Method for improving polysaccharide dissolution of sea cucumber by co-culturing paecilomyces hepiali with sea cucumber and application thereof
Patent Information
- Application Number
- CN202610807701.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-06-05
- Publication Date
- 2026-08-21
AI Technical Summary
同时多糖分子大小不等,大多与蛋白或者皂苷元等由连接键,结构越复杂,溶解性越小,营养吸收率低,不利于海参多糖成分的健康功能发挥
[0024]保藏菌种归类于粉质虫草,拉丁名为Cordyceps farinosa,命名为Cordycepsfarinosa BFE-1,保藏单位为中国微生物菌种保藏管理委员会普通微生物中心,保藏地址:中国北京,保藏日期2025年12月29日,保藏号为CGMCC No.42492。
Smart Images

Figure CN122609662A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of microbial fermentation technology, and in particular to a method and its application for improving the dissolution of polysaccharides from sea cucumbers by co-culturing Paecilomyces hepiali with sea cucumbers. Background Technology
[0002] Cordyceps sinensis refers to the dried complex of the stroma of Cordyceps sinensis (Ber K.) Sacc., a fungus belonging to the Clavicipitaceae family, which parasitizes the larvae of insects belonging to the Hepialidae family, along with the larval corpse. It possesses functions of tonifying the kidneys and lungs, stopping bleeding, and resolving phlegm. It is used for conditions such as lower back and knee pain, kidney deficiency and spermatorrhea, and chronic cough and asthma. It is a precious traditional Chinese medicine with nourishing properties listed in the Chinese Pharmacopoeia. Cordyceps sinensis contains various components such as adenosine, cordycepin, cordycepic acid, polysaccharides, and ergosterol, exhibiting pharmacological effects including antioxidant, anti-aging, anti-fatigue, immunomodulatory, anti-inflammatory, anti-tumor, and hepatoprotective properties. It has extremely high health and medicinal value in the fields of traditional Chinese medicine and food-medicine homology.
[0003] The fungus *Paecilomyces hepiali*, isolated from natural Cordyceps sinensis, can be used in a liquid deep fermentation process followed by drying to obtain a dried powder product. This product is an important alternative to Cordyceps sinensis in the pharmaceutical and health food market. This product contains active ingredients similar to those in Cordyceps sinensis, such as adenosine, cordycepin, organic acids, and polysaccharides. Related products, such as Bailin Capsules and Jinshuibao, have already obtained national drug approval numbers. *Paecilomyces hepiali* is also one of the permitted raw materials for health food products.
[0004] Sea cucumbers belong to the class Holothuroidea, an invertebrate marine animal of the phylum Echinodermata. They contain various active substances such as polysaccharides, saponins, proteins, and small peptides, making them a high-end product in nutritional and health foods. Sea cucumber saponins are glycosides composed of glycosyl groups and aglycones, which decompose into sea cucumber polysaccharides and aglycones. Sea cucumber polysaccharides include sea cucumber glycosaminoglycans and sea cucumber fucoidan, with sea cucumber fucoidan being a representative polysaccharide component. Sea cucumber polysaccharides have anticoagulant, antitumor, anti-aging, and osteoporosis-improving effects, offering various health benefits. However, polysaccharide molecules vary in size, and most are linked to proteins or aglycones by bonds. The more complex the structure, the lower the solubility and the lower the nutrient absorption rate, which is detrimental to the health functions of sea cucumber polysaccharide components.
[0005] Currently, there are no reports on using β-glucosidase produced by the fermentation of *Paecilomyces hepiali* to enzymatically hydrolyze sea cucumber polysaccharides to improve their solubility. Therefore, developing a method to effectively increase the solubility of sea cucumber polysaccharides has significant application value. Summary of the Invention
[0006] The technical problem to be solved by the present invention is to provide a method and its application for co-culturing *Paecilomyces hepiali* with sea cucumber to increase the dissolution of sea cucumber polysaccharides, so as to effectively increase the dissolution of sea cucumber polysaccharides.
[0007] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows.
