Automated nested recombinase polymerase amplification
Patent Information
- Application Number
- CN202610649401.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2016-03-04
- Filing Date
- 2017-03-03
- Publication Date
- 2026-08-21
AI Technical Summary
[0035]本发明的其它特征和优点将从以下详细描述和图以及从权利要求书中显而易见。
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
[0001] Cross-references to related applications This application is a divisional application of international application PCT / US2017 / 020782, filed on March 3, 2017, and entered into China with application number 201780022595.2, entitled "Automated Nested Recombinase Polymerase Amplification". This application claims the benefit of U.S. Patent Application Serial No. 62 / 303,934, filed on March 4, 2016, entitled "Automated Nested Recombinase Polymerase Amplification", which is incorporated herein by reference in its entirety.
[0002] Statement concerning government interests This invention was carried out with government support under license number HHSO100201400011C granted by the U.S. Department of Health and Human Services. The government has certain rights in this invention. Technical Field
[0003] This invention relates to an influenza detection system, and more specifically, to a system comprising a sample module, a microfluidic nucleic acid amplification device, and an analyzer that facilitates fully automated nested recombinase polymerase amplification (RPA) of a sample delivered to the nucleic acid amplification device via the sample module. Background Technology
[0004] The detection of trace levels of polynucleotide sequences plays a crucial role in the detection of pathogens and genetic diseases, helping to tailor treatment strategies to specific infections or genotypes. Certain isothermal nucleic acid amplification methods can amplify target polynucleotide sequences from trace levels to extremely high and detectable levels within minutes. These isothermal methods, such as recombinase polymerase amplification (RPA) or nicking and extension amplification reaction (NEAR), allow users to detect specific sequences in trace amounts, facilitating point-of-care testing and increasing the convenience and speed of diagnosis. Summary of the Invention
[0005] The nucleic acid amplification device disclosed herein is configured to include a series of microfluidic channels interconnecting a primary reaction chamber, a secondary reaction chamber, and a detection chamber. An integrated pump module is also provided to allow liquid to selectively pass through the device at appropriate times. A primary reaction chamber is provided where a first round of RPA occurs, amplifying the target polynucleotide sequence of interest. After the first round of RPA, the sample liquid is combined with specific RPA primers and transferred to the secondary reaction chamber. During secondary amplification, the sequence completely contained within the primary reaction product is amplified to form the secondary reaction product; the secondary reaction product is then detected. Detection can be achieved using optical or electrochemical methods.
[0006] Before entering multiple secondary reaction chambers, the product mixture from the first round of RPA can be split into multiple streams and passed through a reagent reservoir, in which the product mixture is combined with the same or different RPA primers. In this way, the nucleic acid amplification device can be used to detect more than one target of interest (e.g., influenza A virus and influenza B virus). In some cases, one of the secondary reaction chambers can be used as a control.
[0007] The first general aspect includes providing a sample to a microfluidic device and amplifying a target polynucleotide sequence in the sample. Amplifying the target polynucleotide sequence includes performing a first round of amplification on the sample to obtain a first amplification product, and performing a second round of amplification on the first amplification product to obtain a second amplification product. The second amplification product includes a smaller sequence completely contained within the first amplification product generated during the first round of amplification.
[0008] The implementation of the first general aspect may include one or more of the following features.
[0009] Some implementations include detecting the second amplification product.
[0010] In some embodiments, detecting the second amplification product may include labeling the second amplification product with a first oligonucleotide linked to a fluorophore and a quencher to obtain a labeled second product, cleaving the quencher from the labeled second amplification product, and optically detecting a signal from the fluorophore, wherein a detectable signal indicates the presence of the second amplification product. Cleavage of the quencher may be performed using a nuclease. The nuclease may target double-stranded DNA. In some cases, the nuclease is a formamidopyrimidine-DNA glycosylase.
