CRISPR knockout vector Ruv1 - Cas9 construction diagram; Figure 2 Figure A in the text: Ruv1 - Vector map of Cas9; U3 represents an RNA polymerase III promoter, Ubi represents a ubiquitin gene promoter, and Cas9 represents a CRISPR-related endonuclease gene; Figure 2 Figure B in the text: Ruv1 Design sites for CRISPR target TS1 and TS2 gRNAs and Ruv1 The number and location of deoxyribonucleotides missing in gene knockout rice lines compared to wild type; Figure 3 : Ruv1 -OE and Ruv1 - Analysis of the resistance of T2 generation transgenic plants of Cas9 to rice false smut; Figure 3 Image A in the image: Background of rice TP309 Ruv1 Phenotypes of gene-overexpressing lines 3 and 6 after inoculation with rice false smut; Figure 3 Figure B in the text: Ruv1 The number of rice false smut per panicle after inoculation of rice false smut fungus in gene-overexpressing lines 3 and 6; compared with wild-type TP309. Ruv1 The number of rice false smut per panicle was significantly reduced after transgenic rice with overexpressed genes was inoculated with rice false smut fungus. Figure 3 Figure C in the middle: Ruv1 The biomass of rice false smut fungus after inoculation of gene-overexpressing lines 3 and 6; compared with wild-type TP309, Ruv1 Transgenic rice with overexpressed genes showed a significant reduction in the biomass of rice false smut after inoculation with rice false smut. Figure 3 Image D in the image: Background of rice TP309 Ruv1 Phenotypes of gene knockout lines 5 and 9 after inoculation with rice false smut; Figure 3 E diagram in the middle: Ruv1 The number of rice false smut per panicle after inoculation of gene knockout lines 5 and 9 with rice false smut; compared with wild-type TP309. Ruv1 Gene knockout transgenic rice showed a significant increase in the number of rice false smut per panicle after inoculation with rice false smut fungus; Figure 3 F-graph in the middle: Ruv1 The biomass of rice false smut fungus after inoculation of gene knockout lines 5 and 9; compared with wild-type TP309, Ruv1 Gene knockout transgenic rice showed a significant increase in the biomass of rice false smut after inoculation with rice false smut. Detailed Implementation

[0033] This invention discloses a rice blast resistance gene. Ruv1 The encoded proteins and applications of this invention can be referenced by those skilled in the art, who can appropriately modify the process parameters to achieve the desired results. It is particularly important to note that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments, and those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0034] In rice Ruv1The gene encodes a receptor-like protein, and its gene number in the Japanese Haru reference genome is Os03g0400800.

[0035] Unless otherwise specified, the methods or reagents used in the following examples are conventional methods or reagents in the art. For specific steps, please refer to, for example, "Molecular Cloning: A Laboratory Manual" (Sambrook, J., Russell, David W., Molecular Cloning: A Laboratory Manual, 3rd edition, 2001, NY, Cold Spring Harbor) or related products (the implementation of this invention is not limited thereto).

[0036] The present invention will be further illustrated below with reference to the embodiments: Example 1: Isolation of Clones Ruv1 DNA fragments of the complete coding region of a gene Genomic DNA was extracted from leaves of rice variety Taipei 309 (TP309) using the CTAB method as a template. SEQ ID No. 1 and SEQ ID No. 2 were used as amplification primers to clone [a specific DNA sequence]. Ruv1 DNA sequence of the complete coding region (SEQ ID No. 3).

[0037] SEQ ID No. 1: TACACTCGTCCTTGAGCCATGCCCCTTTTTCATCAGATCC SEQ ID No. 2: AACGAAAGCTCTGCAGGTCGACCTACTGCAAAGGCGTCCTATGGTCG SEQ ID No. 3: Example 2 Separation Ruv1 DNA fragments of gene-high expression promoters Genomic DNA was extracted from leaves of rice variety YH2115 using the CTAB method and used as a template. Sequence ID 4 and Sequence ID 5 were used as amplification primers, and PCR was used to isolate and clone samples containing... Ruv1 The promoter DNA sequence of the 5'UTR of the gene (SEQ ID No. 6).