[0008] A method for increasing the solubility of sea cucumber polysaccharides by co-culturing *Paecilomyces hepiali* with sea cucumber through fermentation includes the following steps:
[0009] (1) Seed culture and large-scale fermentation culture of *Paecilomyces hepiali* strain were carried out to obtain *Paecilomyces hepiali* fermentation broth;
[0010] (2) Add the sterilized sea cucumber raw liquid to the fermentation liquid of *Paecilomyces hepiali* obtained in step (1) and carry out co-culture fermentation to obtain co-culture fermentation liquid;
[0011] The sea cucumber raw material liquid is added after the fermentation of *Paecilomyces hepiali* has reached a stable period.
[0012] As a preferred technical solution of the present invention, the *Cordyceps farinosa* strain is *Cordyceps farinosa* BFE-1, belonging to the *Cordyceps farinosa* family. It was deposited on December 29, 2025, with accession number CGMCC No. 42492, and the depository institution is the China General Microbiological Culture Collection Center. Its main biological characteristics include: white, velvety mycelium that grows upwards and outwards; dense mycelium; and colorless base of the mycelial growth. Under a microscope, it shows branched mycelium, and the conidia are leaf-like.
[0013] As a preferred technical solution of the present invention, the culture medium for the expanded fermentation culture in step (1) comprises, by weight percentage: 1% potato extract, 1% glucose, 0.5% peptone, 0.1% silkworm pupa powder, 0.5% soybean powder, 0.02% magnesium sulfate, 0.01% zinc sulfate, 0.02% dipotassium hydrogen phosphate, and pH 6.5; the fermentation time of the expanded fermentation culture is 48h, the fermentation tank rotation speed is 150r / min, the temperature is 22℃, and the aeration rate is 1:1 (V / V).
[0014] As a preferred technical solution of the present invention, the seed culture in step (1) involves inoculating the *Paecilomyces hepiali* strain into potato dextrose broth medium and culturing it at 22°C and 150 r / min on a shaker for 40-48 h.
[0015] As a preferred technical solution of the present invention, the sea cucumber raw material liquid in step (2) is prepared by the following method: the salt-free dried sea cucumber is soaked in water at a volume ratio of 5:1, the water is changed 3 times and then drained; the soaked sea cucumber is added to water and pulverized into a slurry at a volume ratio of 2:1, and then sterilized with saturated steam at 120±5℃ for later use; the sea cucumber raw material liquid is added after the fermentation of the *Penicillium chrysogenum* fermentation liquid for 40-48 hours.
[0016] As a preferred technical solution of the present invention, the volume ratio of the sea cucumber raw material liquid to the *Paecilomyces cerevisiae* fermentation liquid in step (2) is 1:3-5; the fermentation tank for co-culture fermentation has a rotation speed of 50 r / min, a temperature of 22℃, and a co-culture time of 16 h.
[0017] As a preferred technical solution of the present invention, the following post-processing steps are also included: freeze-drying the obtained co-culture fermentation broth to obtain Cordyceps sinensis and sea cucumber co-culture product powder; the freeze-drying process is as follows: -40℃ for 5 hours, 0℃ for 20 hours, 20℃ for 16-18 hours, and the temperature difference between the material and the shelf at the end point is ≤5℃.
[0018] Cordyceps farinosa BFE-1, characterized by: its name being Cordyceps farinosa BFE-1, belonging to Cordyceps farinosa, deposited on December 29, 2025, with accession number CGMCC No. 42492, and deposited at the China General Microbiological Culture Collection Center, its main biological characteristics include: white hyphae, hairy, growing upwards and outwards, dense hyphae, colorless at the base of the mycelial mass; under a microscope, it shows branched hyphae, and the conidia are leaf-like.
[0019] A fermentation product of *Paecilomyces pilosa* co-cultured with sea cucumber was prepared by the above method.
[0020] As a preferred embodiment of the present invention, the fermented product is a freeze-dried powder.
[0021] The beneficial effects of the above technical solution are as follows: This invention addresses the technical problem of low solubility and poor absorption rate of sea cucumber polysaccharides due to their complex structure. It utilizes the characteristic of Cordyceps militaris BFE-1 (Paecilomyces hepiali) to secrete β-glucosidase during deep liquid fermentation. This enzyme decomposes the glycosidic bonds in sea cucumber polysaccharides, achieving efficient dissolution of the polysaccharides. Since adding sea cucumber raw materials to the fermentation system too early can interfere with the normal metabolism of the fungi and lead to a decrease in the content of active ingredients such as adenosine and cordycepin, this invention adopts a two-step co-cultivation process: first, the *Paecilomyces hepiali* strain BFE-1 is independently fermented and expanded until it has fully grown and accumulated β-glucosidase; then, sterilized sea cucumber raw material liquid is added for co-cultivation. Based on this concept, this invention has developed a complete co-cultivation process, the flow of which includes: activation of the original strain, inoculum culture, large-scale fermentation, addition of sea cucumber, and freeze-drying post-processing.
