A method for producing 5-amino levulinic acid by inhibiting expression of the arsX gene of corynebacterium glutamicum

CN122609652APending Publication Date: 2026-08-21NINGXIA JIANLI PEPTIDE BIOTECHNOLOGY CO LTD
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202610455813.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-08
Publication Date
2026-08-21

AI Technical Summary

Technical Problem

目前,arsX基因的调控已成功应用于谷氨酸棒杆菌的重金属解毒与耐受研究,但尚未有关于抑制谷氨酸棒杆菌中arsX基因表达以合成 5-ALA 的相关报道

Benefits of technology

本发明首次将全局转录调控因子基因arsX的抑制应用于谷氨酸棒杆菌5-ALA 的合成,通过CRISPRi 技术构建特异性抑制arsX基因表达的工程菌株Cgh3-h-ArsX,实验结果表明,该工程菌株经摇瓶发酵72 h后5-ALA产量达到3.32 g/L,相较于对照菌株Cgh3-pXi提升约1.91倍,显著提高5-ALA的合成效率。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122609652A_ABST
    Figure CN122609652A_ABST
Patent Text Reader

Abstract

The present disclosure provides a method for producing 5-ALA by inhibiting the expression of the gene of Corynebacterium glutamicum arsX The present disclosure relates to the field of bioengineering technology and application, and discloses a method for producing 5-ALA by inhibiting the expression of the gene of Corynebacterium glutamicum arsX The present disclosure uses Corynebacterium glutamicum engineering bacteria Cgh3 as a host, constructs a pCRISPRi-high-ArsX plasmid for targeted inhibition of the gene of Corynebacterium glutamicum by CRISPRi technology, and obtains an engineering strain Cgh3-h-ArsX through electroporation and screening, and then synthesizes 5-ALA through fermentation culture. arsX The present disclosure first applies gene inhibition to the synthesis of 5-ALA of Corynebacterium glutamicum, and the yield of 5-ALA of the engineering strain reaches 3.32 g / L after 72 h of shake flask fermentation, which is about 1.91 times higher than that of the control strain. The present disclosure is suitable for industrial production of 5-ALA.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology and application, specifically relating to a method that inhibits Corynebacterium glutamicum. arsX A method for producing 5-aminolevulinic acid through gene expression. Background Technology

[0002] 5-Aminolevulinic acid (5-ALA), also known as 5-aminolevulinic acid, with the molecular formula C5O3NH9, is a common precursor in the synthesis of pyrrole compounds such as chlorophyll, heme, and vitamin B12 in organisms. It is widely found in microorganisms and animal and plant cells. 5-ALA is non-toxic to humans and animals, readily degrades in the environment without leaving residues, and has broad application prospects in the pharmaceutical field as a photodynamic drug and in agriculture as a biodegradable herbicide, plant growth regulator, and feed additive.

[0003] Currently, large-scale production of 5-ALA mainly relies on chemical synthesis. However, this method suffers from drawbacks such as high production costs, severe pollution during synthesis, low yields, and demanding reaction conditions, which seriously limit the industrial-scale promotion and application of 5-ALA and its related derivatives. With the development of synthetic biology technology, microbial synthesis has gradually become a research hotspot for 5-ALA production due to its advantages such as environmental friendliness, mild conditions, and controllable costs.

[0004] Corynebacterium glutamicum, as an important industrial microorganism, has been widely used in the synthesis of various bio-based products. Current 5-ALA biosynthesis technology based on Corynebacterium glutamicum mainly achieves yield increases through strategies such as directed evolution of 5-ALA synthase, perturbation of side pathways or downstream pathways, and dynamic regulation of key gene expression. However, research on the regulation of 5-ALA synthesis pathway-specific transcription factors remains lacking.

