Use of td2 gene or its encoded protein in improving the resistance of plants to bacterial wilt

Abstract

The application belongs to the technical field of biology and particularly relates to TD2 application of a gene or a coded protein thereof in improving plant resistance to bacterial wilt. TD2 The application discloses, for the first time, functions of a gene or a coded protein thereof in regulating plant resistance to bacterial wilt, and the functions of the gene are lost by CRISPR / Cas9 gene editing technology. TD2 The functions of the gene can significantly reduce the resistance of plants to bacterial wilt, and overexpression of the gene can significantly enhance the disease resistance. TD2 Experiments prove that the gene or the coded protein thereof positively regulates and enhances the immune response of plants through hydrogen peroxide accumulation, and provide a clear molecular target and theoretical basis for cultivating new varieties of plants resistant to bacterial wilt by using the gene. The application provides a new gene resource and a breeding idea for plant disease-resistant molecular breeding, especially genetic improvement for bacterial diseases such as bacterial wilt.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically involving TD2 Application of genes or their encoded proteins in improving plant resistance to bacterial wilt. Background Technology

[0002] tomato( Solanum lycopersicum Ralstonia solanacearum is an important and widely cultivated economic crop. However, during its cultivation, it is susceptible to damage from Ralstonia solanacearum (Ralstonia solanacearum). Ralstonia solanacearum Bacterial wilt, caused by [unspecified disease], is a devastating soil-borne disease that often leads to rapid wilting and even death of plants, resulting in severe yield reduction. Currently, the control of bacterial wilt mainly relies on chemical pesticides, but long-term use not only pollutes the environment but also easily induces drug resistance in the pathogen. While developing disease-resistant varieties through traditional hybridization breeding methods is a fundamental approach, its long cycle, low efficiency, and the relative scarcity of highly effective bacterial wilt-resistant gene resources in tomatoes greatly limit the breeding process.

[0003] Threonine dehydrogenase (TD2) is a key enzyme catalyzing the degradation of threonine. Recent studies have found that... TD2 In plant-pathogen interactions, they may play complex roles beyond their metabolic functions. For example, some literature reports that... TD2 Knock down the plant's resistance to hemizomycetes Pseudomonas syringae Its resistance is improved, but it is still susceptible to necrotrophic fungi. Botrytis cinerea The resistance of tomatoes decreases. However, in tomatoes... TD2 The function of the gene in bacterial wilt resistance has not been reported. Summary of the Invention

[0004] The purpose of this invention is to discover and verify genes that regulate resistance to bacterial wilt, elucidate their mechanisms of action, improve plant resistance to bacterial wilt, screen plants resistant to bacterial wilt, and provide a new approach for breeding disease-resistant plant varieties.

[0005] This invention provides TD2 The application of genes or their encoded proteins in improving plant resistance to bacterial wilt, the TD2 The amino acid sequence of the protein encoded by the gene is selected from any of the following: (1) the amino acid sequence shown in SEQ ID NO:2; (2) an amino acid sequence that has more than 70% homology with the amino acid sequence shown in SEQ ID NO:2 and has the same function.

[0006] This invention provides TD2 The application of genes or their encoded proteins in screening or breeding plants resistant to bacterial wilt, the aforementioned TD2The amino acid sequence of the protein encoded by the gene is selected from any of the following: (1) the amino acid sequence shown in SEQ ID NO:2; (2) an amino acid sequence that has more than 70% homology with the amino acid sequence shown in SEQ ID NO:2 and has the same function.

[0007] Preferably, the TD2 The nucleotide sequence of the gene is selected from any of the following: (1) the nucleotide sequence shown in SEQ ID NO:1; (2) the nucleotide sequence that has more than 70% homology with the nucleotide sequence shown in SEQ ID NO:1 and encodes a protein with the same function.

[0008] Preferably, the plant includes tomato.

[0009] Preferably, the pathogen causing bacterial wilt includes Ralstonia solanacearum.

[0010] This invention provides a method for improving plant resistance to bacterial wilt or cultivating plants resistant to bacterial wilt, comprising: overexpressing in a plant receptor TD2 The gene or its encoded protein, said TD2 The amino acid sequence of the protein encoded by the gene is selected from any of the following: (1) the amino acid sequence shown in SEQ ID NO:2; (2) an amino acid sequence that has more than 70% homology with the amino acid sequence shown in SEQ ID NO:2 and has the same function.