[0022] The freeze-dried powder of *Paecilomyces hepiali* and sea cucumber co-cultured using the above process, verified by a third-party testing institution, exhibits the following excellent bioactivity indicators: adenosine content ≥3.0 mg / g, total polysaccharide content ≥40 mg / g; the dissolution rate of sea cucumber fucoidan increased from approximately 180 mg / L before co-culture to approximately 2300 mg / L after co-culture, an increase of more than 12 times. Compared with using them individually, the co-culture product obtained by this invention simultaneously contains multiple active ingredients such as cordyceps adenosine, cordyceps polysaccharides, sea cucumber protein, and sea cucumber polysaccharides, possessing the dual nutritional characteristics of both *Cordyceps sinensis* and sea cucumber, and has broad application prospects in the fields of health foods and food-medicine homology products.
[0023] Preservation Instructions
[0024] The preserved strain is classified as Cordyceps farinosa, with the Latin name Cordyceps farinosa, and is named Cordyceps farinosa BFE-1. The depository institution is the China General Microbiological Culture Collection Center (CGMCC), located in Beijing, China. The deposit date is December 29, 2025, and the accession number is CGMCC No. 42492. Attached Figure Description
[0025] Figure 1 This is a screenshot of the strain's gene sequence aligned to Blast.
[0026] Figure 2 This is an image showing the growth appearance of BFE-1 mycelium on a plate in step c of Example 2;
[0027] Figure 3 This is a microscopic image of the BFE seed culture in the Erlenmeyer flask cultured for 40 hours in step b of Example 3;
[0028] Figure 4 This is a graph showing the enzyme activity detection results of β-glucosidase in the BFE fermentation broth;
[0029] Figure 5 This is a graph showing the content curves of sea cucumber polysaccharides and adenosine during the co-culture stage of BFE fermentation broth and sea cucumbers;
[0030] Figure 6 This is a third-party testing report comparing BFE and sea cucumber before and after fermentation co-culture - 1;
[0031] Figure 7 This is a third-party testing report comparing BFE and sea cucumber before and after fermentation co-culture - 2;
[0032] Figure 8 This is a third-party testing report comparing BFE and sea cucumber before and after fermentation co-culture - 3;
[0033] Figure 9 This is a third-party testing report comparing BFE and sea cucumber before and after fermentation co-culture - 4;
[0034] Figure 10 This is a third-party testing report comparing BFE and sea cucumber before and after fermentation co-culture - 5;
[0035] Figure 11 This is a third-party testing report comparing BFE and sea cucumber before and after fermentation co-culture - 6;
[0036] Figure 12 This is a third-party testing report comparing BFE and sea cucumber before and after fermentation co-culture - 7. Detailed Implementation
[0037] The following embodiments illustrate the present invention in detail. All raw materials and equipment used in the present invention are commercially available products and can be directly obtained through market purchase.
[0038] In the following description of embodiments, specific details such as particular system architectures and techniques are set forth for illustrative purposes and not for limitation, in order to provide a thorough understanding of the embodiments of this application. However, those skilled in the art will understand that this application may also be implemented in other embodiments without these specific details. In other instances, detailed descriptions of well-known systems, apparatuses, and methods are omitted so as not to obscure the description of this application with unnecessary detail. It should be understood that, as used in this specification and the appended claims, the term "comprising" indicates the presence of a described feature, integral, step, operation, element, and / or component, but does not exclude the presence or addition of one or more other features, integrals, steps, operations, elements, components, and / or collections thereof. It should also be understood that, as used in this specification and the appended claims, the term "and / or" refers to any combination of one or more of the associated listed items and all possible combinations, and includes such combinations.
[0039] As used in this application specification and the appended claims, the term "if" may be interpreted, depending on the context, as "when," "once," "in response to determination," or "in response to detection." Similarly, the phrase "if determined" or "if detected [the described condition or event]" may be interpreted, depending on the context, as meaning "once determined," "in response to determination," "once detected [the described condition or event]," or "in response to detection [the described condition or event]."