[0011] In some embodiments, detecting the second amplification product includes labeling the second amplification product with a first oligonucleotide linked to a redox moiety to obtain a labeled second amplification product, cleaving the redox moiety from the labeled second amplification product, and electrochemically detecting a signal from the cleaved redox moiety, wherein a detectable signal indicates the presence of the second amplification product. The redox moiety is typically selected from the group consisting of phenothiazines, phenoxazines, ferrocene, ferricyanides, ruthenium(III), osmium(II), anthraquinones, phenazines, and their derivatives. Cleavage of the redox moiety can be performed using a nuclease. The nuclease can target double-stranded DNA. In some cases, the nuclease is a formamidopyrimidine-DNA glycosylase.
[0012] Some implementations include performing a third round of amplification on the second amplification product to obtain a third amplification product, and detecting the third amplification product, wherein the third amplification product includes a smaller sequence that is completely contained within the second amplification product generated during the second round of amplification.
[0013] Samples can be obtained from animals. For example, samples can be obtained from an animal's blood, sputum, mucus, saliva, tears, or urine. In some cases, samples are obtained from humans.
[0014] The target nucleic acid may include a target polynucleotide sequence. In some embodiments, the target nucleic acid is obtained from an animal pathogen. The animal pathogen may be a single-stranded DNA virus, a double-stranded DNA virus, or a single-stranded RNA virus. The animal pathogen may be bacteria. The target nucleic acid may be double-stranded DNA, single-stranded DNA, or RNA. In some cases, the target nucleic acid is selected from the group consisting of: genomic DNA, plasmid DNA, viral DNA, mitochondrial DNA, cDNA, synthetic double-stranded DNA, and synthetic single-stranded DNA. The target nucleic acid may be viral DNA or viral RNA. In some cases, the animal pathogen is influenza A virus or influenza B virus.
[0015] In some implementations, two or more target polynucleotide sequences in the sample are amplified. In one example, a target polynucleotide sequence including an influenza A gene sequence and a target polynucleotide sequence including an influenza B gene sequence are amplified.
[0016] In some implementations, two or more second amplification products are detected. In some implementations, a second amplification product including an influenza A gene sequence and a second amplification product including an influenza B gene sequence are detected.
[0017] In a second general aspect, the diagnostic card includes a card body. The card body includes a primary reaction chamber, one or more secondary reaction chambers, a channel for supplying sample fluid to the primary reaction chamber, one or more detection chambers fluidly connected to the one or more secondary reaction chambers, and a detection module associated with each detection chamber. The primary reaction chamber is configured to perform a first nucleic acid amplification on the sample fluid in the reaction chamber to form a first amplification product. Each secondary reaction chamber is configured to perform a second nucleic acid amplification on the first amplification product to form a second amplification product.
[0018] The second general aspect can be implemented in ways that include one or more of the following features.
[0019] In some implementations, the detection module is an optical module, such as a fluorescence detector. The fluorescence detector may include a single light guide for directing illumination light to one or more detection chambers, and discrete light guides for receiving reflected light from each detection chamber.
[0020] In some implementations, the detection module is an electrode module. The detection module may include a series of conductive traces terminating in electrodes in each detection chamber. The device may include additional conductive traces and electrodes for detecting the position of the liquid in the microfluidic card.
[0021] In some implementations, amplification includes a recombinase polymerase amplification (RPA) reaction.
[0022] In some implementations, the diagnostic card includes a mixing component, a pump, and a connection port for connecting to the sample module. The main reaction chamber may be connected to a heater. The main reaction chamber may include, or be connected to, the mixing component. In some cases, the main reaction chamber includes reagents. Reagents may include RPA reagents. RPA reagents may be lyophilized.
[0023] In some implementations, each secondary reaction chamber includes a reagent. The reagent may include an RPA reagent. The RPA reagent may be lyophilized.
[0024] In some implementations, the sample fluid is a sample obtained from an animal. The sample can be obtained from the animal's blood, sputum, mucus, saliva, tears, or urine. In some cases, the sample fluid is a sample obtained from a human. The sample fluid may include target nucleic acids. Target nucleic acids can be obtained from animal pathogens. Animal pathogens can be single-stranded DNA viruses, double-stranded DNA viruses, or single-stranded RNA viruses. In some cases, animal pathogens are bacteria. Target nucleic acids can be double-stranded DNA, single-stranded DNA, or RNA. In some cases, target nucleic acids are selected from the group consisting of: genomic DNA, plasmid DNA, viral DNA, mitochondrial DNA, cDNA, synthetic double-stranded DNA, and synthetic single-stranded DNA. Target nucleic acids can be viral DNA or viral RNA. Animal pathogens can be influenza A viruses or influenza B viruses.