[0011] Preferably, the plant receptor includes a cotyledonary explant.

[0012] This invention provides a method for screening plants resistant to bacterial wilt, comprising: detecting in the test plant... TD2 The expression level of a gene or its encoded protein, if the plant being tested... TD2 If the expression level of a gene or its encoded protein is significantly higher than that of wild-type plants, then the plant under test is a plant resistant to bacterial wilt. If the plant to be tested TD2 The expression level of the gene or its encoded protein is significantly lower than that of the wild-type plant, or the plant being tested... TD2 If the gene or its encoded protein is missing, the plant being tested is susceptible to bacterial wilt. The TD2 The amino acid sequence of the protein encoded by the gene is selected from any of the following: (1) the amino acid sequence shown in SEQ ID NO:2; (2) an amino acid sequence that has more than 70% homology with the amino acid sequence shown in SEQ ID NO:2 and has the same function.

[0013] This invention provides a plant material resistant to bacterial wilt, wherein the plant material expresses exogenous expression TD2The gene or its encoded protein, said TD2 The amino acid sequence of the protein encoded by the gene is selected from any of the following: (1) the amino acid sequence shown in SEQ ID NO:2; (2) an amino acid sequence that has more than 70% homology with the amino acid sequence shown in SEQ ID NO:2 and has the same function.

[0014] Preferably, the plant material includes one or more of plant cells, plant tissues, and plant explants.

[0015] Beneficial effects: This invention utilizes CRISPR / Cas9 gene editing technology. TD2 Compared to the wild type, the loss-of-function mutant showed significantly higher disease index and colony count after inoculation, while overexpression of the gene significantly enhanced disease resistance. TD2 Genes positively regulate plant resistance to bacterial wilt. Specifically, the aforementioned... TD2 The gene participates in the resistance response to bacterial wilt by regulating the accumulation of hydrogen peroxide (H2O2) in plants. After inoculation treatment, overexpression... TD2 The hydrogen peroxide content of the plant was significantly higher than that of the wild type, while td2 The hydrogen peroxide content in the mutant was lower than that in AC, indicating that TD2 The gene positively regulates the hydrogen peroxide burst during pathogen infection. This invention provides new gene resources and breeding strategies for molecular breeding of plant disease resistance, especially for genetic improvement against bacterial diseases such as bacterial wilt. Attached Figure Description

[0016] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0017] Figure 1 In the leaves of the tomato control group and the group inoculated with bacterial wilt pathogen TD2 Gene expression levels; Figure 2 The roots of the tomato control group and the group inoculated with bacterial wilt pathogen TD2 Gene expression levels; Figure 3 The stems of the tomato control group and the group inoculated with bacterial wilt were found to be contaminated with the fungus TD2 Gene expression levels; Figure 4 For tomatoes td2 A schematic diagram of gene editing site sequence alignment in mutant plants; Figure 5 For tomatoes TD2 Western blot analysis results of proteins from gene-overexpressing plants; Figure 6 For tomatoes td2 mutant plants and tomatoes TD2 Phenotype of plants with overexpressing genes 6 days after inoculation with bacterial wilt pathogen; Figure 7 For tomatoes td2 mutant plants and tomatoes TD2 Disease index of gene-overexpressing plants 6 days after inoculation with bacterial wilt pathogen; Figure 8 For tomatoes td2 mutant plants and tomatoes TD2 Statistical graph of Ralstonia solanacearum colony-forming units on the stems of overexpressing plants after inoculation with Ralstonia solanacearum; Figure 9 For tomatoes td2 mutant plants and tomatoes TD2 Staining diagram of hydrogen peroxide content in leaves of gene-overexpressing plants after inoculation with bacterial wilt pathogen; Figure 10 For tomatoes td2 mutant plants and tomatoes TD2 Staining image of hydrogen peroxide content in the stem of a gene-overexpressing plant after inoculation with bacterial wilt pathogen; Lowercase letters a and b represent the differences between different plants in the t-test. P The difference was significant at the <0.05 level. Detailed Implementation

[0018] This invention provides TD2 The application of genes or their encoded proteins in improving plant resistance to bacterial wilt, the TD2 The amino acid sequence of the protein encoded by the gene is selected from any of the following: (1) the amino acid sequence shown in SEQ ID NO:2; (2) an amino acid sequence that has more than 70% homology with the amino acid sequence shown in SEQ ID NO:2 and has the same function.

