A method for constructing a mouse model of GATM gene I304T point mutation Fanconi renal tubular syndrome
Patent Information
- Application Number
- CN202610688693.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-05-19
- Publication Date
- 2026-08-21
AI Technical Summary
少数点突变模型如GATM p.Pro341Leu敲入小鼠已报道,能部分模拟线粒体异常和慢性肾病,但这些模型针对特定突变,无法覆盖所有临床变异,尤其是新型I304T突变的独特表型,如尿丝状物质和严重骨骼异常
[0023]1、本发明构建的GATM基因I304T点突变范可尼肾小管综合征小鼠模型能再现范可尼肾小管综合征的典型临床表现,包括肾小管重吸收障碍、电解质失衡和骨骼异常,提供更贴近患者杂合突变背景的实验平台,避免敲除模型的局限性。
Smart Images

Figure CN122609646A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to a method for constructing a mouse model of Fanconi renal tubular syndrome with the I304T point mutation in the GATM gene. Background Technology
[0002] Fanconi renotubular syndrome (FRTS) is a group of inherited disorders characterized primarily by proximal tubular dysfunction, manifesting mainly as renal glycosuria, aminoaciduria, phosphateuria, metabolic acidosis, and low molecular weight proteinuria. These abnormalities stem from defects in the reabsorption of various solutes and water by proximal tubular epithelial cells, leading to multiple electrolyte imbalances and nutrient losses. FRTS can be classified into primary and secondary types, with primary FRTS further subdivided into several subtypes, varying according to inheritance patterns and pathogenic genes. Primary FRTS1 is an autosomal dominant inherited disease primarily caused by mutations in the gene encoding glycine-amidinotransferase (GATM, also known as AGAT). The disease typically manifests in childhood, progresses to chronic kidney disease in adolescence, and may develop into end-stage renal disease between the ages of 30 and 60, requiring kidney transplantation. GATM protein is a key enzyme in the creatine biosynthesis pathway, mainly expressed in the proximal renal tubules of the kidney and the liver. It catalyzes the transfer of the guanidino group of L-arginine to glycine to generate guanidinoacetic acid (GAA), the precursor of creatine. The GATM protein structure consists of five antiparallel β-sheets (β1-β5), which normally form an active dimer through the β2-β2 interface.
[0003] Clinical reports of FRTS appeared in the literature as early as the mid-20th century, such as the familial case described by Sheldon et al. in 1961, but its molecular mechanism remained unclear for a long time. Until 2018, Reichold et al., through genetic analysis of 28 members from five families, first discovered four different heterozygous missense mutations in the GATM gene: c.958C>T (p.Pro320Ser), c.1006A>G (p.Thr336Ala), c.1007C>T (p.Thr336Ile), and c.1022C>T (p.Pro341Leu). These mutations are located in conserved regions of the GATM protein, primarily affecting the β4 domain, leading to the formation of new β4-β4 interaction interfaces on the protein surface and promoting fibrillary aggregation of the protein. This accumulation occurs within the mitochondria of proximal renal tubular cells, causing significant mitochondrial enlargement and abnormal morphology, accompanied by increased reactive oxygen species (ROS), activation of inflammatory factors (such as elevated IL-18), and accelerated cell death, ultimately leading to renal interstitial fibrosis and progressive renal failure. The mitochondrial phenotype observed in patient renal biopsies is consistent with these molecular changes. Furthermore, Reichold's research showed that the GATM knockout mouse model exhibited no renal tubular dysfunction, confirming that FRTS1 is not due to GATM haploid deficiency, but rather the toxic accumulation of the mutant protein. Creatine supplementation can reduce renal GATM expression levels, suggesting a potential therapeutic strategy.