[0040] Furthermore, in the description of this application and the appended claims, the terms "first," "second," "third," etc., are used only to distinguish descriptions and should not be construed as indicating or implying relative importance. References to "one embodiment" or "some embodiments" in this application mean that one or more embodiments of this application include a specific feature, structure, or characteristic described in connection with that embodiment. Therefore, the phrases "in one embodiment," "in some embodiments," "in other embodiments," "in still other embodiments," etc., appearing in different parts of this specification do not necessarily refer to the same embodiment, but rather mean "one or more, but not all, embodiments," unless otherwise specifically emphasized. The terms "comprising," "including," "having," and variations thereof mean "including but not limited to," unless otherwise specifically emphasized.
[0041] This invention relates to a Cordyceps farinose strain, Cordyceps farinosa BFE-1, belonging to the Cordyceps farinosa family. The strain was deposited on December 29, 2025, with accession number CGMCC No. 42492, located in Beijing, China, at the China General Microbiological Culture Collection Center. Taxonomically, strain BFE-1 belongs to Cordyceps farinosa. Because the original classification of fungi was based on morphology and ascus development, early asexual strains screened from Cordyceps sinensis were named 'Paecilomyces hepiali' in the industry. Later, with the development of molecular biology, it should be classified as Cordyceps farinosa, but the name 'Paecilomyces hepiali' has been retained.
[0042] Example 1: Acquisition and identification of strains
[0043] 1.1 Strains Isolation
[0044] Microbial isolation: The procedure was performed in a laminar flow hood. Fresh Cordyceps sinensis collected from Tibet was selected. The outer bacterial membrane and soil layer were removed using tweezers and a sterile inoculation loop. The sample was placed in a sterile agar plate and rinsed 3-5 times with sterile water. Finally, it was transferred to a new sterile agar plate. The sample was then immersed in 75% ethanol solution for 1 minute to achieve disinfection. Subsequently, the sample was rinsed 2-3 times with sterile water to remove residual ethanol. After rinsing, the sample surface moisture was blotted dry with sterile filter paper.
[0045] Using a sterile scalpel, the sample is cut open from the mandible of the worm's head, separating it into two parts: the stroma and the worm body. The stroma and worm body are then further divided into circular tissue blocks 1-2 mm thick. These tissue blocks are then further divided: the stroma is divided into 2 pieces, and the worm body into 4 pieces. Each piece is inoculated into PDB medium, with 2-3 pieces evenly inoculated per dish, and labeled accordingly.
[0046] The PDB culture medium was purchased from Beijing Luqiao Technology Co., Ltd.
[0047] PDB medium preparation: Weigh 35.0g of ready-to-use potato dextrose broth medium, dissolve it completely in distilled water, and bring the volume to 1L. Set the pH to natural. Add 10g of agar powder, stir well, and sterilize at 121℃ for 20 minutes.
[0048] Preparation of PDB plates: Pour the dissolved PDB culture medium into sterile plates to a thickness of 4-6 mm, allow to cool and solidify naturally, and set aside.
[0049] After inoculating the plates with the stroma and insect tissue of Cordyceps sinensis, they are placed in a positive culture environment at 22-25℃, 50-75% humidity, and in the dark.
[0050] Perform 3 parallel scans for each tissue site;
[0051] After colony formation, select single colonies with clear edges and independent structures, characterized by tightly packed, white, raised mycelia with no pigment secretion on the reverse side. Use a sterile inoculation loop to pick a small amount of mycelia and transfer them to fresh PDB medium for purification. Remove any other strains of different morphologies and colors to prevent interference. After multiple purification cycles, store the obtained pure colonies at 4°C for later use.
[0052] Culture characteristics of this strain: After about one week of cultivation on PDB medium (potato dextrose broth agar), the mycelium is about 10-20 mm in diameter, the colonies are white and fluffy, the mycelium is tightly raised, and there is no pigment at the bottom of the colony.
[0053] Colony morphology on PDB medium is shown in [reference needed]. Figure 2 .
[0054] Furthermore, based on morphological identification, representative strains were screened from each morphological group and subjected to molecular biological identification to determine their phylogenetic position.