[0019] This invention provides TD2 The application of genes or their encoded proteins in screening or breeding plants resistant to bacterial wilt, the aforementioned TD2 The amino acid sequence of the protein encoded by the gene is selected from any of the following: (1) the amino acid sequence shown in SEQ ID NO:2; (2) an amino acid sequence that has more than 70% homology with the amino acid sequence shown in SEQ ID NO:2 and has the same function.

[0020] As one implementation method, the present invention described TD2 The nucleotide sequence of the gene is selected from any of the following: (1) the nucleotide sequence shown in SEQ ID NO:1; (2) the nucleotide sequence that has more than 70% homology with the nucleotide sequence shown in SEQ ID NO:1 and encodes a protein with the same function.

[0021]

[0022] SEQ ID NO:2:

[0023] In one embodiment, the plant described in this invention includes tomato. In another embodiment, the pathogen causing bacterial wilt in this invention includes *Ralstonia solanacearum*.

[0024] This invention provides a method for improving plant resistance to bacterial wilt or cultivating plants resistant to bacterial wilt, comprising: overexpressing in a plant receptor TD2 The gene or its encoded protein, said TD2 The amino acid sequence of the protein encoded by the gene is selected from any of the following: (1) the amino acid sequence shown in SEQ ID NO:2; (2) an amino acid sequence that has more than 70% homology with the amino acid sequence shown in SEQ ID NO:2 and has the same function.

[0025] In one embodiment, the plant receptor of the present invention includes a cotyledonary explant.

[0026] This invention provides a method for screening plants resistant to bacterial wilt, comprising: detecting in the test plant... TD2 The expression level of a gene or its encoded protein, if the plant being tested... TD2 If the expression level of a gene or its encoded protein is significantly higher than that of wild-type plants, then the plant under test is a plant resistant to bacterial wilt. If the plant to be tested TD2 The expression level of the gene or its encoded protein is significantly lower than that of the wild-type plant, or the plant being tested... TD2 If the gene or its encoded protein is missing, the plant being tested is susceptible to bacterial wilt. The TD2 The amino acid sequence of the protein encoded by the gene is selected from any of the following: (1) the amino acid sequence shown in SEQ ID NO:2; (2) an amino acid sequence that has more than 70% homology with the amino acid sequence shown in SEQ ID NO:2 and has the same function.

[0027] The present invention relates to the above. TD2 There are no strict requirements for the methods used to detect the expression levels of genes or their encoded proteins; conventional methods in the field can be used, such as PCR amplification. TD2 Gene expression levels were detected using Western blotting. TD2 The expression level of a gene-encoded protein.

[0028] This invention provides a plant material resistant to bacterial wilt, wherein the plant material expresses exogenous expression TD2 The gene or its encoded protein, said TD2 The amino acid sequence of the protein encoded by the gene is selected from any of the following: (1) the amino acid sequence shown in SEQ ID NO:2; (2) an amino acid sequence that has more than 70% homology with the amino acid sequence shown in SEQ ID NO:2 and has the same function.

[0029] In one embodiment, the plant material of the present invention includes one or more of plant cells, plant tissues, and plant explants. In one embodiment, the explant of the present invention includes cotyledons.

[0030] To further illustrate the present invention, the following description, in conjunction with the accompanying drawings and embodiments, explains the invention. TD2 The application of genes or their encoded proteins in enhancing plant resistance to bacterial wilt is described in detail, but should not be construed as limiting the scope of protection of this invention.

[0031] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials and reagents used in the following examples are commercially available. The tomato variety used in the following examples is the common tomato variety Ailsa Craig, abbreviated as "AC".

[0032] Example 1 1. Tomatoes were retrieved from the SGN (https: / / solgenomics.net / ) tomato genome database. TD2 The full-length DNA sequence of the gene (gene ID: Solyc09g008670.2) was analyzed, and the nucleotide sequence of its protein-coding region (CDS) is shown in SEQ ID NO:1, with a length of 1788 bp. TD2 The protein encoded by the gene consists of 596 amino acids, and its sequence is shown in SEQ ID NO:2.