[0004] Subsequently, more heterozygous GATM mutations were reported, further enriching the genetic lineage of FRTS1. In 2022, Seaby et al. reported a mother and daughter carrying the c.965G>C (p.Arg322Pro) mutation, with the mother undergoing a kidney transplant in her 30s, highlighting the progressive nature of the disease. In 2023, Kudo et al. discovered the c.888T>A (p.Phe296Leu) mutation in a Japanese family, with patients presenting with familial Fanconi syndrome with chronic kidney disease. Around the same time, Koyun et al. reported the c.953C>A (p.Ser318Tyr) mutation, associated with hypophosphatemic rickets. In 2024, Ragate et al. discovered the c.1021C>T (p.Pro341Ser) mutation in a multicenter study in western India, expanding the geographical distribution of the disease. These mutations are mostly clustered near β4 of the GATM protein, and molecular dynamics simulations confirmed their promotion of protein polymerization and mitochondrial damage. In 2024, Li et al. reported a novel heterozygous mutation c.911T>C (p.Ile304Thr, or I304T for short), which was the first reported case of FRTS1 in China. The patient presented with severe hypophosphatemic rickets, a large amount of filamentous material in the urinary sediment, and typical renal tubular dysfunction. This site is highly conserved, located near the β4 domain, and the mutation may interfere with protein folding, leading to fibrous-like aggregates.
[0005] Despite rapid progress in clinical and genetic research, animal model studies of FRTS1 have lagged behind. Existing models primarily consist of GATM knockout mice, used to study cerebral creatine deficiency syndrome, characterized by intellectual disability, language and behavioral impairments, but without obvious kidney or muscle phenotypes. This contradicts the autosomal dominant mechanism of FRTS1, as knockout models mimic the recessive creatine synthesis defect rather than the toxic effects of the mutant protein. A few point mutation models, such as the GATM p.Pro341Leu knock-in mouse, have been reported to partially mimic mitochondrial abnormalities and chronic kidney disease; however, these models target specific mutations and cannot cover all clinical variations, especially the unique phenotypes of the novel I304T mutation, such as urinary filamentous material and severe skeletal abnormalities. Other FRTS subtype models, such as HNF4A knockout mice mimicking FRTS4, or EHHADH mutation models mimicking FRTS3, cannot be directly used for GATM-related research. The limitations of these models have hindered the exploration of the pathogenesis of FRTS1 and the study of drug intervention, making it impossible to accurately simulate the physiological state under human heterozygous mutations, such as progressive renal failure and hypophosphatemic rickets. Summary of the Invention
[0006] The purpose of this invention is to overcome the defects of the prior art and provide a method for constructing a mouse model of Fanconi renal tubular syndrome with the I304T point mutation in the GATM gene.
[0007] Another objective of this invention is to provide a mouse model of Fanconi renal tubular syndrome with the I304T point mutation in the GATM gene constructed by the above-described method.
[0008] The technical solution of the present invention is as follows:
[0009] A method for constructing a mouse model of Fanconi renal tubular syndrome with the I304T point mutation in the GATM gene includes the following steps:
[0010] (1) A c.911T>C point mutation was introduced into exon 6 of the GATM gene, and the corresponding amino acid was changed from Ile to Thr;
[0011] (2) The point mutation was introduced into the fertilized eggs of C57BL / 6JGpt background mice using the CRISPR / Cas9 system and Donor vector;
[0012] (3) The injected fertilized eggs were transplanted into pseudopregnant female mice to produce F0 generation mice;
[0013] (4) Genotyping of F0 generation mice was performed to obtain positive F0 generation mice;
[0014] (5) Cross the positive F0 generation mice with wild-type mice to obtain F1 generation mice, and perform genotyping on the F1 generation mice to obtain the F1 generation mice.
[0015] In a preferred embodiment of the present invention, the GATM gene in step (1) is based on the Gatm-201 transcript ENSMUST00000028624.9, with the 304th codon mutated from ATC to ACC.
[0016] In a preferred embodiment of the present invention, the CRISPR / Cas9 system in step (2) includes Cas9 mRNA and gRNA prepared by in vitro transcription, which are mixed with Donor vector and then microinjected into C57BL / 6JGpt fertilized eggs.