[0055] 1.2 Strain Identification
[0056] With the development of molecular biology techniques, nucleic acid sequence analysis has been widely used in fungal classification and identification. Currently, commonly used techniques include 18S rDNA, ITS (Internal Transcribed Spacer, ITS), and 18S rDNA-ITS sequence analysis.
[0057] 18S rDNA is the DNA sequence encoding the small subunit rRNA of eukaryotic ribosomal cells (18S rRNA). This sequence contains both conserved and variable regions. Conserved regions reflect phylogenetic relationships between species, while highly variable regions reflect differences between species. Because 18S rDNA is relatively conserved in its evolutionary rate, it is more suitable for classification at the species level and above in phylogenetic studies. The internal transcribed spacer (ITS), located between the 18S, 5.8S, and 28S ribosomal rDNA, can tolerate more variation during evolution, with an evolutionary rate 10 times that of 18S rDNA. It is a moderately conserved region and can be used to study taxonomic levels at the species level and below.
[0058] The invention team sent the strain samples to Sangon Biotech (Shanghai) Co., Ltd. for strain identification and issued a strain identification service report, such as... Figure 1 As shown.
[0059] 1.2.1 Materials, Reagents and Instruments
[0060] 1.2.1.1 Main Materials and Reagents
[0061]
[0062] 1.2.1.2 Main Instruments
[0063]
[0064] 1.2.2 Primer Sequences
[0065] ITS1:TCCGTAGGTGAACCTGCGG (SEQ ID NO.2)
[0066] ITS4-R:TCCTCCGCTTATTGATATGC (SEQ ID NO.3)
[0067] ITS5:GGAAGTAAAAGTCGTAACAAGG (SEQ ID NO.4)
[0068] 1.2.3 DNA Extraction
[0069] For detailed operating procedures, please refer to the Ezup Column-Based Fungal Genomic DNA Extraction Kit (B518255).
[0070] 1.2.4 DNA electrophoresis detection
[0071] DNA electrophoresis results were detected by electrophoresis (1.5% agarose, 1X TAE electrophoresis buffer, observation).
[0072] 1.2.5 PCR Amplification
[0073] 1.2.5.1 PCR reaction system
[0074]
[0075] 1.2.5.2 PCR reaction conditions
[0076]
[0077] 1.2.5.3 PCR electrophoresis
[0078] Electrophoresis was performed on a 1.5% agarose gel at 1x TAE for 20 min at 150 V and 100 mA.
[0079] 1.2.6 Experimental Results
[0080] The 18S rDNA sequence of the strain gene is shown in SEQ ID NO.1.
[0081]
[0082] This strain was identified as *Cordyceps*, specifically *Cordyceps farinosa*. Synonyms: *Paecilomyces farinosus*; *Isaria farinosa*; *Ramaria farinosa*.
[0083] After sequencing, the obtained sequence was compared with the NCBI database using BLAST. The comparison results showed that the isolated strain was Cordyceps farinose, named Cordyceps farinosa BFE-1, with a deposit date of December 29, 2025, accession number CGMCC No. 42492, deposit address: Beijing, China, depositary institution: China General Microbiological Culture Collection Center.
[0084] Example 2: Slant culture operation of bacterial strain
[0085] a. Instruments, equipment and reagents
[0086] Sterile rooms and clean benches, autoclaves, test tubes, eggplant flasks, refrigerators, constant temperature incubators, microscopes, sodium hydroxide, hydrochloric acid, sodium chloride, beef extract, peptone and agar, etc.
[0087] b. Culture medium preparation
[0088] Prepare the culture medium (PDB medium) according to the following formula: Potato extract powder 0.5%, glucose 1.5%, peptone 1.0%, sodium chloride 0.5%, agar 2%; Heat the culture medium to dissolve and stir evenly, then dispense into eggplant bottles or test tubes, put them in an autoclave for moist heat sterilization, and after cooling, prepare slant for later use.
[0089] c. Activation and scale-up of microbial strains
[0090] Using an inoculation loop under aseptic conditions, pick up a small amount of mycelial growth (approximately 1-2 mm in diameter) from the original culture slant and inoculate it onto the slant of a test tube or flask. Then, incubate at 25°C for 5 days until the mycelium has fully grown onto the culture medium. Store at 4°C for later use. The appearance of BFE-1 mycelial growth on a plate is shown in the image. Figure 2 As shown.