[0033] 2. Root, stem, and leaf samples were collected from the control and inoculated groups of wild-type tomato variety 'AC' at different time points after inoculation with Ralstonia solanacearum. Total RNA was extracted and detected using real-time quantitative PCR (qRT-PCR). TD2 Gene expression levels. Results as follows: Figures 1-3 As shown, inoculation with bacterial wilt pathogens can significantly induce bacterial rot in tomato plants. TD2 Upregulated gene expression. This indicates... TD2 It plays an important role in the tomato's defense response against bacterial wilt.

[0034] Example 2 tomato TD2 Preparation and identification of deletion mutant plants 1. Construction of CRISPR / Cas9 vectors containing specific sgRNA (1) Tomatoes were obtained by searching the SGN (https: / / solgenomics.net / ) tomato genome database. TD2 The full-length DNA sequence of the gene (gene ID: Solyc09g008670.2) was analyzed, and the nucleotide sequence of its protein-coding region (CDS) is shown in SEQ ID NO:1, with a length of 1788 bp. TD2 The protein encoded by the gene consists of 596 amino acids, and its sequence is shown in SEQ ID NO:2.

[0035] (2) TD2The full-length DNA sequence of the gene was submitted to the CRISPR-P 2.0 online tool (http: / / crispr.hzau.edu.cn / CRISPR2 / ). A 20 bp sequence with a high onscore score, GC content >40%, and located upstream of the protein-coding region before the PAM (NGG) sequence was selected as the specific sgRNA. The selected sgRNA1 sequence was: TTGTTTAGCCCCAACACGTA (SEQ ID NO:3); the sgRNA2 sequence was: AGCGATCATACTAGTACCAC (SEQ ID NO:4).

[0036] (3) Using a sequence containing tRNA-sgRNA-gRNA scaffold as a template, a DNA fragment containing the above-mentioned specific sgRNA sequence (SEQ ID NO.3 and SEQ ID NO.4) was obtained by PCR amplification, and the fragment was inverted at both ends. Bsa I. Restriction endonuclease cleavage sites. After purifying this PCR product, it is then... Bsa I. The plasmid was digested and ligated into a pHSE401 vector that had also been digested with the same enzymes. The correctly constructed recombinant plasmid was transformed into *E. coli* DH5α competent cells, and single clones were selected for sequencing verification. The correctly sequenced plasmid was then transformed into *Agrobacterium tumefaciens* GV3101 competent cells by electroporation to obtain an engineered strain for tomato genetic transformation.

[0037] 2. TD2 Preparation and identification of gene mutant materials (1) Take the seeds of tomato variety 'AC', disinfect the surface, sow them on 1 / 2 MS solid medium, and culture them in the dark until germination, then transfer them to light for culture. After the cotyledons have fully expanded, cut them off as explants, place them on nursery medium, and pre-culture them in the dark for 12-24 hours.

[0038] (2) The product containing pHSE401- TD2 Agrobacterium strains carrying the -sgRNA vector were inoculated into YEP liquid medium containing the appropriate antibiotics and cultured at 28°C with shaking until the logarithmic growth phase. The bacterial cells were collected by centrifugation and resuspended in MS 0.2 liquid medium (containing 100 μM acetylsylcholine) to a suitable concentration (OD600≈0.8). Pre-cultured cotyledonary explants were immersed in the bacterial suspension and gently shaken for 8-10 minutes to infect. After removal, excess bacterial solution was blotted dry with sterile filter paper, and the cultures were transferred to co-culture medium and co-cultured in the dark for 2 days.

[0039] (3) After co-culture, the explants are transferred to a selective medium containing appropriate amounts of antibiotics (such as termethin and kanamycin) to induce callus formation. The medium is replaced with fresh medium every 2-3 weeks. After callus formation, the explants are transferred to a shoot-forming medium to induce shoot clusters. Seedlings that have grown to 2-3 cm are cut off and transferred to a rooting medium to induce rooting.

[0040] (4) After the regenerated plants have developed a well-developed root system, they are transplanted into a sterilized substrate and cultured in an artificial climate chamber. Genomic DNA is extracted from the leaves of the T0 generation plants and used as a template to perform targeted... TD2 PCR amplification was performed using specific primers designed for the gene editing target region. The PCR products were sequenced and compared with wild-type sequences to screen for positive mutant plants with base insertions, deletions, or substitutions at the sgRNA target site. The primer sequences used for genotyping are as follows: Upstream primer: CTACTGAACAAAGTTTTCGA (SEQ ID NO:5); Downstream primer: ACTCCGAGCCTATCCGAGAG (SEQ ID NO:6).