[0017] In a preferred embodiment of the present invention, the genotype identification in steps (4) and (5) includes extracting genomic DNA from the tip of a mouse tail, performing PCR amplification using Primer-F as shown in SEQ ID NO.01 and Primer-R as shown in SEQ ID NO.02, with the amplification product being 684 bp in length, followed by Sanger sequencing.
[0018] More preferably, the PCR amplification cycling conditions are as follows: 95 ℃ pre-denaturation for 5 min; then 98 ℃ denaturation for 30 s, 65 ℃ annealing for 30 s, and 72 ℃ extension for 45 s, for 20 cycles; followed by 98 ℃ denaturation for 30 s, 55 ℃ annealing for 30 s, and 72 ℃ extension for 45 s, for 20 cycles; and finally, 72 ℃ extension for 5 min.
[0019] In a preferred embodiment of the present invention, the method further includes a step of analyzing mRNA expression in subsequent generations of mice: extracting total RNA from the renal cortex, performing qPCR using M-GATM-F as shown in SEQ ID NO.03 and M-GATM-R as shown in SEQ ID NO.04 as primers, and using GAPDH as an endogenous control.
[0020] In a preferred embodiment of the invention, the method further includes a step of analyzing protein expression in subsequent generations of mice: extracting renal cortical proteins and performing Western blotting using GATM and GAPDH antibodies.
[0021] A mouse model of Fanconi renal tubule syndrome with I304T point mutation in the GATM gene was constructed using the method described above.
[0022] The beneficial effects of this invention are:
[0023] 1. The GATM gene I304T point mutation Fanconi renal tubular syndrome mouse model constructed in this invention can reproduce the typical clinical manifestations of Fanconi renal tubular syndrome, including renal tubular reabsorption disorder, electrolyte imbalance and skeletal abnormalities, and provides an experimental platform that is closer to the heterozygous mutation background of patients, avoiding the limitations of knockout models.
[0024] 2. The GATM gene I304T point mutation Fanconi renal tubular syndrome mouse model constructed in this invention can be used to observe the protein aggregation, mitochondrial damage and negative feedback regulatory mechanisms caused by the mutation, such as reduced mRNA and protein expression, as well as inflammatory activation and cell death processes, helping to reveal the molecular pathway of FRTS1 from proximal renal tubular damage to progressive renal failure.
[0025] 3. The GATM gene I304T point mutation Fanconi renal tubular syndrome mouse model constructed by this invention can be used to evaluate the effects of interventions such as inhibiting protein polymerization, improving mitochondrial function, or supplementing creatine, providing a reliable basis for clinical translation, such as testing compounds that reduce GATM expression to reduce toxic deposition.
[0026] 4. This invention uses CRISPR / Cas9 technology, which makes the construction process fast and efficient, including microinjection and genotype identification. It is suitable for large-scale breeding and multi-generational observation, reducing experimental variation and improving the standardized application of animal models in the study of genetic kidney diseases.
[0027] 5. The GATM gene I304T point mutation Fanconi renal tubular syndrome mouse model constructed in this invention is designed for the novel I304T mutation and can be used as a template to extend to other GATM site mutation models, enrich the FRTS1 animal model library, and promote cross-mutation comparative analysis and personalized medicine progress. Attached Figure Description
[0028] Figure 1 This paper illustrates the interspecies conservation of the GATM gene I304T mutation site in Example 1 of this invention, the mouse model construction strategy, and expression analysis. Figure a shows the interspecies conservation analysis, displaying the alignment results of the GATM protein sequence, including the I304T mutation site (marked with a black box), across multiple species. Figure b is a diagram of the design strategy for constructing the Gatm-I304T gene mutant mouse model. Figure c shows the Sanger sequencing results of wild-type, heterozygous, and homozygous mutant mice from the same littermate of Gatm-I304T constructed using CRISPR / Cas9, with the sites marked with red boxes. Figure d shows the expression levels of GATM protein and mRNA in the kidney tissue of wild-type, heterozygous, and homozygous mutant mice from the same littermate at 30 weeks of age (n=3 per group). Expression values were standardized using the WT group as a baseline, and results are expressed as mean ± standard deviation (SD). WT: wild-type; Het: heterozygous; Hom: homozygous; SD: standard deviation.