[0091] Example 3: Shake-flask culture of *Paecilomyces hepiali* mycelium.
[0092] a. Preparation of potato glucose broth culture medium: Prepare PDB culture medium according to the ingredient ratio, fill 100 / 500ml in shake flasks (Eragonal flasks), sterilize at 120℃ for 20min.
[0093] b. Liquid culture of mycelium: Take the BFE-1 test tube from the shake flask (Eragonal flask), use a sterile inoculation loop to pick up a rice-grain-sized mycelial growth, and inoculate it into the sterilized seed culture in the Eragonal flask. Shake at 150 rpm and 22℃ for 40-48 hours, which is the seed culture for expansion. A microscopic image of the strain after 40 hours of BFE seed culture in the Eragonal flask is shown below. Figure 3 As shown.
[0094] Example 4: Large-scale fermentation culture of *Paecilomyces hepiali*
[0095] a. Raw material preparation and sterilization: Potato extract 1%, glucose 1%, peptone 0.5%, silkworm pupa powder 0.1%, soybean flour 0.5%, magnesium sulfate 0.02%, zinc sulfate 0.01%, dipotassium hydrogen phosphate 0.02%. Adjust the pH to 6.5 before sterilization. Fill the fermentation tank to 65% capacity and sterilize with saturated steam at 120±5℃. After sterilization, wait for the material temperature to drop to 22±1℃ before use.
[0096] b. Inoculation and Fermentation: The seed culture of *Paecilomyces hepiali* BFE-1 was inoculated into sterile fermentation broth at an inoculation rate of 5%-10%. The fermenter was operated at 150 rpm, with an aeration rate of 1:1 (V / V), a temperature of 22℃, and a fermentation time of 48 h to obtain BFE-1 fermentation broth for later use. The enzyme activity detection results of β-glucosidase in the BFE fermentation broth are as follows: Figure 4 As shown.
[0097] Example 5: Co-culture and fermentation of *Paecilomyces hepiali* BFE-1 and sea cucumber raw materials
[0098] a. Soaking sea cucumbers: Select high-quality unsalted dried sea cucumbers, add purified water to soak them, with a water-to-sea cucumber ratio of 5:1. Soak for 3-5 hours each time, changing the water 3 times. Drain the water from the sea cucumbers and set aside.
[0099] b. Preparation of sea cucumber raw material liquid: Soak the sea cucumber and add water, with the ratio of water to soaked sea cucumber being 2:1. Crush the sea cucumber and process it into a slurry. Sterilize it with saturated steam at 120±5℃. After sterilization, store it in a flow tank for later use.
[0100] c. Add the prepared sea cucumber liquid to the BFE-1 fermentation stock solution at a ratio of 1:3-5 (V / V). Adjust the fermentation tank speed to 50 r / min, the temperature to 22℃, and co-culture for 16 hours to obtain the co-culture fermentation solution of BFE-1 and sea cucumber.
[0101] d. Freeze-drying of co-culture broth of Cordyceps militaris and sea cucumber: The fermentation broth is placed in a freeze dryer under sterile conditions. The freeze-drying process is as follows: -40℃ for 5 hours, 0℃ for 20 hours, and 20℃ for 16-18 hours. At the end point, the temperature difference between the material and the shelf is ≤5℃. The freeze-dried material is then pulverized, placed in a food bag, and sealed to obtain the co-culture product powder of Cordyceps sinensis and sea cucumber.
[0102] e. Detection methods for sea cucumber polysaccharides:
[0103] e-1, Fucose series standard working solutions derived
[0104] Accurately transfer 00 μL of fucose standard working solution (5.24) with concentrations of 0.10 mmol / L, 0.5 mmol / L, 0.50 mmol / L, 0.75 mmol / L, 1.00 mmol / L, and 1.25 mmol / L into six 10 mL stoppered test tubes. Add 50 μL of 2 mmol / L lactose solution (5.25), 450 μL of 0.5 mol / L 1-phenyl-3-methyl-5-pyrazolone-methanol solution (5.22), and 450 μL of 0.3 mol / L sodium hydroxide solution (5.20), respectively. Vortex mix thoroughly to prepare a series of fucose standard solution derivatives. Plot a standard working curve with the ratio of the peak area of the fucose derivative to the peak area of the lactose derivative as the ordinate and the corresponding fucose concentration as the abscissa.