[0041] (5) The T1 generation population was sown, and its genotype was detected by PCR and sequencing methods. Cas9 Specific primer detection to eliminate kanamycin resistance and Cas9 Genetic lines. Two lines without exogenous genes were selected from these. Cas9 Genes, and TD2 The T1 generation homozygous mutant lines with homozygous gene editing sites and stable inheritance were named as follows: td2 #1 and td2 #2. See details of its gene editing sites. Figure 4 As shown, compared to WT, td2 The #1 strain has a 4-base deletion (TTAG) at the sgRNA1 target site (SEQ ID NO:3). This mutation causes a frameshift in the reading frame of its encoded protein, resulting in the premature generation of a stop codon. td2 The #2 strain has a one-base (G) deletion at the sgRNA2 target site (SEQ ID NO:4). This mutation also causes a frameshift in the reading frame of its encoded protein, resulting in the premature generation of a stop codon.

[0042] (6) Further self-pollinate the above homozygous lines to obtain stable T2 generation seeds for subsequent experiments.

[0043] Example 3 tomato TD2 Construction and validation of overexpression plants 1. TD2Construction of gene overexpression vectors (1) Find the tomato on the SGN website (https: / / solgenomics.net / ). TD2 The CDS sequence of the gene (Solyc09g008670.2) is shown in SEQ ID NO:1. Specific amplification primers were designed to construct an overexpression vector with a C-terminal fusion HA tag. The 5' end of the primers contains sequences homologous to both ends of the linearized pAC004-HA vector for homologous recombination cloning. The amplification primers are designed as follows: OE-TD2-F: ttacaattaccatggggcgcgccATGGAATTCCTTTGTTTAG (SEQ ID NO:7); OE-TD2-R:aacatcgtatgggtaggtaccCTCACTTACTACAGGTTAG (SEQ ID NO:8); The lowercase letters represent arm sequences homologous to the linearized pAC004-HA vector; the bold parts are respectively... TD2 The coding sequences preceding the start codon (ATG) and stop codon (TGA) of the gene's CDS are used to ensure that the gene's CDS is completely cloned into the vector and forms the correct fusion reading frame with the downstream HA tag sequence.

[0044] (2) Linearize the vector using an appropriate restriction endonuclease (determined based on the multiple cloning site of the pAC004-HA vector), and then amplify the vector using homologous recombination. TD2 The purified CDS product was ligated into a linearized vector and transformed into *E. coli* DH5α competent cells. Single clones were picked for colony PCR and sequencing verification to ensure... TD2 The CDS sequence is correct, mutation-free, and correctly fused with the HA tag reading frame. The pAC004 sequence is correctly sequenced. TD2 - The HA recombinant plasmid was used to transform GV3101 Agrobacterium competent cells by electroporation to obtain an engineered strain for tomato genetic transformation.

[0045] 2. TD2 Preparation and identification of gene overexpression materials (1) After sterilization, the seeds of the tomato variety 'AC' were sown in 1 / 2 MS medium and cultured in the dark until the seeds germinated. After germination, they were moved to light. After the cotyledons were fully expanded, they were cut off as explants and placed in nursery medium for 12-24 hours in the dark.

[0046] (2) The Agrobacterium engineered strain containing the pAC004-TD2-HA vector was cultured to the logarithmic growth phase, and the bacterial cells were collected by centrifugation and resuspended in MS 0.2 liquid medium (containing 100 μM acetylsyl syringone) to a suitable concentration (OD600≈0.8). This medium was used to infect the pre-cultured cotyledonary explants, and the incubation was carried out in the dark for 8-10 minutes. After removal, the remaining bacterial solution on the surface of the cotyledonary explants was blotted dry with sterile filter paper, and the explants were placed on care medium and cultured in the dark for two days.

[0047] (3) After co-culture, the cotyledonary explants were transferred to a selective medium containing an appropriate amount of chloramphenicol to induce callus formation. After 2-3 weeks, they were transferred to a budding medium containing the same antibiotic for screening and induction of shoot clusters. When the shoot clusters reached 1-2 cm in length, they were cut off and transferred to a rooting medium containing antibiotics to induce rooting. After the regenerated plants developed a well-developed root system, they were transferred to a sterile substrate and cultured in an artificial climate chamber until they survived.