[0029] Figure 2 This figure shows the changes in blood and urine biochemical parameters of a 30-week-old I304T heterozygous mutant mouse model constructed in Example 1 of this invention and its littermate wild-type mice. Figure a shows the 24-hour urinary β2-microglobulin (U-β2-MG) content, Figure b shows the 24-hour urinary glucose (U-Glu) content, Figure c shows the 24-hour urinary albumin-to-creatinine ratio (U-ACR), Figure d shows the serum phosphate content, and Figure e shows the 24-hour urinary total amino acid content. Data are expressed as mean ± standard deviation (SD), n=6; **p<0.01, *p<0.1. WT: wild type; U-β2-MG: urinary β2-microglobulin; U-ACR: urinary albumin / creatinine ratio; Serum phosphate: serum phosphate; Total urinary amino acids: urinary total amino acids; SD: standard deviation.
[0030] Figure 3 This image shows transmission electron microscopy (TEM) images of mitochondria in renal tubular epithelial cells from the I304T heterozygous mutant mouse model constructed in Example 1 of this invention and from littermate wild-type mice. Representative TEM images show the ultrastructure of mitochondria in renal tubular epithelial cells from wild-type and GATM-I304T heterozygous mutant mice. At 30 weeks of age, the mutant mice exhibit significant electron density inconsistencies, mitochondrial swelling, disappearance or breakage of internal cristae, widening of the plasma membrane infolds, and nuclear shrinkage. (ab: 3000x magnification; cd: 8000x magnification)
[0031] Figure 4 This invention demonstrates the pathological changes in kidney tissue from the I304T heterozygous mutant mouse model constructed in Example 1 of this invention and its littermate wild-type mice, as shown by HE and Masson staining. Masson staining (×200) and HE staining (×200) revealed tubulointerstitial fibrosis, disordered tubular arrangement, and numerous cavities in the mutant mouse kidney tissue. No obvious abnormalities were observed in the wild-type control mice at the same time point. HE: hematoxylin-eosin staining; Masson: Masson staining.
[0032] Figure 5This paper displays MicroCT scan images and bone parameter analysis of the distal femur of the I304T heterozygous mutant mouse model constructed in Example 1 of this invention. Figure a shows a 2D image of the distal femur of the mouse; Figure b shows the quantitative analysis of bone volume / tissue volume (BV / TV); Figure c shows the quantitative analysis of bone surface area / bone volume (BS / BV); Figure d shows the quantitative analysis of bone surface area / tissue volume (BS / TV); Figure e shows the quantitative analysis of trabecular thickness (Tb.Th); Figure f shows the quantitative analysis of trabecular number (Tb.N); and Figure g shows the quantitative analysis of trabecular spacing (Tb.Sp). **p<0.01, *p<0.1, expression values were standardized based on the WT group, and results are expressed as mean ± standard deviation (SD). Detailed Implementation
[0033] The technical solution of the present invention will be further explained and described below with reference to specific embodiments and accompanying drawings.
[0034] Example 1
[0035] A site-directed mutation, c.T911C, was created in exon 6 of the Gatm-201 (ENSMUST00000028624.9) transcript, changing codon 304 from ATC to ACC and amino acid I (Ile) to T (Thr). The CRISPR / Cas9 system and Donor vector sample were microinjected into C57BL / 6JGpt background mouse zygotes. Surviving zygotes were transferred to pseudopregnant female mice, allowing them to give birth. F0 generation pups were tail-cropped and toe-cropped at 5-7 days of age for genomic DNA extraction, which was then used for PCR and sequencing to confirm genotype. After reaching sexual maturity, positive F0 generation mice were mated with wild-type background mice. F1 generation pups were tail-cropped and toe-cropped at 5-7 days of age for genomic DNA extraction, which was then used for PCR and sequencing to confirm genotype. Subsequent generations of mice were bred through mating and analyzed.