[0005] Transcription factors (TFs) are a class of protein molecules that bind to cis-acting elements on DNA, thereby regulating gene transcription. They can simultaneously affect the expression of multiple or even hundreds of genes at the transcriptional level, making them a key component of microbial gene expression regulation. Existing literature reports global transcription factor genes. arsXThe ArsX protein, encoding a transcriptional repressor of arsenic / metal sensing, binds to the operator sequence of its own operon (ars operon) promoter region in the absence of metals (especially As(III)), blocking the binding of RNA polymerase to the promoter and thus inhibiting the transcription of downstream arsenic resistance genes. When trace amounts of As(III) are present intracellularly, As(III) coordinates with conserved cysteine ​​residues near the N-terminal DNA-binding domain of the ArsX protein, inducing a conformational change in the protein and its dissociation from the DNA. This releases the repression of the operon, allowing for rapid synthesis of the resistance protein to ensure cell survival under arsenic stress. Currently, arsX Gene regulation has been successfully applied to research on heavy metal detoxification and tolerance in Corynebacterium glutamicum, but there is still no research on the inhibition of Corynebacterium glutamicum. arsX Reports on gene expression for the synthesis of 5-ALA. Summary of the Invention

[0006] This invention provides a method for inhibiting the engineered bacteria Corynebacterium glutamicum Cgh3. arsX A method for producing 5-aminolevulinic acid through gene expression utilizes the CRISPRi technology to specifically inhibit the production of glutamate-producing Corynebacterium glutamicum Cgh3. arsX Gene expression enhances 5-ALA production, providing a new technological pathway for the industrial biosynthesis of 5-ALA.

[0007] This invention relates to a method for inhibiting Corynebacterium glutamicum. arsX A method for producing 5-ALA through gene expression includes the following steps:

[0008] S1: Constructing inhibition arsX Vectors for gene expression; S2: The vector obtained in step S1 is introduced into the Corynebacterium glutamicum host to obtain inhibition. arsX Engineered strains that express genes; S3: Ferment the engineered strain obtained in step S2 to obtain 5-ALA; The arsX The gene is a global transcriptional regulatory factor gene derived from Corynebacterium glutamicum, and its nucleotide sequence is shown in SEQ ID NO.1; The *Corynebacterium glutamicum* strain mentioned is the engineered strain *Corynebacterium glutamicum* Cgh3, which has undergone gene knockout and strong promoter-mediated overexpression of key genes. ldhA、pta、ackA Genes that block carbon metabolic flux loss through parametrogenic pathways, via P sod-sx Strong promoter drives key genes in 5-ALA synthesis hemA C132A Multi-site integrated expression lays the foundation for efficient 5-ALA synthesis; its genotype is... Corynebacterium glutamicum ATCC13032Δ ldhA Δ pqo ::P sod- sx hemA C132A Δ cat ::P sod-sx hemA C132A Δ pta Δ ack AP sod pyc P sod ppc Δ ace A::P sod -sx hemA C132A P sod tal P sod tkt P tuf araE (Δ21bp) ackA - pta ::P sod xylAB :(C131T) NCgl 2538:(C311T).

[0009] Further, the vector mentioned in step S1 is specifically the pCRISPRi-high-ArsX plasmid; the construction method includes the following steps: Design Targets arsX The sgRNA of the gene was used as a vector. Based on the 20 bp binding sequence of this sgRNA, upstream and downstream primers h-ArsX-F and h-ArsX-R were designed. Insert fragment 1 was obtained by PCR amplification. Using pdCas9gRNA as the vector backbone, insert fragment 1 was ligated to the pdCas9gRNA backbone using BsaI restriction endonuclease and T4 DNA ligase via the Golden Gate ligation method. The ligation product was then transformed into *E. coli* DH5α competent cells. Positive transformants were verified by colony PCR, and the pCRISPRi-high-ArsX plasmid was obtained after sequencing confirmation. The nucleotide sequence of h-ArsX-F is shown in SEQ ID NO.2; The nucleotide sequence of h-ArsX-R is shown in SEQ ID NO.3.