[0025] In some implementations, the second amplification product is generated 30 minutes or less, 15 minutes or less, 10 minutes or less, or 5 minutes or less after the sample fluid is delivered to the diagnostic card. The diagnostic card is typically disposable.
[0026] In some implementations, the diagnostic card includes additional reaction chambers, each configured to perform an additional round of nucleic acid amplification to form additional amplification products, such that the amplification products from each of the subsequent n+1 rounds of amplification are smaller sequences completely contained within the amplification products of the preceding nth round.
[0027] The third general aspect includes a reader configured to receive a diagnostic card from the second general aspect. The reader includes a detector configured to detect the presence of a second amplification product in the secondary reaction chamber.
[0028] The fourth general aspect includes a nucleic acid amplification device. The nucleic acid amplification device includes a first reaction chamber fluidly connected to a first inlet and a first outlet, a second reaction chamber fluidly connected to a second inlet and a second outlet, a detection chamber, a first pump, a second pump, and a third pump. The first inlet is fluidly connected to the first reaction chamber via the first pump, and the first outlet is fluidly connected to the first reaction chamber. The first reaction chamber is fluidly connected to the second reaction chamber via the second pump, and the second outlet is fluidly connected to the second reaction chamber. The second inlet is fluidly connected to the second reaction chamber via the third pump.
[0029] The implementation of the fourth general aspect may include one or more of the following features.
[0030] In some implementations, the nucleic acid amplification device is a microfluidic device. The first reaction chamber typically includes reagents. In some cases, the first reaction chamber includes a catalyst. The catalyst may include magnesium.
[0031] In some implementations, the nucleic acid amplification apparatus includes a reagent reservoir, and a second and a third pump are fluidly connected to each second reaction chamber via a first reagent reservoir. The second and third pumps may be fluidly connected to each second reaction chamber via both the first and second reagent reservoirs. In some cases, the first and second reagent reservoirs are connected in series. The first reagent reservoir may include an oligomer. The second reagent reservoir may include magnesium.
[0032] In some implementations, each second reaction chamber is a detection chamber. A portion of each detection chamber may be optically transparent. In some cases, electrodes are connected to each detection chamber. In one example, three electrodes are connected to each detection chamber.
[0033] In some implementations, the nucleic acid amplification device includes a fluid detection zone. A first pump and a first reaction chamber may be connected via the first detection zone. A second pump and a second reaction chamber may be connected via a second detection zone. A third pump and a second reaction chamber may be connected via a third detection zone. The third pump and the first reaction chamber may be connected via a fourth detection zone. In some cases, a portion of each detection zone is optically transparent. A fluid detection chamber may be connected to each detection zone.
[0034] In some implementations, the nucleic acid amplification apparatus includes a heater connected to a first reaction chamber. The first reaction chamber may include a stirrer. In some implementations, a first pump is configured to provide a sample to be delivered to the nucleic acid amplification apparatus via a first inlet into the first reaction chamber. Second and third pumps may be configured to combine reagents delivered to the body of the nucleic acid amplification apparatus via a second inlet with products from the first reaction chamber to obtain a reaction mixture. The second and third pumps may be configured to provide a portion of the reaction mixture into each of the second reaction chambers.
[0035] Other features and advantages of the invention will be apparent from the following detailed description and figures, as well as from the claims. Attached Figure Description
[0036] Figures 1A-1D depict the components of a system for fully automated nested RPA of samples delivered to a nucleic acid amplification device via a sample module.
[0037] Figures 2A-2E depict alternative workflows for the system illustrated in Figure 1.
[0038] Figures 3A and 3B depict perspective views of the receiver module portion of the sample module.
[0039] Figures 4A and 4B depict perspective views of the transfer module portion of the sample module.
[0040] Figure 5A-5G illustrates the workflow for providing samples to a sample module that has a connected receiver module and a transmission module.