[0036] I. Materials and Methods:
[0037] 1. Laboratory animals:
[0038] All C57BL / 6J mice were given free access to standard feed and water and housed in a constant temperature and humidity environment of 22±2 ℃ and 50±10% relative humidity, with a 12 h light / 12 h dark light cycle. All animal experiments were approved by the Ethics Committee for the Management and Use of Laboratory Animals of the College of Pharmaceutical Sciences, Ocean University of China, and experimental procedures strictly followed the SRC-IACUC guidelines.
[0039] 2. Construction of the GATM I304T point mutation knock-in model:
[0040] The c.911T>C (p.I304T) mutation located in exon 6 of GATM is highly conserved across species. Figure 1 a). To elucidate the potential effects of this mutation, this embodiment utilizes CRISPR / Cas9 technology to create an I304T point mutation knock-in mouse model ( Figure 1 b). The strategy targets the mouse Gatm-201 (ENSMUST00000028624.9) transcript. The specific process is as follows: (1) Cas9 mRNA and gRNA (5'-ggcatcgatgtgcattggat-3', SEQ ID NO.07) are prepared by in vitro transcription. At the same time, a homologous recombination vector (Donor vector) is constructed. A single-chain Donor oligo is chemically synthesized, which contains the mutation site sequence and has homologous arms of 60 bp upstream and downstream of the target gene mutation site, respectively. The oligo was chemically synthesized by solid-phase phosphoramide method and purified by HPLC to ensure purity. The sequence consists of an upstream 60 bp homologous arm, a target point mutation sequence, and a downstream 60 bp homologous arm in sequence. The correctness of the vector sequence was verified by sequencing. (2) Cas9 mRNA, gRNA and Donor vector were mixed and microinjected into C57BL / 6J fertilized eggs. F0 generation positive mice were obtained by PCR and sequencing. (3) F0 generation positive mice were mated with wild-type C57BL / 6J mice to obtain F1 generation. The tails and toes of the F1 generation mice were clipped and numbered 5-7 days after birth. Genomic DNA was extracted for PCR and sequencing to confirm the genotype.
[0041] 3. Genotyping:
[0042] Genomic DNA was extracted from the tail tip of mice using a mouse tissue direct PCR kit (Tiangen, China). PCR amplification was performed targeting exon 6 of the GATM gene, using the following primer sequences:
[0043] Primer-F: 5'-ctgacttcattcgagctggaagag-3' (SEQ ID NO.01),
[0044] Primer-R: 5'-cttgcttacagtcctgttgaaccac-3' (SEQ ID NO. 02).
[0045] The expected product length was 684 bp. The PCR cycling conditions were: 95 °C pre-denaturation for 5 min, 98 °C denaturation for 30 s, 65 °C annealing for 30 s, 72 °C extension for 45 s, for 20 cycles; followed by another 98 °C denaturation for 30 s, 55 °C annealing for 30 s, 72 °C extension for 45 s, for 20 cycles; and finally, 72 °C for 5 min and 10 °C hold. After separation by 1.5% agarose gel electrophoresis, the amplified product was directly subjected to Sanger sequencing to determine the genotype.
[0046] 4. mRNA and protein expression level analysis:
[0047] Three 30-week-old male mice with the heterozygous GATM-I304T mutation and three wild-type male mice were used. Total RNA was extracted from the renal cortex using RNA-easy separation reagent (Vazyme Biotech Co., Ltd., China). The expression level of the GATM gene was detected by reverse transcription and real-time quantitative PCR (qPCR) using a two-step RT-qPCR kit (Accurate Biology, China). Primer sequences are shown in Table 1. GAPDH internal control reagent was used as an endogenous control. The protein supernatant was obtained by lysing mouse renal cortex with RIPA lysis buffer (Beyotime, P0013B). Loading buffer (Yamei, LT101S) was added to prepare a Western blotting sample. A 10% gel (Seville, G2043-50T) was prepared, and electrophoresis was performed at 80V for 30 min, 120V for 70 min, followed by sandwich transfer at 300V for 30 min. Blocking with 5% skim milk powder was performed for 1 h 30 min. The sample was then incubated overnight at 4 ℃ with primary antibody GATM (ABclonal, A6598, 1:2000) and GAPDH (Proteintech, 10494-1-AP, 1:10000). The sample was washed three times with TBST for 5 min each time. The sample was then incubated at room temperature with rabbit secondary antibody (Proteintech, RGAR001, 1:2000) for 1 h, followed by three more washes with TBST for 5 min each time. Chemiluminescence imaging was then performed.