[0105] e-2, Chromatographic acquisition conditions
[0106] Column: XDB-C18, 5μm, 250mm × 4.6mm (inner diameter).
[0107] Column temperature: 25℃.
[0108] Detection wavelength: 254nm.
[0109] Injection volume: 20uL.
[0110] Flow rate: 1.0 mL / min.
[0111] Mobile phase: A: phosphate-acetonitrile solution 1, B: phosphate-acetonitrile solution 2; gradient elution program is shown in the table below.
[0112] Table 1. Gradient elution program for mobile phase
[0113]
[0114] e-3, Chromatographic analysis
[0115] Inject 20 μL of fucose series standard derivatization solution and sample derivatization solution into a high-performance liquid chromatograph (HPLC), respectively, and analyze under the specified chromatographic conditions. Record the peak areas. The response values of the fucose derivatives in the sample solution should all be within the range of the standard curve. Qualitative analysis is based on the retention time of the standards, and quantification is performed using the internal standard method.
[0116] e-4, Calculation Formula
[0117] The content of sea cucumber polysaccharides in the sample was calculated using the following formula.
[0118] X=(C×164×5×10) / (A×1000)×20
[0119] In the formula: X is the content of sea cucumber polysaccharide in the sample, in milligrams per gram or milligrams per milliliter (mg / g or mg / mL); C is the concentration of fucose in the sample solution calculated from the standard curve, in millimoles per liter (mmol / L); 164 is the molar mass of fucose, in grams per mole (g / mol); 20 is the mass conversion coefficient between fucose and sea cucumber polysaccharide in sea cucumber. The calculation result is retained to 3 significant figures.
[0120] Table 2. High-performance liquid chromatography analysis data of fucose standard solution
[0121]
[0122] The content curves of sea cucumber polysaccharides and adenosine during the co-culture stage of BFE fermentation broth and sea cucumber are shown in the figure below. Figure 5 As shown in the third-party testing report comparing BFE and sea cucumber before and after fermentation co-culture, etc. Figure 6-12 As shown, the detection results of sea cucumber polysaccharides in the co-culture broth of *Paecilomyces hepiali* and sea cucumber and its raw material broth are as follows:
[0123] Table 3. Detection results of adenosine, total polysaccharide, and sea cucumber polysaccharide content in different batches of co-culture fermented products of *Paecilomyces hepiali* BFE-1 and sea cucumber.
[0124]
[0125] This invention addresses the technical problem of low solubility and poor absorption rate of sea cucumber polysaccharides due to their complex structure. It utilizes the characteristic of Cordyceps militaris BFE-1 (Paecilomyces hepiali) to secrete β-glucosidase during deep liquid fermentation. This enzyme breaks down the glycosidic bonds in sea cucumber polysaccharides, achieving efficient dissolution. Since adding sea cucumber raw materials too early to the fermentation system can interfere with the normal metabolism of the fungi, leading to a decrease in the content of active ingredients such as adenosine and cordycepin, this invention adopts a two-step co-cultivation process: first, the *Paecilomyces hepiali* strain BFE-1 is independently fermented and expanded until it has fully grown and accumulated β-glucosidase, then sterilized sea cucumber raw material liquid is added for co-cultivation. Based on this concept, this invention has developed a complete co-cultivation process, the flow of which includes: activation of the original strain, inoculum culture, large-scale fermentation, addition of sea cucumber, and freeze-drying post-processing.
[0126] The freeze-dried powder of *Paecilomyces hepiali* and sea cucumber co-cultured using the above process, verified by a third-party testing institution, exhibits the following excellent bioactivity indicators: adenosine content ≥3.0 mg / g, total polysaccharide content ≥40 mg / g; the dissolution rate of sea cucumber fucoidan increased from approximately 180 mg / L before co-culture to approximately 2300 mg / L after co-culture, an increase of more than 12 times. Compared with using them individually, the co-culture product obtained by this invention simultaneously contains multiple active ingredients such as cordyceps adenosine, cordyceps polysaccharides, sea cucumber protein, and sea cucumber polysaccharides, possessing the dual nutritional characteristics of both *Cordyceps sinensis* and sea cucumber, and has broad application prospects in the fields of health foods and food-medicine homology products.