[0048] (4) Identification of positive transgenic plants DNA level verification (PCR): Genomic DNA was extracted from T0 generation resistant plants, and PCR amplification was performed using universal primers to preliminarily screen out positive transgenic plants.

[0049] Protein level validation (Western Blot): To further confirm at the protein level TD2 Gene overexpression was investigated by extracting total protein from leaves of wild-type (WT) and T0 generation positive plants, and Western blot analysis was performed using a monoclonal antibody against the HA tag.

[0050] The results are as follows Figure 5 As shown, no endogenous TD2 protein band was detected in wild-type (WT) plants, while strong specific hybridization signals were detected at the expected molecular weight in multiple independent overexpression lines (OE1, OE2), indicating that TD2 protein was stably and efficiently overexpressed in these transgenic lines. Two to three independent lines with the highest expression levels were selected for self-pollination, and T1 generation seeds were harvested and further propagated to obtain T2 generation homozygous lines for subsequent experiments.

[0051] Example 4 tomato TD2 Identification of disease resistance phenotypes in gene knockout mutants and overexpression plants To clarify TD2 The biological function of genes in the response of tomatoes to bacterial wilt, for wild-type (WT) td2 mutant ( td2 #1, td2 #2) and overexpressing plants (OE- TD2 #1 and OE- TD2 #2) Disease resistance was assessed.

[0052] 1. Plant materials and inoculation treatment Wild-type, mutant, and overexpression plants were selected for experiments after reaching the six-leaf-one-heart stage in a greenhouse. Plants with consistent growth vigor were used. Ralstonia solanacearum (Ralstonia solanacearum) was inoculated onto a solid propagation medium and incubated at 28°C for 2 days to activate the culture, which served as the original plate. Bacterial suspension was transferred from the original plate to fresh solid propagation medium using a spreader and incubated at 28°C for 1 day. The suspension was resuspended in sterile water, and the OD600 was adjusted to approximately 1.4. 50 ml of the bacterial suspension was injected into the roots of each tomato plant, and the plants were incubated at 28°C, 95% relative humidity, 14 hours of light followed by 10 hours of darkness, and the disease incidence was observed.

[0053] 2. Observation of disease phenotype and statistics of disease index The disease incidence of the plants was continuously observed and recorded after inoculation. On the 6th day after inoculation, the severity of the disease in each treatment group was investigated and statistically analyzed. The disease severity classification criteria are as follows: Grade 0, no symptoms; Grade 1, 1-20% of leaves wilting; Grade 2, 21-40% of leaves wilting; Grade 3, 41-60%; Grade 4, 61-80%; Grade 5, 81-100% of leaves wilting or plant death.

[0054] The results are as follows Figure 6 and Figure 7 As shown, all plants in the Mock control group grew normally. After inoculation, td2 mutant ( td2 #1, td2 #2) exhibited the most severe wilting symptoms, with a disease index significantly higher than the wild type. Conversely, overexpressing plants (OE-) showed significantly higher wilting rates. TD2 #1 and OE- TD2 #2) The plants showed the least wilting, with a disease index significantly lower than the wild type. This indicates... TD2 The loss of gene function exacerbates the susceptibility of tomatoes to bacterial wilt, while its overexpression significantly enhances resistance.

[0055] 3. Stem bacterial load (CFU) determination To quantitatively assess the proliferation of pathogens within the plants, on day 6 post-inoculation, stem segments approximately 5 cm above the base of the stem were collected from each group of plants under aseptic conditions. 0.1 g of tissue was weighed, surface-sterilized, and homogenized into a paste. This homogenate was then serially diluted using sterile ddH2O. An appropriate amount of the diluted solution was spread onto Ralstonia solanacearum agar and incubated upside down at 28°C for 48 hours. The number of single colonies on the plates was counted, and the colony-forming units (CFU / g) per gram of stem tissue were calculated. Results are as follows: Figure 8 As shown: td2The mutant stems showed the highest bacterial load, significantly higher than the wild type; while the overexpressing plants showed the lowest bacterial load, significantly lower than the wild type. This result is completely consistent with the disease index statistics, further confirming the pathogen's growth and colonization from the perspective of... TD2 Genes are positively regulating the resistance of tomatoes to bacterial wilt.