[0048] Table 1
[0049] M-GATM-F ttttcaagaaagcaggatgga (SEQ ID NO.03) M-GATM-R atcatcccctctggatgtca (SEQ ID NO.04) M-GAPDH-F tgtgtccgtcgtggatctga (SEQ ID NO.05) M-GAPDH-R ttgctgttgaagtcgcaggag (SEQ ID NO.06)
[0050] 5. Urine and serum biochemical indicators
[0051] Thirty-week-old male mice were collected and individually placed in metabolic cages with free access to water. Urine was collected over 24 hours. The urine samples were centrifuged at 3000 rpm for 20 min, and the supernatant was used to analyze urinary protein (Nanjing Jiancheng, catalog number: C035-2-1), urinary creatinine (Nanjing Jiancheng, catalog number: C011-2-1), urinary phosphorus (Abcam, catalog number: ab65622), urinary glucose (Beyotime, catalog number: S0201S), and β2-microglobulin (Youpin Biotechnology, catalog number: YPD1069). Blood was collected via the tail vein, incubated at room temperature for 2 h, and then centrifuged at 3000 rpm for 20 min to separate serum. Serum creatinine (Nanjing Jiancheng, catalog number: C011-2-1), blood urea nitrogen (Nanjing Jiancheng, catalog number: C013-2-1), serum phosphorus (Abcam, catalog number: ab65622), and alkaline phosphatase (Nanjing Jiancheng, catalog number: A059-2) were all tested according to the instructions.
[0052] 6. Histological changes in the kidneys
[0053] To observe the histological changes in the kidneys of the I304T mouse model, kidney tissues were taken from 30-week-old I304T and wild-type male mice and analyzed by light microscopy, transmission electron microscopy and immunofluorescence.
[0054] 6.1 Light microscopic examination:
[0055] Kidney tissue was fixed with 4% paraformaldehyde, embedded in paraffin, sectioned, and stained with HE and Masson staining for histological evaluation.
[0056] 6.2 Transmission Electron Microscopy:
[0057] The specimen was cut into 1 mm³ pieces, fixed with 2.5% glutaraldehyde and 1% osmium tetroxide, dehydrated with a gradient of ethanol or acetone, embedded in epoxy resin and polymerized and cured at 60 °C. After trimming, 70-80 nm ultrathin sections were cut, stained with uranyl acetate and lead citrate on a copper grid, and finally observed under a transmission electron microscope to examine the ultrastructure.
[0058] 6.3 Immunofluorescence:
[0059] Kidney tissue immunofluorescence paraffin sections need to be dewaxed and hydrated first: dewaxed three times with xylene (5 min each time), followed by gradient alcohol (100%, 95%, 80%, 70%) for 5 min each, and rinsed with distilled water; then antigen retrieval (microwave heating method), cooled to room temperature and rinsed with PBS; blocked with 3% BSA for 30 min, GATM primary antibody added, and incubated overnight at 4 ℃; the next day, the primary antibody was washed off with PBS, fluorescent secondary antibody was added and incubated at room temperature in the dark for 1 h, rinsed with PBS, mounted with mounting medium containing DAPI, and observed under a fluorescence microscope.