[0041] Figures 6A-6H depict the workflow for providing samples to a sample module with separate receiver and delivery modules.
[0042] Figure 7 A perspective view of the hinged sample module is depicted.
[0043] Figure 8A and 8B A view of the alternative sample module is depicted.
[0044] Figures 9A-9E Describes the method for providing samples to Figure 8A and 8B The workflow of the sample module is described in the text.
[0045] Figure 10 An exploded view of a microfluidic nucleic acid amplification device used for detecting optical probes is depicted.
[0046] Figure 11 Depicting Figure 10 The working components of the microfluidic nucleic acid amplification device are depicted in the image.
[0047] Figure 12 An exploded view of a microfluidic nucleic acid amplification device used for detecting electrochemical probes is depicted.
[0048] Figure 13 Depicting Figure 12 A top view of the middle layer of the microfluidic nucleic acid amplification device depicted in the image.
[0049] Figure 14 Depicting crossing Figure 12 A top view of the sensor layer of the microfluidic nucleic acid amplification device depicted in the image.
[0050] Figure 15 A perspective view of the nucleic acid amplification device in the insertion analyzer is depicted.
[0051] Figure 16 A perspective view of the optical analyzer is depicted.
[0052] Figure 17 Depicting Figure 16 A detailed diagram of the light guide tube in the optical analyzer depicted in the image.
[0053] Figures 18A-18C Describing about Figure 16 The optical analyzer depicted in the diagram describes the excitation and emission coordinate systems.
[0054] Figures 19A-19DThe results of nested RPA amplification as described in this paper are depicted. Detailed Implementation
[0055] Figures 1A-1D depict the components of a system 100 for fully automated nested RPA of samples provided to a microfluidic nucleic acid amplification device. Figure 1A depicts a sample module 102, which includes a receiver module 104 and a delivery module 106. Figure 1B A microfluidic nucleic acid amplification device 110 is depicted. As shown in Figure 1C, the sample module 102 and the nucleic acid amplification device 108 are connected to form the nucleic acid amplification assembly 110. Figure 1D A system 100 is depicted, which includes a nucleic acid amplification assembly 110 inserted into an analyzer 112 for assessing the presence of target nucleic acids in a sample provided from a sample module 102 to a nucleic acid amplification apparatus 108.
[0056] System 100 is used to assess the presence of target nucleic acids in a sample provided to receiver module 104 of sample module 102. Receiver module 104 and delivery module 106 of sample module 102, along with nucleic acid amplification device 108, contain reagents required for performing a first round of RPA, followed by a subsequent second round of RPA, to amplify the target nucleic acid (if present in the sample). The connection between sample module 102 and nucleic acid amplification device 108 creates a fluid pathway between the sample module and the nucleic acid amplification device, allowing the RPA reaction mixture to be delivered to the nucleic acid amplification device. In some cases, system 100 is used to assess the presence of two or more target nucleic acids in a sample. In one example, system 100 is used to assess the presence of influenza A virus and influenza B virus in a sample. In some cases, sample module 102 and nucleic acid amplification device 108 are configured to perform three or more rounds of nested RPA.
[0057] Figures 2A-2E depict an alternative workflow for system 100. As depicted in Figure 2A, the nucleic acid amplification device 108 is inserted into the analyzer 112. In Figure 2B, the sample module 102 moves toward the nucleic acid amplification device 108 in the analyzer. Registration features on the interface of analyzer 112 before connection restrict the sample module 102 in two dimensions, allowing the sample module and nucleic acid amplification device 108 to pair and form channels that allow fluid to flow from the sample module to the nucleic acid amplification device and vice versa. Figure 2C depicts the nucleic acid amplification assembly 110 in analyzer 112. Connecting the sample module 102 to the nucleic acid amplification device 108 initiates the flow of reactants from the sample module to the nucleic acid amplification device, thereby initiating the evaluation of the presence of the target nucleic acid in the sample. Once evaluation is complete, as depicted in Figure 2D, the registration features in analyzer 112 can engage to release the nucleic acid amplification assembly 110. Figure 2EThe nucleic acid amplification assembly 110 is depicted after being released from the analyzer 112. The nucleic acid amplification assembly 110 can be discarded after being released from the analyzer 112.