[0010] Further, the vector introduced into the Corynebacterium glutamicum host in step S2 includes the following steps: The pCRISPRi-high-ArsX plasmid constructed in step S1 was introduced into *Corynebacterium glutamicum* Cgh3 competent cells via electroporation. After resuscitation, the transformation solution was obtained. The transformation solution was plated on BHIS solid plates containing chloramphenicol (final concentration 10 μg / mL) and incubated at 30°C for 18–24 h. Single colonies were picked from the plates and colony PCR was performed using primer pair CRISPRi-test-f / CRISPRi-test-r to screen for the engineered strain Cgh3-h-ArsX with suppressed arsX gene expression. The nucleotide sequences of the primer pair CRISPRi-test-f and CRISPRi-test-r are shown in SEQ ID NO.4 and SEQ ID NO.5, respectively.

[0011] Furthermore, the fermentation culture described in step S3 includes seed culture and master fermentation culture; Furthermore, the seed culture specifically involves activating the engineered strain Cgh3-h-ArsX obtained in step S2 by streaking it onto BHIS solid medium and culturing it at 28-32°C until colonies grow; picking a single colony and inoculating it into BHIS liquid medium, and culturing it at 28-32°C with shaking at 200-250 rpm to obtain a primary seed culture; transferring the primary seed culture to CGIII liquid medium and culturing it at 28-32°C with shaking at 200-250 rpm to obtain a secondary seed culture. The primary fermentation culture specifically involves using the secondary seed culture at an initial OD value. 600 =0.4~0.6 Transfer to fresh CGIII liquid medium containing 10 g / L glucose, and incubate at 28~32℃ with shaking at 200~250 rpm until the bacterial OD... 600 When the pH reaches 4.0~6.0, add glycine at a final concentration of 5~10 g / L as a precursor, and continue shaking culture for 60~84 h to obtain 5-ALA; Furthermore, in the above-mentioned main fermentation culture, the initial concentration of glucose is 10 g / L, the final concentration of glycine is 5-10 g / L, and the shaking culture time is 72 h; Furthermore, the final concentration of glycine mentioned above is 7.5 g / L.

[0012] On the other hand, the present invention provides a recombinant plasmid pCRISPRi-high-ArsX for inhibiting the expression of the arsX gene in Corynebacterium glutamicum. The recombinant plasmid pCRISPRi-high-ArsX uses pdCas9gRNA as a vector backbone and inserts an sgRNA expression cassette targeting the arsX gene of Corynebacterium glutamicum. The nucleotide sequence of the arsX gene is shown in SEQ ID NO.1. The plasmid is 11132 bp in size and contains cas9 (D10A, H840A mutants), sgRNA expression elements, ori pBL1 Corynebacterium glutamicum replicon, ori pUC Escherichia coli replicon, chloramphenicol resistance gene, pTac promoter, lacIq repressor gene, and RBS2 ribosome binding site.

[0013] On another front, this invention provides a Corynebacterium glutamicum engineered strain Cgh3-h-ArsX for efficient synthesis of 5-ALA, obtained by transforming Corynebacterium glutamicum Cgh3 with the aforementioned recombinant plasmid pCRISPRi-high-ArsX. The genotype of Cgh3 is: Corynebacterium glutamicum ATCC 13032 ΔldhA Δpqo::Psod-sxhemAC132A Δcat::Psod-sx hemAC132A Δpta ΔackA Psod pyc Psod ppc ΔaceA::Psod-sx hemAC132A Psod tal Psod tkt Ptuf araE (Δ21bp) ackA-pta::Psod xylAB:(C131T)NCgl2538:(C311T). This strain can specifically inhibit the expression of the arsX gene after 72 hours of shake-flask fermentation. The yield of 5-ALA was ≥3.32 g / L.

[0014] In another aspect, the present invention provides an application of the engineered strain of Corynebacterium glutamicum Cgh3-h-ArsX in the biosynthesis of 5-ALA.