[0038] SEQ ID No. 4: GCTATGACCATGATTACGAATTCATTGCACAGTGTAGGAGACAACCC SEQ ID No. 5: GGATCTGATGAAAAAGGGGCATGGCTCAAGGACGAGTGTA SEQ ID No. 6: Example 3 Construction Ruv1 Gene overexpression vector The vector pCAMBIA1300 was digested with EcoRI and SalI, and then ligated together with the PCR products obtained in Examples 1 and 2 using a multi-fragment recombinase (C113, Nanjing Novizan Biotechnology Co., Ltd.). The ligation product was transformed into competent *E. coli* Tran-DH5α cells (purchased from Beijing TransGen Biotech Co., Ltd.) by heat-activated transformation, and then incubated in 600 μL of LB medium for 45-60 min. The cells were then plated on LA medium containing 50 mg / L kanamycin and incubated at 37°C for 16-20 h (LB and LA formulations referenced from: MR. Green, J. Sambrook, *Molecular Cloning: A Laboratory Manual*, 4th Edition, Science Press, Beijing, 2017-03). After bacterial growth, single clones were picked and identified by PCR. Positive clones were transferred to test tubes for amplification and plasmid extraction. The resulting expression vector was named. Ruv1 -OE (e.g.) Figure 1 (As shown in A).

[0039] Example 4 Construction Ruv1 CRISPR-Cas9 gene editing vector For rice Ruv1 Gene design based on target sequences of the CRISPR / Cas9 system, located in Ruv1 The two target sequences are located near the 5' end of the exon of the gene, as shown in SEQ ID No. 7 and SEQ ID No. 8, respectively (e.g. Figure 2 (As shown in B). Based on the sequences of sgRNA TS1 and TS2, the following primers were designed (the primer design method can be found in the published article, Xie et al., Boosting CRISPR / Cas9 multiplex editing capability with the endogenous tRNA processing system. PNAS. 2015, 112(11): 3570-3575.): TS1-F (SEQ ID No. 9), TS1-R (SEQ ID No. 10), TS2-F (SEQ ID No. 11), and TS2-R (SEQ ID No. 12).

[0040] (1) Construction of tRNA-gRNA fragments Using plasmid pGTR (containing a gRNA-tRNA fusion fragment, which enables efficient expression and processing of multiple gRNAs using an endogenous tRNA processing system) as a template, fragment P1 was amplified using primers S5AD5-F (SEQ ID No. 13) and TS1-R (SEQ ID No. 10), fragment P2 was amplified using primers TS1-F (SEQ ID No. 9) and TS2-R (SEQ ID No. 12), and fragment P3 was amplified using primers TS2-F (SEQ ID No. 11) and S3AD5-R (SEQ ID No. 14).

[0041] SEQ ID No. 7: AATTCTTGGACAGAGTGATA SEQ ID No. 8: AACCTGACAGGAAGTATAAG SEQ ID No. 9: taGGTCTCGACAGAGTGATAgttttagagctagaa SEQ ID No. 10: cgGGTCTCTGTCCAAGAATTtgcaccagccggg SEQ ID No. 11: taGGTCTCAGGAAGTATAAGgttttagagctagaa SEQ ID No. 12: cgGGTCTCTCCTGTCAGGTTtgcaccagccggg SEQ ID No. 13: CGGGTCTCAGGCAACAAAGCACCAGTGG SEQ ID No. 14: TAGGTCTCCAAACAAAAAAAAAAGCACCGACTCG (2) Construction of knockout vector Using the restriction endonuclease BsaI and T4 ligase, the tRNA-gRNA fragments of P1, P2, P3 and the vector pRGEB32-Cas9-gRNA (vector information can be found in the published article, Xie et al., Boosting CRISPR / Cas9 multiplex editing capability with the endogenous tRNA processing system. PNAS. 2015, 112(11): 3570-3575) were inserted into the BsaI site of the vector pRGEB32-Cas9-gRNA through a method of enzyme digestion and ligation simultaneously, thus obtaining the knockout vector. Ruv1 -Cas9 (e.g.) Figure 2 (As shown in A).