[0058] Figures 3A and 3B depict perspective views of one embodiment of the receiver module 104 of the sample module 102. Figure 3A depicts a perspective view of the receiver module 104 having a chamber 300 for containing a sample, reagents, or both. The receiver module 104 also includes a registration feature 302 for aligning the receiver module with the delivery module 106. Figure 3B A perspective view opposite to Figure 3A is depicted, which shows an exterior view of the bottom 304 of chamber 300.
[0059] Figures 4A and 4B depict perspective views of one embodiment of a transmission module 106 configured to mate with receiver module 104. Figure 4A depicts a perspective view of the transmission module 106 having chambers 400, each chamber having an inlet 402 and an outlet 404. The transmission module 106 also includes a registration feature 406 for aligning the transmission module with the receiver module 104. Figure 4B A perspective view opposite to Figure 4A is depicted, showing the bottom 408 and the inlet 402 and outlet 404 of the chamber 400.
[0060] Figures 5A-5G depict the workflow for providing a sample to a sample module 500 having a connected receiver module 502 and a delivery module 504. As depicted in Figure 5A, the sample module 500 can be provided in a sealed pouch 506. The sealed pouch 506 can be a foil pouch. Figure 5B depicts the sample module 500 after it has been removed from the pouch 506, with the hinge 508 open to expose the sealing strips 510 and 512 on the receiver module 502 and the delivery module 504, respectively.
[0061] As depicted in Figure 5C, the seal 510 can be removed from the receiver module 502 to expose the sample chamber 514 and the blank chamber 516. The sample chamber 514 and the blank chamber 516 typically comprise a liquid medium, such as a buffer solution. A sample (e.g., a bodily fluid) can be delivered to the sample chamber 514 via a device 518 (e.g., a swab), thereby introducing the sample into the liquid medium within the sample chamber 514. The blank chamber 516 can be covered by an interlocking element 520 to prevent sample insertion into the blank chamber. Gaskets 522 and 524 can be located around the exterior of the sample chamber 514 and the blank chamber 516, respectively, to facilitate a seal between the receiver module 502 and the transfer module 504 after the sample has been placed in the sample chamber 514. A registration feature 526 on the receiver module 502 is configured to mate with a corresponding registration feature on the transfer module 504.
[0062] As depicted in Figures 5D and 5E, the seal 512 can be removed from the transfer module 504 to expose the sample chamber 528 and the blank chamber 530. Holding elements 532 and 534 may be located in the sample chamber 528 and the blank chamber 530, respectively, to retain solid reagents in the sample chamber, the blank chamber, or both. In one example, holding element 532 retains reagent pellets in the sample chamber 528. The reagent pellets may include oligomers used for RPA reactions. In some cases, the pellets are freeze-dried pellets. The blank chamber 530 may be free of solid reagents. Holding elements 532 and 534 typically define orifices, such as orifices. In some cases, holding elements 532 and 534 are glass frits. The glass frits can be selected to facilitate fluid transfer from the receiver module 502 to the transfer module 504. In one example, holding elements 532 and 534 are hydrophilic glass frits. The transmission module 504 includes a registration feature 536, which is configured to pair with the registration feature 526 of the receiver module 502.
[0063] After removing the seal 512 from the transfer module 504, as depicted in Figure 5F, the transfer module can be rotated about hinge 508 and secured to the receiver module 502, wherein retaining elements 532 and 534 respectively retain reagents present in the sample chamber 528 and blank chamber 530. When the receiver module 502 and the transfer module 504 are pressed together, as shown in Figure 5F... Figure 5G As depicted, registration features 526 and 536 are locked together, gasket 522 seals sample chambers 514 and 528 together, and gasket 524 seals blank chambers 516 and 530 together. When sample module 502 is oriented as depicted with transfer module 504 above receiver module 502, the liquid medium in sample chamber 514 and blank chamber 516 remains in the receiver module and does not flow toward sample chamber 528 and blank chamber 530 in transfer module 504, respectively, before reversal occurs. Registration features 526 and 536 can be configured to irreversibly seal receiver module 502 and transfer module 504, making it impossible to unintentionally open sample module 500.