[0015] Compared with the prior art, the present invention has the following beneficial effects: This invention is the first to include global transcription factor genes. arsX The inhibitor was applied to the synthesis of Corynebacterium glutamicum 5-ALA, and a specific inhibitor was constructed using the CRISPRi technology. arsXThe engineered strain Cgh3-h-ArsX, which expresses the gene, showed that after 72 h of shake-flask fermentation, the yield of 5-ALA reached 3.32 g / L, which was about 1.91 times higher than that of the control strain Cgh3-pXi, significantly improving the synthesis efficiency of 5-ALA. Attached Figure Description

[0016] Figure 1 shows the pCRISPRi-high-ArsX plasmid map; Figure 2 shows the genes of global transcriptional regulatory factors in Corynebacterium glutamicum. arsX The graph shows the 5-ALA yield after inhibition of expression under shake-flask conditions. The horizontal axis represents the strain type (control strain Cgh3-pXi and engineered strain Cgh3-h-ArsX), and the vertical axis represents the 5-ALA yield. Detailed Implementation

[0017] The present invention will be further described in detail below with reference to specific embodiments. The following embodiments are intended to help those skilled in the art understand the present invention, but do not constitute any limitation on the present invention.

[0018] The engineered bacteria construction and gene regulation technology of this invention is a further innovation and application based on existing patented technologies. The following are the existing technology sources for the non-core technologies and related materials involved in this invention, so that those skilled in the art can fully understand and repeatedly implement the technical solutions of this invention: The starting strain used in this invention is Corynebacterium glutamicum ( Corynebacterium glutamicum ATCC13032, purchased from ATCC (The Global Bioresource Center) in October 2012.

[0019] The engineered strain Corynebacterium glutamicum Cgh3 is a high-yielding chassis strain constructed from the starting strain ATCC 13032 through multiple rounds of gene editing (including key gene integration, strong promoter-mediated expression, and traceless manipulation). The construction process is described in Reference 1, where strain A3 is the engineered strain Corynebacterium glutamicum Cgh3 of this invention.

[0020] The core vectors, promoters, functional genes, and manipulation techniques used in its construction are all based on publicly available literature, as detailed below: The integration vector pD- of the engineered bacteria Corynebacterium glutamicum Cgh3 involved in this invention aceA :: hemA C132A pD- catA :: hemA C132A pD- pqo :: hemA C132A For details on the construction method and primers used, please refer to the patent "Engineering strain of Corynebacterium glutamicum producing 5-aminolevulinic acid and construction method" (application number: CN202410677943.1). strong promoter P sod-sx For details on the construction method, please refer to the published patent "A High-Strength Promoter P of Corynebacterium Glutamate". sod-sx "And its application" (Patent No.: CN202010351748.1); hemA C132A For details on the gene construction method, please refer to the authorized patent "5-Aminolevulinic acid synthase mutant of Rhodopseudomonas palustris and its application" (application number: CN202210142094.0). Scarless manipulation techniques and tools for Corynebacterium glutamicum pD- sacB The construction method can be referred to the authorized patent (application number: CN201710215459.7, invention title: Corynebacterium glutamicum strain with high chiral D-(-)-acetoin production, construction and application). The preparation process of the pdCas9gRNA vector can be found in reference 2.

[0021] The 5-aminolevulinate standard used in this invention was purchased from Sigma-Aldrich; molecular biology reagents such as restriction endonucleases and DNA ligases were purchased from Thermo Fisher Scientific; other biochemical reagents were purchased from Sangon Biotech (Shanghai) Co., Ltd.; Escherichia coli DH5α competent cells were prepared by the conventional CaCl2 method, and the preparation method was in accordance with the method in the standard laboratory manual "Molecular Cloning: A Laboratory Manual".

[0022] The culture medium used in this invention is composed and prepared as follows: LB liquid medium consists of 5 g / L yeast extract, 10 g / L tryptone, and 10 g / L NaCl; LB solid medium is supplemented with 2% agar powder; the antibiotic concentration used is chloramphenicol 10 μg / mL; BHIS liquid medium contains 74 g / L brain and heart broth powder, 91 g / L sorbitol, and is brought to a final volume of 1 L with deionized water, and autoclaved at 121°C for 20 min. BHIS solid medium is prepared by adding 2% agar powder to the above liquid medium; CGIII medium contains 10 g / L yeast extract, 10 g / L tryptone, 21 g / L MOPS (3-morpholinopropanesulfonic acid), and 2.5 g / L NaCl, and the pH is adjusted to 7 with 5 M NaOH aqueous solution. Resistance medium: After sterilizing the above BHIS solid medium and cooling it to about 55°C, add chloramphenicol solution that has been sterilized by a 0.22μm filter membrane to make the final concentration of chloramphenicol 10 μg / mL. Shake well and pour the mixture into plates quickly. After cooling, it is ready for use.