[0060] 7. Trabecular bone parameters of the distal femur
[0061] After euthanizing mice, the femur was completely dissected, soft tissue removed, and fixed in 4% paraformaldehyde for 24 h. The surface liquid was wiped dry, and the sample was placed in a 38 mm diameter sample tube of a MicroCT scanner (Quantum GX2). Scanning parameters were set (500 kV, 100 μA, resolution 36 μm). After Scout View pre-scanning and localization, regions of interest (ROIs) were defined in the 0-3.4 mm region (cancellous bone) below the distal femoral growth plate. After image reconstruction, three-dimensional evaluation was performed using professional analysis software. A segmentation threshold was set for cancellous bone (approximately 220-300 / 1000 mgHA / cm³), and Gaussian filtering was applied for noise reduction (Sigma=0-1.2, Support=0-2). Bone tissue was extracted by automatic or manual contour drawing. Finally, trabecular parameters (bone volume fraction BV / TV, trabecular thickness Tb.Th, resolution Tb.Sp, number Tb.N, etc.) were calculated. All analyses maintained consistent scanning conditions and threshold settings for the same experiment.
[0062] 8. Statistical Analysis
[0063] All data were analyzed using GraphPad Prism 8.0.2 software. Student's test was used for comparisons between two groups. P < 0.05 was considered statistically significant, and all experiments were independently repeated at least three times.
[0064] II. Experimental Results
[0065] 1. Establishment of the I304T point mutation knock-in mouse model
[0066] In this embodiment, the CRISPR / Cas9 system was used to construct the corresponding GATM mutant mouse based on the I304T missense mutation reported in the literature. Genotyping was performed using PCR amplification and sequencing. A sufficient number of wild-type, homozygous, and heterozygous offspring were then bred by mating heterozygous females and males.
[0067] Three heterozygous, three homozygous, and three wild-type male I304T mice aged 30 weeks were used to extract total RNA from the renal cortex for qPCR analysis to detect the expression level of GATM mRNA. The results showed that the expression level of GATM mRNA in the renal tissue of homozygous mutant mice was significantly lower than that in wild-type mice (*p<0.05). A decreasing trend was also observed in heterozygous mutants, but the difference was not significant (p=0.226). Figure 1d). Western blot protein analysis of renal cortex samples revealed that heterozygous mice had significantly lower GATM protein levels in renal tissue compared to wild-type mice (**p<0.01), while homozygous mice had the lowest protein levels, significantly lower than wild-type mice (**p<0.01) and heterozygous mice (*p<0.05). Figure 1 d). The decrease in protein levels caused by missense mutations may be due to the body's own protein quality control system regulating and promptly clearing misfolded proteins, leading to a decrease in GATM protein levels in kidney tissue. Furthermore, there is a negative feedback regulatory mechanism of transcription factors, resulting in a decrease in cellular mRNA levels.
[0068] 2. Analysis of blood and urine biochemical indicators and pathological results in I304T heterozygous mutant mice
[0069] I304T heterozygous mutant mice showed elevated urinary glucose (*p<0.05, n=5), increased urinary total amino acid content (**p<0.01, n=5), increased low molecular weight protein (β2-microglobulin) content (*p<0.05, n=5), and decreased serum phosphorus concentration at 30 weeks (*p<0.05, n=5). Figure 2 All of the above indicators meet the relevant clinical criteria for Fanconi renal tubular syndrome.
[0070] Electron microscopy of mitochondria in proximal renal tubular epithelial cells of mouse renal cortex ( Figure 3 The results showed that the mitochondria of the heterozygous mutant mice exhibited widened plasma membrane infolds, partial breakage or disappearance of mitochondrial infolds, nuclear shrinkage, increased number of phagocytic vesicles, increased number of lysosomes, heterogeneous electron density in the mitochondria, and mitochondrial swelling. Masson staining of kidney tissue sections showed mild interstitial fibrosis in the I304T heterozygous mutant mice. Figure 4 HE staining revealed disordered renal tubule arrangement, luminal dilation in some tubules, and shedding of some tubular epithelial cells in I304T heterozygous mutant mice. Electron microscopy and pathological results both indicated abnormalities in the mitochondria of the renal tubular epithelial cells of I304T heterozygous mutant mice.