[0064] Before the sample module 500 is connected to the nucleic acid amplification device, the sample module is inverted to move the liquid medium in the receiver module 502 toward the transfer module 504, thereby hydrating it with the solid reagent in the transfer module to form a hydration reaction mixture. In one example, freeze-dried RPA reagent in the transfer module is hydrated to form the hydration reaction mixture.
[0065] Figures 6A-6H depict an alternative workflow for providing samples to a sample module 600 having separate receiver module 602 and delivery module 604. As depicted in Figure 6A, receiver module 602 and delivery module 604 can each be provided in separate sealed pouches 606, 606'. Sealed pouch 606 may be a foil pouch.
[0066] Figure 6B depicts the transfer module 604 after removal from the sealed pouch 606'. The transfer module 604 is sealed with a seal 612. Figure 6C depicts the receiver module 602 after removal from the pouch 606. The receiver module 602 is sealed with a seal 610. After removing the seal 610 from the receiver module 602, as depicted in Figure 6D, the sample chamber 614 and the blank chamber 616 are exposed. The sample chamber 614 and the blank chamber 616 typically contain a liquid medium, such as a buffer solution. A sample (e.g., bodily fluid) can be delivered to the sample chamber 614 via a device 618 (e.g., a swab), thereby introducing the sample into the liquid medium within the sample chamber. The blank chamber 616 can be covered with an interlocking element 620 to prevent sample insertion into the blank chamber. Gaskets 622 and 624 can be located around the exterior of the sample chamber 614 and the blank chamber 616, respectively, to facilitate a seal between the receiver module 602 and the transfer module 604. The registration feature 626 on the receiver module 602 is configured to pair with the corresponding registration feature on the transmission module 604.
[0067] As depicted in Figure 6E, seal 612 can be removed from transfer module 604. Removing seal 612 from transfer module 604 exposes the sample chamber and blank chamber (not shown). Holding elements (not shown) may be located in the sample chamber and blank chamber, respectively, to hold solid reagents in the sample chamber, blank chamber, or both. In one example, the solid reagent comprises an oligomer for RPA reaction. In some cases, the solid reagent is lyophilized pellets. The blank chamber may be free of solid reagents. The holding element typically defines an orifice, such as a small hole. In some cases, the holding element is a glass frit. The glass frit can be selected to facilitate fluid transfer from receiver module 602 to transfer module 604. In one example, the holding element is a hydrophilic glass frit. Transfer module 602 includes registration feature 636, which is configured to mate with registration feature 626 of receiver module 602.
[0068] After removing seal 612 from transfer module 604, as depicted in FIG6F, the transfer module can be inverted to align registration features 626 and 636. During this inversion, retaining elements in transfer module 604 retain reagents present in the sample chamber and blank chamber of the transfer module. When receiver module 602 and transfer module 604 are pressed together, as depicted in FIG6G, registration features 626 and 636 engage lockably, gasket 622 seals the sample chamber of the receiver together with the transfer module, and gasket 624 seals the blank chamber of the receiver together with the transfer module. As depicted in FIG6G, when transfer module 604 is above receiver module 602, the liquid media in sample chamber 614 and blank chamber 616 are retained in the receiver module and do not flow toward the sample chamber and blank chamber in the transfer module, respectively. Registration features 626 and 636 can be configured to irreversibly seal receiver module 602 and transfer module 604, as shown in FIG6G. Figure 6H As described, it is impossible to open sample module 600 unintentionally.
[0069] Before the sample module 600 is connected to the nucleic acid amplification device, the sample module can be inverted to move the liquid medium in the receiver module 602 toward the transfer module 604, thereby hydrating it with the solid reagent in the transfer module to form a hydration reaction mixture. In one example, freeze-dried RPA reagent in the transfer module is hydrated to form a hydration reaction mixture.