[0023] The terminology of this invention is explained as follows: CRISPRi technology, or CRISPR Interference, is a transcriptional repression technology based on the modified CRISPR-Cas9 system. It works by having the nuclease-free dCas9 protein form a complex with the target sgRNA, binding to the promoter or coding region of the target gene and blocking RNA polymerase binding. This specifically silences the target gene expression without cleaving DNA. In this patent, it is used to inhibit Corynebacterium glutamicum. arsX Gene.

[0024] sgRNA, or guide RNA, is an artificially designed single-stranded RNA molecule containing a binding sequence complementary to the target gene and a backbone sequence for binding to the Cas9 protein. It guides the dCas9 protein to precisely target and bind to the target gene. In this patent, the target... arsX The sgRNA of the gene is a 20 bp binding sequence and is the core component of CRISPRi technology.

[0025] Traceless operation technology: a gene knockout / insertion technology in microbial genetic engineering that leaves no resistance markers and no foreign DNA residues. The modified strain genome retains only the target mutation and no additional screening marker genes, which can avoid the influence of marker genes on the strain's metabolism. In this patent, it is used to construct the engineered strain Corynebacterium glutamicum Cgh3.

[0026] Golden Gate Ligation Method: A one-step enzyme digestion-ligation seamless cloning technology that utilizes restriction endonucleases with misaligned digestion characteristics (such as BsaI in this patent) to generate complementary sticky ends between the insert fragment and the vector backbone. Enzyme digestion and ligation are completed simultaneously in the same reaction system without the need to purify the digestion product. The ligation product has no excess base residue. In this patent, it is used to construct the pCRISPRi-high-ArsX recombinant plasmid.

[0027] Example 1 1. Construction of pCRISPRi-high-ArsX plasmid Design Targets arsX The sgRNA of the gene was used to design upstream and downstream primers h-ArsX-F (SEQ ID NO.2) and h-ArsX-R (SEQ ID NO.3) based on its 20 bp binding sequence for PCR amplification to obtain insert fragment 1. The PCR amplification system consisted of 5 μL each of upstream and downstream primers and 90 μL of sterile double-distilled water, for a total volume of 100 μL. The reaction conditions were: incubation at 95℃ for 5 min, followed by cooling to 4℃ at a rate of 0.1℃ / s.

[0028] Using pdCas9gRNA as the vector backbone, insert fragment 1 was ligated to the vector backbone using the Golden Gate ligation method. The Golden Gate ligation system consisted of: 1 μL insert fragment, 1 μL pdCas9gRNA backbone, 1 μL T4 ligase buffer, 1 μL T4 DNA ligase, 1 μL BsaI restriction enzyme, 2.5 μL rcut smart, and 17.5 μL sterile double-distilled water, for a total volume of 20 μL. The reaction program was as follows: 37℃ for 10 min, 16℃ for 10 min, 10 cycles, followed by 50℃ for 5 min and 65℃ for 20 min. After the reaction, the sample was stored at 4℃.