[0042] Example 5: Construction and Identification of Transgenic Rice Plants (1) Obtaining genetically modified rice overexpression vector Ruv1 -OE (from Example 3) and knockout vector Ruv1 -Cas9 (from Example 4) was sent to Weimi Biotechnology Co., Ltd. and transformed into the callus tissue of rice variety TP309 through Agrobacterium EHA105-mediated genetic transformation. After conventional pre-culture, infection culture, co-culture and screening culture, followed by differentiation culture, rooting culture, seedling hardening and transplanting to the field, transgenic plants were obtained.

[0043] (2) Identification of genetically modified rice for Ruv1 In this invention, the transgenic rice plants with overexpressed genes were extracted using the Trizol extraction kit manufactured by Invitrogen (the specific operating steps were performed according to the instructions provided with the kit). Ruv1 RNA overexpressing from the tillering leaves of transgenic plants was reverse transcribed using a reverse transcription kit manufactured by Takara (specific operating procedures were performed according to the kit's instructions). The resulting cDNA was used as a template for further processing. Ruv1 The gene was detected by qRT-PCR using the quantitative primers Ruv1-RT-F (SEQ ID No. 15) and Ruv1-RT-R (SEQ ID No. 16) and a quantitative kit (the specific operating steps were performed according to the instructions provided with the kit). Rice Ubiquitin As an internal reference gene, its quantitative primer sequences are shown in SEQ ID No. 17 and SEQ ID No. 18.

[0044] SEQ ID No. 15:ACTAGATGTGTCCCAAAATCGG SEQ ID No. 16:GCTGAGATCAACATCCTGGAG SEQ ID No. 17: GCCCAAGAAGAAGATCAAGAAC SEQ ID No. 18: AGATAACAACGGAAGCATAAAAGTC RT-PCR results showed that multiple Ruv1 -OE transgenic positive plants showed a significantly increased expression level compared to wild-type TP309 (e.g. Figure 1 (See B in the table below).

[0045] Table 1. Expression vectors in the rice TP309 background Ruv1 -OE obtained from genetically modified rice Ruv1 Gene expression level

[0046] against Ruv1 This invention relates to gene knockout transgenic plants. Primers were designed using the upstream and downstream sequences of target sites TS1 and TS2 in the TP309 genomic DNA sequence. Genomic DNA was extracted from the transgenic plants, and PCR amplification was performed using primers Ruv1-KO-F (SEQ ID No. 19) and Ruv1-KO-R (SEQ ID No. 20). The amplified fragments were sequenced, and the sequencing peak diagram was used to determine whether base deletions or insertions occurred at target sites TS1 and TS2, as well as the DNA region between them. This invention successfully obtained... Ruv1 Genetically modified plants with gene mutations ruv1-5 and ruv1-9 (like Figure 2 (As shown in B).