[0070] Figure 7 This is a perspective view of sample module 500. The delivery module 500 may be wrapped with a seal 700, covering the portion of the delivery module configured to connect to the nucleic acid amplification device. The seal 700 may be a foil seal, providing an opaque surface to cover the openings of inlets 702 and 704 and outlets 706 and 708. The seal 700 may retain the hydrated reaction mixture within the sample module 500 during inversion. In some cases, the seal 700 is removed from the sample module 500, the nucleic acid amplification device is connected to the sample device, and the sample module 500 is inverted first after being sealed relative to the nucleic acid amplification device. Inlets 702 and 704 and outlets 706 and 708 may have tapered ends (e.g., low-profile Luer connectors) configured to insert into the nucleic acid amplification device. In some cases, gaskets 710, 712, 714, and 716 may be located on inlets 702, 704, 706, and 708, respectively, forming an hermetically sealed seal with the nucleic acid amplification device.
[0071] Figure 8A and 8B Alternative implementation schemes for the sample module are described. Figure 8A This is a perspective view of a sample module 800, including a receiver module 802 and a transmitter module 804. Figure 8B This is a cross-sectional perspective view of sample module 800. (See image.) Figure 8B As depicted, receiver module 802 defines a sample chamber 806 having an orifice 808. Sample chamber 806 holds a liquid medium 810. The liquid medium 810 may be a buffer solution. Receiver module 802 includes an inlet 812 and an outlet 814. Receiver module 802 also includes a registration feature 816 configured to engage the registration features of transfer module 804.
[0072] The transfer module 804 includes a housing 818 having an extension 820 that defines an orifice 822 of a sample chamber 806 configured to receive a receiver module 802. A punch 824 is located within the housing, with the extension 820 situated in an arm 826 of the punch. The arm 826 is situated within a spring 828, which is held in a loaded position by a release latch 830. A porous element 832 is located between the punch 824 and the orifice 822. The porous element 832 contains a solid reagent (e.g., lyophilized RPA reagent). A registration feature 834 is configured to engage with a registration feature 816 of the receiver module 802, and a gasket 836 forms a seal between the receiver module and the transfer module 804. As depicted, the receiver module 802 is situated in the orifice 822 of the transfer module 804. Registration features 816 and 834 are lockedly engaged to seal the receiver module 802 and the transfer module 804 via the gasket 836. Registration features 816 and 834 can be configured to irreversibly seal the receiver module 802 and the transmission module 804, making it impossible to open the sample module 800 unintentionally.
[0073] Figures 9A-9E The workflow for providing samples to sample module 800 is described. Figure 9A In the process, the seal 900 is removed from the receiver module 802. Figure 9B In this process, the sample is provided to the liquid medium 810 in the sample chamber 806 of the receiver module 802 via the orifice 808. Figure 9C In this process, the transmission module 804 advances toward the receiver module 802 to lock-engage registration features 816 and 834. After the receiver module 802 is sealed relative to the transmission module 804 via the washer 836, force can be applied to the release latch 830 to release the spring-loaded punch 824, as... Figure 9D As depicted in the diagram. Releasing the spring-loaded punch 824 causes the porous element 832 to advance through the orifice 822, causing the solid reagent in the porous element to hydrate in the liquid medium 810 of the receiver module 802. Figure 9E A sealed sample module 800 is depicted, in which a punch 824 rests within a receiver module 802, forcing solid reagents in a porous element 832 into a liquid medium 810. The sealed sample module 800 can be connected to a nucleic acid amplification apparatus to assess the presence of target nucleic acids in samples provided to the receiver module 802.
[0074] Figure 10 An exploded view of a nucleic acid amplification device 1000 for optical detection is depicted. The nucleic acid amplification device 1000 is a layered microfluidic device comprising a top layer 1002, an intermediate layer 1004, and a base layer 1006. The base layer 1006 may include more than one component. As depicted, the base layer 1006 includes two components 1008 and 1010.