[0029] The ligation product was transformed into *E. coli* DH5α competent cells and plated on LB agar plates containing chloramphenicol (10 μg / mL). The cells were incubated at 37°C for 12–16 h. Single colonies were picked and colony PCR was performed using primer pairs CRISPRi-test-f (SEQ ID NO.4) / CRISPRi-test-r (SEQ ID NO.5) for verification. The PCR amplification system consisted of 2 μL template, 2 μL each of forward and reverse primers, 1 μL dNTP, 25 μL phanta buffer, 17 μL sterile double-distilled water, and 1 μL DNA polymerase, for a total volume of 50 μL. The reaction conditions were: 95°C pre-denaturation for 3 min, 30 cycles (95°C denaturation for 20 s, 58°C annealing for 20 s, 72°C extension for 1 min), and a final extension at 72°C for 10 min. The cells were then stored at 4°C. Transformants that tested positive by PCR were sequenced. The plasmid carried by the correctly sequenced strain was the pCRISPRi-high-ArsX plasmid, as shown in Figure 1. This plasmid is 11132 bp in size and contains key elements such as cas9 (D10A, H840A mutants), sgRNA expression elements, ori pBL1, ori puc replicon, and chloramphenicol resistance gene, ensuring stable replication in Corynebacterium glutamicum and specific inhibition of the arsX gene.

[0030] The above arsX The nucleotide sequence of the gene (SEQ ID NO.1) is as follows: atgaaatcagttttgtttgtgtgcgtcggtaatggcggaaaatcacagatggcggcggcgctggcacagaagtatgcatcagattcagtagagatcc attctgctggaaccaagcctgcacaggggctaaaccaattgtctgtggaatccatcgctgaggtgggcgctgatatgtcgcaaggaattcccaaagcg atcgatccggagctgctgcgcactgtcgatcgtgtggttattttgggcgatgacgcacaggtagatatgcctgaatctgcacagggcgctcttgagc gttggtcaattgaggaaccggatgctcaaggtatggaacgtatgcgtattgtgcgggatcagatcgataaccgagtccaagctttgctagcgggataa The primer sequences used for constructing the above strains are shown in Table 1: Table 1: Primer sequences used for strain construction

[0031] 2. Construction of 5-ALA Synthetic Strains Strain construction: The pCRISPRi-high-ArsX plasmid and the empty vector pdCas9gRNA were electroporated into Corynebacterium glutamicum Cgh3. The transformation solution was evenly spread on BHIS-resistant solid plates containing chloramphenicol (final concentration 10 μg / mL) and incubated at 30℃ for 18-24 h. Single colonies growing on the plates were picked and colony PCR was performed using primer pair CRISPRi-test-f / CRISPRi-test-r to screen for engineered strain Cgh3-h-ArsX (inhibiting arsX gene expression) and control strain Cgh3-pXi (empty vector control) that could grow on chloramphenicol-resistant medium and were PCR-positive.

[0032] 3. Shake-flask fermentation Cgh3-pXi and Cgh3-h-ArsX strains were streaked onto BHIS solid medium and cultured at 30°C for 18 h. Single colonies were picked for colony PCR verification. Verified strains were inoculated into 5 mL of BHIS liquid medium and cultured at 30°C and 220 rpm for 12 h. 1 mL of seed culture was transferred to 50 mL of CGIII liquid medium (500 mL Erlenmeyer flask) and cultured at 30°C and 220 rpm for 12 h. The initial OD was used as the starting point for PCR analysis. 600 =0.5 Transfer to fresh CGIII liquid medium (50 mL / 500 mL Erlenmeyer flask) containing 10 g / L glucose, and incubate at 30°C with shaking at 220 rpm for 4 h until OD reaches 0.5. 600When the concentration reached approximately 5.0, glycine was added to a final concentration of 7.5 g / L, and the mixture was cultured for another 72 h. During this period, samples were taken periodically to detect the 5-ALA yield. The detection method for 5-ALA was as follows: 250 μL of 5-ALA standard solution (final concentrations of 1, 2, 4, 6, or 8 mg / L) or diluted fermentation broth or the reaction solution after enzyme activity assay was completed was added to 125 μL of sodium acetate buffer (pH=4.6), followed by 62.5 μL of acetylacetone. The mixture was incubated in a 100℃ metal bath for 15 min, cooled to room temperature, and then 440 μL of freshly prepared Modified Ehrlich's reagent (0.2 g p-dimethylaminobenzaldehyde, 1 mL glacial acetic acid, 1 mL perchloric acid, and glacial acetic acid to a final volume of 10 mL) was added. The mixture was stirred and reacted at room temperature for 20 min. The absorbance of the reaction solution at 554 nm was then measured. The 5-ALA content in the fermentation broth or the reaction solution after the enzyme activity assay is terminated is calculated using the standard curve obtained from the determination of 5-ALA standards.