[0047] SEQ ID No. 19: ATGCCCCTTTTTCATCAGATCC SEQ ID No. 20:TGAAGAGATGCTCCCAGCG Example 6: Identification of rice false smut resistance in transgenic rice Will Ruv1 Independent T2 generation strains overexpressed Ruv1 -OE-3 and Ruv1 -OE-6、 Ruv1 Knockout independent T2 generation strain ruv1-5 and ruv1-9 After conventional soaking and germination, the seeds are sown in the seedbed and transplanted to the field 30 days later, with a planting density (row spacing) of 16.5 meters. The rice seedlings were 26.5 cm tall and planted in the experimental field of Sichuan Agricultural University in Wenjiang District, Chengdu, Sichuan Province, China. Field management was carried out using conventional rice cultivation methods under safe and protective conditions. One week before the rice heading and heading stage, [the following was observed / implanted / etc.]. Ruv1 Gene overexpression lines Ruv1 -OE-3 and Ruv1 -OE-6, Knockout strain ruv1-5 and ruv1-9 Inoculation experiments were conducted on rice blast fungus and wild-type TP309. Results showed that... Ruv1 Gene overexpression lines Ruv1 -OE-3 and Ruv1 -OE-6 after inoculation with rice false smut fungus during the booting stage Ruv1 Gene overexpression lines Ruv1-OE-3 and Ruv1-OE-6 Number of rice grains per panicle (e.g.) Figure 3 The values ​​of A, B, and those shown in Table 2 were significantly lower than those of the wild type, while... Ruv1 Gene knockout lines ruv1-5 and ruv1-9 Number of rice grains per panicle (e.g.) Figure 3 The values ​​of D, E, and those shown in Table 3 were significantly higher than those of the wild type. These results indicate that... Ruv1 Genes that positively regulate rice resistance to rice false smut.

[0048] Table 2 Ruv1 Number of rice false smut per panicle and relative biomass of rice false smut after inoculation of gene-overexpressing lines with rice false smut

[0049] Table 3 Ruv1 Number of rice false smut per panicle and relative biomass of rice false smut after inoculation of gene knockout lines with rice false smut

[0050] Example 7: Biomass analysis of rice spikelets infected with rice false smut. For rice material TP309, Ruv1 Rice lines with overexpressed and knockout genes were inoculated with *Strombus oryzae* during the booting stage. Six days after inoculation, young panicles were harvested, and florets were removed to extract DNA as a template. The relative DNA level of *Strombus oryzae* was analyzed using qPCR to assess its relative biomass (housekeeping gene of *Strombus oryzae*). UvTub2α Primers are listed in SEQ ID No. 21 and SEQ ID No. 22; Rice housekeeping gene Ubiquitin Primers are listed in SEQ ID No. 17 and SEQ ID No. 18.

[0051] SEQ ID No. 21:ACCAGCTCGTTGAGAACTCG SEQ ID No. 22:AATCAGAGTTGAGCTGGCCG The results showed that after inoculation with rice false smut, Ruv1 overexpression lines of genes Ruv1 -OE-3 and Ruv1 The relative biomass of *Streptococcus oryzae* in the spikelets of OE-6 was significantly lower than that in wild-type TP309 (e.g., ...). Figure 3 (as shown in C); and Ruv1 Gene knockout lines ruv1-5 and ruv1-9 The relative biomass of rice false smut fungus in the wild-type TP309 was significantly higher than that in the wild-type TP309 (e.g. Figure 3 (As shown in Figure F). The above results indicate that... Ruv1 The gene can significantly inhibit the infection and proliferation of rice false smut in rice spikelets.

[0052] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Rice genes Ruv1 In the application of regulating rice resistance to rice false smut, the rice gene... Ruv1 The coding region has a nucleotide sequence as shown in SEQ ID No.

3.

2. The application as described in claim 1, characterized in that, Overexpression of the rice gene Ruv1 This enhances the resistance of rice to rice false smut.

3. The application as described in claim 1, characterized in that, Knock out the rice gene Ruv1 This reduces the resistance of rice to rice false smut.

4. The application as described in any one of claims 1-3, characterized in that, The rice variety in question is TP309.

5. A gene expression element, characterized in that, Including rice genes Ruv1 The encoding area and containing Ruv1 The promoter of the 5'UTR of the rice gene Ruv1 The coding region has a nucleotide sequence as shown in SEQ ID No. 3, wherein the comprising Ruv1 The promoter of the 5'UTR of the gene has a nucleotide sequence as shown in SEQ ID No.

6.