[0056] 4. Tomato TD2 Effects of genes on hydrogen peroxide accumulation under bacterial wilt stress Hydrogen peroxide (H2O2) is a key signaling molecule in plant immune responses. To investigate... SlTD2 To investigate whether *Ralstonia solanacearum* infection responds to reactive oxygen species (ROS) homeostasis through DAB (3,3'-diaminobenzidine) staining of leaves and stems from various materials, this study determined whether the infection responds to Ralstonia solanacearum infection by regulating reactive oxygen species (ROS) homeostasis. The intensity of the brown precipitate after DAB staining represented the level of H2O2 accumulation.

[0057] The results are as follows Figure 9 and 10 As shown, under control conditions, there were no significant differences in staining among the materials; however, after inoculation with Ralstonia solanacearum, SlTD2 Overexpression plants (OE-) TD2 The leaves and stems of the α-type were stained significantly deeper than the wild-type control (AC), indicating that it produced more H2O2. Conversely, td2 The mutant plants stained significantly lighter than the control. This indicates that... TD2 The gene is a positive regulator that triggers the H2O2 burst during the infection process of Ralstonia solanacearum. Overexpression of this gene can induce a stronger H2O2 signal, thereby activating the downstream defense response.

[0058] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. TD2 The application of genes or their encoded proteins in improving plant resistance to bacterial wilt, the TD2 The amino acid sequence of the protein encoded by the gene is selected from any of the following: (1) the amino acid sequence shown in SEQ ID NO:2; (2) an amino acid sequence that has more than 70% homology with the amino acid sequence shown in SEQ ID NO:2 and has the same function.

2. TD2 The application of genes or their encoded proteins in screening or breeding plants resistant to bacterial wilt, the aforementioned TD2 The amino acid sequence of the protein encoded by the gene is selected from any of the following: (1) the amino acid sequence shown in SEQ ID NO:2; (2) an amino acid sequence that has more than 70% homology with the amino acid sequence shown in SEQ ID NO:2 and has the same function.

3. The application according to claim 1 or 2, characterized in that, The TD2 The nucleotide sequence of the gene is selected from any of the following: (1) the nucleotide sequence shown in SEQ ID NO:1; (2) the nucleotide sequence that has more than 70% homology with the nucleotide sequence shown in SEQ ID NO:1 and encodes a protein with the same function.

4. The application according to claim 1 or 2, characterized in that, The plant mentioned includes tomatoes.

5. The application according to claim 1 or 2, characterized in that, The pathogens causing bacterial wilt include Ralstonia solanacearum (Ralstonia solanacearum). Ralstonia solanacearum ).

6. A method for improving plant resistance to bacterial wilt or cultivating plants resistant to bacterial wilt, characterized in that, include: Overexpression in plant receptors TD2 The gene or its encoded protein, said TD2 The amino acid sequence of the protein encoded by the gene is selected from any of the following: (1) the amino acid sequence shown in SEQ ID NO:2; (2) an amino acid sequence that has more than 70% homology with the amino acid sequence shown in SEQ ID NO:2 and has the same function.

7. The method according to claim 6, characterized in that, The plant receptors include cotyledonary explants.

8. A method for screening plants resistant to bacterial wilt, characterized in that, include: Detection of the plant to be tested TD2 The expression level of a gene or its encoded protein, if the plant being tested... TD2 If the expression level of a gene or its encoded protein is significantly higher than that of wild-type plants, then the plant under test is a plant resistant to bacterial wilt. If the plant to be tested TD2 The expression level of the gene or its encoded protein is significantly lower than that of the wild-type plant, or the plant being tested... TD2 If the gene or its encoded protein is missing, the plant being tested is susceptible to bacterial wilt. The TD2 The amino acid sequence of the protein encoded by the gene is selected from any of the following: (1) the amino acid sequence shown in SEQ ID NO:2; (2) an amino acid sequence that has more than 70% homology with the amino acid sequence shown in SEQ ID NO:2 and has the same function.

9. A plant material resistant to bacterial wilt, characterized in that, The exogenous expression of the plant material resistant to bacterial wilt TD2 The gene or its encoded protein, said TD2 The amino acid sequence of the protein encoded by the gene is selected from any of the following: (1) the amino acid sequence shown in SEQ ID NO:2; (2) an amino acid sequence that has more than 70% homology with the amino acid sequence shown in SEQ ID NO:2 and has the same function.

10. The bacterial wilt-resistant plant material according to claim 1, characterized in that, The plant material includes one or more of plant cells, plant tissues, and plant explants.

Images