[0033] The fermentation results are shown in Figure 2. After 72 h of cultivation, the 5-ALA yield of the control strain Cgh3-pXi was 1.74 g / L, while the 5-ALA yield of the engineered strain Cgh3-h-ArsX reached 3.32 g / L, an increase of approximately 1.91 times compared to the control strain, demonstrating the inhibition of... arsX Gene expression can significantly enhance the ability of Corynebacterium glutamicum to synthesize 5-ALA.

[0034] References 1.Zheng, Y., Wang, Z., Li, J., Geng, Z., Chen, T.,&Wang, Z. (2025). Construction of a genome-engineered stable 5-aminolevulinic acid producingCorynebacterium glutamicum by increasing succinyl-CoA supply. Synthetic andSystems Biotechnology, 10 (4):1070–1076. 2.Liu J .,Liu M .,Shi T .,Sun G .,Gao N .,Zhao X .,Guo X .,Ni X .,Yuan Q .,Feng J .,Liu Z.,Guo Y .,Chen J .,Wang Y .,Zheng P.,Sun J .CRISPR-assisted rationalflux-tuningand arrayed CRISPRi screeningof an L-prolineexporterfor L-proline hyperproduction.Nat Commun2022; 13 (1):891.

Claims

1. A method that inhibits Corynebacterium glutamicum arsX A method for producing 5-aminolevulinic acid by gene expression, characterized in that, Includes the following steps: S1: Constructing inhibition arsX Vectors for gene expression; S2: The vector obtained in step S1 is introduced into the Corynebacterium glutamicum host to obtain inhibition. arsX Engineered strains that express genes; S3: The engineered strain obtained in step S2 is fermented to synthesize 5-ALA; The arsX The gene is a global transcriptional regulatory factor gene derived from Corynebacterium glutamicum, and its nucleotide sequence is shown in SEQ ID NO.1; The host of Corynebacterium glutamicum is the engineered strain Cgh3, with the genotype being... Corynebacterium glutamicum ATCC13032Δ ldhA Δ pqo ::P sod-sx hemA C132A Δ cat ::P sod-sx hemA C132A Δ pta Δ ack AP sod pyc P sod PPC Δ ace A::P sod -sx hemA C132A P sod tal P sod tkt P tuf araE (Δ21bp) ackA - pta ::P sod xylAB :(C131T) NCgl 2538:(C311T).

2. The method according to claim 1, characterized in that, The vector mentioned in step S1 is the pCRISPRi-high-ArsX plasmid; the construction method includes the following steps: designing a target arsX The sgRNA of the gene was used as the base for the design of upstream and downstream primers h-ArsX-F and h-ArsX-R based on the 20 bp binding sequence of the sgRNA. Insert fragment 1 was obtained by PCR amplification. Using pdCas9gRNA as the vector backbone, insert fragment 1 was ligated to the pdCas9gRNA backbone using BsaI restriction endonuclease and T4 DNA ligase via the Goldengate ligation method. The ligation product was transformed into E. coli DH5α competent cells, and the pCRISPRi-high-ArsX plasmid was obtained after colony PCR verification and sequencing confirmation.

3. The method according to claim 2, characterized in that, The nucleotide sequence of h-ArsX-F is shown in SEQ ID NO.2, and the nucleotide sequence of h-ArsX-R is shown in SEQ ID NO.

3.

4. The method according to claim 1, characterized in that, The method for introducing the vector into the host of Corynebacterium glutamicum in step S2 is electroporation, specifically including: electroporating the pCRISPRi-high-ArsX plasmid into competent Corynebacterium glutamicum Cgh3 cells, obtaining the transformation solution after resuscitation, spreading the transformation solution on BHIS solid plates supplemented with chloramphenicol, incubating at 30℃ for 18-24 h, picking single colonies and performing colony PCR verification using primer pair CRISPRi-test-f / CRISPRi-test-r, and screening to obtain the engineered strain Cgh3-h-ArsX.