6. An overexpression vector, characterized in that, It contains the gene expression element as described in claim 5.

7. The host, characterized in that, It contains the overexpression vector as described in claim 6.

8. The host as described in claim 7, characterized in that, The host is a recombinant strain.

9. The following methods were used to obtain the application in improving rice false smut resistance; (I) The gene expression element as described in claim 5; (II) The overexpression vector as described in claim 6; and / or (III) The host as described in claim 7 or 8.

10. Rice resistant to rice false smut, characterized in that, Contains any of the following: (I) Overexpressed exogenous inserted genes; the exogenous inserted genes include rice genes. Ruv1; (II) Transfection with the gene expression element as described in claim 5; (III) The overexpression vector as described in claim 6; and / or (IV) Transformation of the host as described in claim 7 or 8; The rice gene Ruv1 The coding region has a nucleotide sequence as shown in SEQ ID No.

3.

11. Amplification of the rice receptor protein encoding gene Ruv1 The primer set is characterized by, It has the following characteristics: (I) The upstream primer has the nucleotide sequence shown in SEQ ID No. 1; and (II) The downstream primer has the nucleotide sequence shown in SEQ ID No.

2.

12. Amplification of rice genes Ruv1 The reagent is characterized by, Includes the primer set as described in claim 11.

13. Amplifying rice genes Ruv1 The reagent kit is characterized by, Includes the primer set as described in claim 11 or the reagent as described in claim 12.

14. A method for improving resistance to rice false smut, characterized in that, By overexpressing rice genes Ruv1 To improve the resistance of rice to rice false smut; the rice gene Ruv1 The coding region has a nucleotide sequence as shown in SEQ ID No.

3.

15. The method as described in claim 14, characterized in that, The rice variety in question is TP309.

16. The method as described in claim 14 or 15, characterized in that, The overexpression vector as described in claim 6 was transferred into rice using Agrobacterium EHA105-mediated genetic transformation to realize the rice gene. Ruv1 Overexpression.

17. Detection of rice genes Ruv1 A primer set for expressing levels in rice, characterized by: It includes Ruv1 Quantitative primer set; The Ruv1 The quantitative primer set has the following characteristics: (I) The upstream primer has the nucleotide sequence shown in SEQ ID No. 15; and (II) The downstream primer has the nucleotide sequence shown in SEQ ID No.

16.

18. The primer set as claimed in claim 17, characterized in that, It also includes rice internal reference genes. Ubiquitin Quantitative primer set; The rice internal reference gene Ubiquitin The quantitative primer set has the following characteristics: (I) The upstream primer has the nucleotide sequence shown in SEQ ID No. 17; and (II) The downstream primer has the nucleotide sequence shown in SEQ ID No.

18.

19. Detection of rice genes Ruv1 A reagent for expressing levels in rice, characterized in that, Includes the primer set as described in claim 17 or 18.

20. Detection of rice genes Ruv1 A kit for expressing levels in rice, characterized in that, Includes the primer set as described in claim 17 or 18 or the reagent as described in claim 19.

21. A method for identifying resistance to rice false smut, characterized in that, Using genomic DNA from rice samples as a template, qRT-PCR was performed via any of the following methods; (I) The primer set as described in claim 17 or 18; (II) The reagent as described in claim 19; and / or (III) The kit as described in claim 20; If the expression level of the test sample is significantly or extremely significantly increased compared to the wild type, then the test sample has strong resistance to rice false smut. If the expression level of the test sample does not increase significantly compared to the wild type, then the test sample has weak resistance to rice false smut.

22. A method for breeding rice resistant to rice false smut, characterized in that, Includes the following steps: Using genomic DNA from rice samples as a template, qRT-PCR was performed via any of the following methods; (I) The primer set as described in claim 17 or 18; (II) The reagent as described in claim 19; and / or (III) The kit as described in claim 20; If the expression level of the test sample increases significantly or extremely significantly compared to the wild type, the test sample is retained for breeding.

Images