[0127] In the above embodiments, the descriptions of each embodiment have different focuses. For parts that are not described in detail or recorded in a certain embodiment, please refer to the relevant descriptions of other embodiments.
[0128] The above-described embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention, and should all be included within the protection scope of the present invention.
Claims
1. A method for increasing the solubility of sea cucumber polysaccharides by co-culturing *Paecilomyces hepiali* with sea cucumber through fermentation, characterized in that... Includes the following steps: (1) Seed culture and large-scale fermentation culture of *Paecilomyces hepiali* strain were carried out to obtain *Paecilomyces hepiali* fermentation broth; (2) Add the sterilized sea cucumber raw liquid to the fermentation liquid of *Paecilomyces cerevisiae* obtained in step (1) and carry out co-culture fermentation to obtain co-culture fermentation liquid; The sea cucumber raw material liquid is added after the fermentation of *Paecilomyces hepiali* has reached a stable period.
2. The method according to claim 1, characterized in that, The described *Cordyceps farinosa* strain is *Cordyceps farinosa* BFE-1, belonging to the *Cordyceps farinosa* family. It was deposited on December 29, 2025, with accession number CGMCC No. 42492, and the depository institution is the China General Microbiological Culture Collection Center. Its main biological characteristics include: white, velvety mycelium that grows upwards and outwards; dense mycelium; and a colorless base to the mycelial growth. Under a microscope, it shows branched mycelium, and the conidia are leaf-like.
3. The method according to claim 1, characterized in that, The culture medium for the expanded fermentation culture in step (1) comprises, by weight percentage: 1% potato extract, 1% glucose, 0.5% peptone, 0.1% silkworm pupa powder, 0.5% soybean powder, 0.02% magnesium sulfate, 0.01% zinc sulfate, 0.02% dipotassium hydrogen phosphate, and pH 6.5; the fermentation time for the expanded fermentation culture is 48 h, the fermenter rotation speed is 150 r / min, the temperature is 22 ℃, and the aeration rate is 1:1 (V / V).
4. The method according to claim 1, characterized in that, The seed culture described in step (1) involves inoculating the *Paecilomyces hepiali* strain into potato dextrose broth medium and culturing it at 22°C and 150 r / min on a shaker for 40-48 h.
5. The method according to claim 1, characterized in that, The sea cucumber raw material liquid in step (2) is prepared by the following method: the salt-free dried sea cucumber is soaked in water at a volume ratio of 5:1, the water is changed 3 times and then drained; the soaked sea cucumber is added to water and pulverized into a slurry at a volume ratio of 2:1, and then sterilized with saturated steam at 120±5℃ for later use; the sea cucumber raw material liquid is added after the fermentation of the *Penicillium chrysogenum* fermentation liquid for 40-48 hours.
6. The method according to claim 1, characterized in that, In step (2), the volume ratio of the sea cucumber raw material liquid to the *Paecilomyces cerevisiae* fermentation liquid is 1:3-5; the fermentation tank for co-culture fermentation rotates at 50 r / min, is at 22°C, and is co-cultured for 16 h.
7. The method according to any one of claims 1-6, characterized in that, The process also includes the following post-processing steps: freeze-drying the obtained co-culture fermentation broth to obtain Cordyceps sinensis and sea cucumber co-culture product powder; the freeze-drying process is as follows: -40℃ for 5 hours, 0℃ for 20 hours, 20℃ for 16-18 hours, and the temperature difference between the material and the shelf at the end point is ≤5℃.
8. Powdered Cordyceps BFE-1, characterized in that: Its name is Cordyceps farinosa BFE-1, belonging to Cordyceps farinosa. The deposit date is December 29, 2025, the accession number is CGMCC No.42492, and the depositary institution is the China General Microbiological Culture Collection Center. Its main biological characteristics include: white hyphae, hairy, growing upward and peripherally, dense hyphae, and colorless base of the mycelium; under a microscope, it has branched hyphae, and the conidia are leaf-like.
9. A fermentation product co-cultured with *Paecilomyces hepiali* and sea cucumber, characterized in that, Prepared by the method according to any one of claims 1-7.
10. The co-culture fermentation product of *Paecilomyces hepiali* and sea cucumber according to claim 9, characterized in that, The fermented product is a freeze-dried powder.