5. The method according to claim 4, characterized in that, The final concentration of chloramphenicol in the BHIS solid plate is 10 μg / mL; the nucleotide sequence of CRISPRi-test-f is shown in SEQ ID NO.4, and the nucleotide sequence of CRISPRi-test-r is shown in SEQ ID NO.

5.

6. The method according to claim 1, characterized in that, The fermentation culture described in step S3 includes seed culture and master fermentation culture.

7. The method according to claim 6, characterized in that, The seed culture was carried out by streaking the engineered strain Cgh3-h-ArsX on BHIS solid medium to activate it, culturing it at 28-32℃ until colonies grew, picking a single colony and inoculating it into BHIS liquid medium, and culturing it at 28-32℃ and 200-250 rpm to obtain a primary seed culture. The primary seed culture was then transferred to CGIII liquid medium and cultured under the same conditions to obtain a secondary seed culture.

8. The method according to claim 6, characterized in that, The fermentation master culture involves introducing the secondary seed culture at an initial OD... 600 =0.4~0.6 Transfer to fresh CGIII liquid medium containing glucose, and incubate at 28~32℃ with shaking at 200~250 rpm until the bacterial OD... 600 When the pH reaches 4.0-6.0, add glycine as a precursor and continue shaking culture for 60-84 hours.

9. The method according to claim 8, characterized in that, The initial concentration of glucose is 10 g / L, the final concentration of glycine is 5-10 g / L, and the shaking culture time is 72 h.

10. The method according to claim 9, characterized in that, The final concentration of glycine is 7.5 g / L.

11. A method for inhibiting Corynebacterium glutamicum. arsX The recombinant plasmid pCRISPRi-high-ArsX for gene expression is characterized by, Using pdCas9gRNA as a vector backbone, it was inserted to target Corynebacterium glutamicum. arsX The sgRNA expression cassette of the gene, arsX The nucleotide sequence of the gene is shown in SEQ ID NO.1; the plasmid is 11132 bp in size and contains cas9 (D10A, H840A mutants), sgRNA expression elements, ori pBL1 Corynebacterium glutamicum replicon, ori pUC Escherichia coli replicon, chloramphenicol resistance gene, pTac promoter, lacIq Repressor genes and RBS2 ribosome binding sites.

12. A Corynebacterium glutamicum engineered strain Cgh3-h-ArsX for efficient synthesis of 5-ALA, characterized in that, Obtained by transformation of Corynebacterium glutamicum Cgh3 with the recombinant plasmid pCRISPRi-high-ArsX as described in claim 11, wherein the genotype of Cgh3 is [not specified]. Corynebacterium glutamicum ATCC13032Δ ldhA Δ pqo ::P sod- sx hemA C132A Δ cat ::P sod-sx hemA C132A Δ pta Δ ack AP sod pyc P sod PPC Δ ace A::P sod -sx hemA C132A P sod tal P sod tkt P tuf araE (Δ21bp) ackA - pta ::P sod xylAB :(C131T) NCgl 2538:(C311T); This strain can specifically inhibit arsX Gene expression and 5-ALA yield ≥3.32g / L after 72h shake-flask fermentation.

13. The application of the engineered strain of Corynebacterium glutamicum Cgh3-h-ArsX according to claim 12 in the biosynthesis of 5-ALA.

Citation Information

Patent Citations

  • Corynebacterium glutamicum strain for high-yield production of chiral D-(-)-acetoin as well as construction method and application of strain

    CN106868033A

  • Corynebacterium glutamicum high-strength promoter Psod-sx and application thereof

    CN111549027A

  • Mutant of 5-aminolevulinic acid synthase in Rhodopseudomonas swamp and its application

    CN114181921B

  • Corynebacterium glutamicum engineering bacterium for producing 5-aminolevulinic acid and construction method

    CN118652920A