[0071] The microCT scan of the mouse femur visually demonstrates the changes in the microstructure of the trabecular bone. Figure 5Most trabecular bone parameters, including bone volume / tissue volume (BV / TV), trabecular number (Tb.N), trabecular thickness (Tb.Th), and trabecular spacing (Tb.Sp), were affected. In I304T heterozygous mutant mice, the number of trabecular bones was reduced (**p<0.01, n=5), trabecular spacing was increased (**p<0.01, n=5), trabecular thickness showed a decreasing trend but no significant difference (p=0.4504), the bone volume / tissue volume ratio was decreased (**p<0.01, n=5), the bone surface area / bone volume ratio was decreased (*p<0.05, n=5), and the bone surface area / tissue volume ratio was decreased (**p<0.01, n=5). These changes are consistent with reported bone parameter changes associated with hypophosphatemic rickets in patients carrying this mutation.
[0072] This embodiment successfully constructed a mouse model of the GATM site I304T mutation, which accurately simulated the relevant clinical indicators, providing a solid foundation for subsequent research on the pathogenic mechanism and drug treatment.
[0073] The above description is merely a preferred embodiment of the present invention, and therefore should not be construed as limiting the scope of the present invention. All equivalent changes and modifications made in accordance with the scope of the patent and the contents of the specification should still fall within the scope of the present invention.
Claims
1. A method for constructing a mouse model of Fanconi renal tubular syndrome with the I304T point mutation in the GATM gene, characterized in that: Includes the following steps: (1) A c.911T>C point mutation was introduced into exon 6 of the GATM gene, and the corresponding amino acid was changed from Ile to Thr; (2) The point mutation was introduced into the fertilized eggs of C57BL / 6JGpt background mice using the CRISPR / Cas9 system and Donor vector; (3) The injected fertilized eggs were transplanted into pseudopregnant female mice to produce F0 generation mice; (4) Genotyping of F0 generation mice was performed to obtain positive F0 generation mice; (5) Cross the positive F0 generation mice with wild-type mice to obtain F1 generation mice, and perform genotyping on the F1 generation mice to obtain the F1 generation mice.
2. The preparation method according to claim 1, characterized in that: The GATM gene in step (1) is based on the Gatm-201 transcript ENSMUST00000028624.9, with the 304th codon mutated from ATC to ACC.
3. The preparation method according to claim 1, characterized in that: The CRISPR / Cas9 system in step (2) includes Cas9 mRNA and gRNA prepared by in vitro transcription, which are mixed with the Donor vector and then microinjected into C57BL / 6JGpt fertilized eggs.
4. The preparation method according to claim 1, characterized in that: Genotyping in steps (4) and (5) includes extracting genomic DNA from the tip of a mouse tail, performing PCR amplification using Primer-F as shown in SEQ ID NO.01 and Primer-R as shown in SEQ ID NO.02, with the amplified product being 684 bp in length, followed by Sanger sequencing.
5. The preparation method according to claim 4, characterized in that: The PCR amplification cycling conditions were as follows: 95 °C pre-denaturation for 5 min; then 98 °C denaturation for 30 s, 65 °C annealing for 30 s, and 72 °C extension for 45 s, for 20 cycles; followed by 98 °C denaturation for 30 s, 55 °C annealing for 30 s, and 72 °C extension for 45 s, for 20 cycles; and finally, 72 °C extension for 5 min.
6. The preparation method according to claim 1, characterized in that: It also includes the step of analyzing mRNA expression in subsequent generations of mice: extracting total RNA from the renal cortex, performing qPCR using M-GATM-F as shown in SEQ ID NO.03 and M-GATM-R as shown in SEQ ID NO.04 as primers, and using GAPDH as an endogenous control.
7. The preparation method according to claim 1, characterized in that: It also includes steps for analyzing protein expression in subsequent generations of mice: extracting renal cortical proteins and performing Western blotting using GATM and GAPDH antibodies.
8. A mouse model of Fanconi renal tubular syndrome with a GATM gene I304T point mutation, characterized in that: It is constructed by the construction method according to any one of claims 1 to 7.