[0075] The intermediate layer 1004 includes inlets 1012 and 1014 and outlets 1016 and 1018, which are connected to the outlet and inlet of the sample module, respectively. The intermediate layer 1004 typically includes reagents, such as RPA reagents. Figure 10 As depicted, the main reaction chamber 1020 includes a solid reagent 1022 (e.g., Mg in the form of magnesium acetate). 2+ Intermediate layer 1004 includes reagent reservoirs 1024 and 1026, which contain solid reagents 1028 and 1030. In one example, solid reagent 1028 comprises a dried (e.g., freeze-dried) oligomer and solid reagent 1030 comprises Mg. 2+ (For example, in the form of magnesium acetate). The secondary reaction chamber 1032 can also serve as a detection chamber, in which the target nucleic acid is detected by an analyzer via an optical signal. The secondary reaction chamber 1032 has an optically transparent cover, allowing the detection of the fluorescence signal generated when the fluorophore and quencher are separated by an exonuclease by an optical sensor in an analyzer configured to be inserted therein, through which the nucleic acid amplification device is inserted. Registration feature 1036 allows for the alignment of the nucleic acid amplification device 1000 in the analyzer.
[0076] The intermediate layer 1004 may also include flow detection chambers 1034, each with a transparent cover, through which the presence of fluid passing through the cover is optically monitored by an analyzer to detect liquid flow. An analyzer configured to receive the nucleic acid amplification apparatus 1000 includes a light source directed at each configured flow detection chamber. The analyzer is configured to detect (e.g., via light scattering) the presence of liquid in each flow detection chamber. Detection of liquid in the flow detection chamber can trigger various operations (e.g., start or stop pumping), and a controller in the analyzer can be configured to execute various parameters (e.g., pumping time, reaction time, mixing time, flow time) based on the detection of liquid in the flow detection chamber, such that reagents are supplied in a predetermined volume and the reaction is allowed to proceed for a predetermined time.
[0077] Nucleic acid amplification device 1000 may include Figure 10Additional features not described herein include pumps and microfluidic pathways. One or more of the pumps may be peristaltic pumps or syringe pumps. Based on the elapsed time or the flow of fluid through the flow detection chamber detected by optical sensors in the optical analyzer, the pumps can selectively drive reagents from the sample module and primary reaction chamber 1020 to secondary reaction chamber 1032, metering and aliquoting the sample as needed.
[0078] according to Figure 11 The operation of a nucleic acid amplification apparatus 1000 having a sample module is described. When the sample module is connected to the nucleic acid amplification apparatus 1000, the outlet of the sample module is connected to the inlets 1012 and 1014 of the nucleic acid amplification apparatus, and the inlets of the sample module are connected to the outlets 1016 and 1018 of the nucleic acid amplification apparatus. Reagents in the sample module flow into the inlets 1012 and 1014 of the nucleic acid amplification apparatus 1000 via the outlet of the sample module, and fluids (e.g., gas, liquid, or both) discharged from the nucleic acid amplification module flow into the inlets of the sample module via the outlets 1016 and 1018 of the nucleic acid amplification module.
[0079] More specifically, the sample and buffer solution flow from the sample chamber of the receiver module through the outlet into the inlet 1012 to hydrate with the RPA reagent (e.g., dried oligomer) in the sample chamber of the delivery module. A first pump 1040 propels this main reaction mixture through the first flow detection chamber 1042.
[0080] The main reaction mixture is drawn from the flow detection chamber into the first pump, passes through the mixing chamber 1044, reaches the second flow detection chamber 1046, and then reaches the main reaction chamber 1020. The main reaction chamber 1020 includes the RPA reagent 1022 (e.g., Mg in the form of magnesium acetate). 2+ It is connected to a heater and a mixer. The mixer may be a magnetic mixer 1048. After sufficient mixing time, the first pump 1040 advances the product formed in the main reaction chamber 1020 to the third flow detection chamber 1050. From the third flow detection chamber 1050, air and a portion of the product from the main RPA reaction in the main reaction chamber flow to the sample module via the outlet 1016.
[0081] The second pump 1054 draws an aliquot of the product from the main reaction chamber 1020 from the bypass 1052 and flows to the fourth flow detection chamber 1056. The third pump 1058 draws reagents (e.g., buffer) for the secondary RPA reaction from the blank chamber of the transfer module via the outlet of the transfer module into the inlet 1014 of the nucleic acid amplification device 1000, and through the fifth flow detection chamber 1060. The fourth flow detection chamber 1056 and the fifth flow detection chamber 1060 are joined at the Y-junction 1062, where a selected amount of product from the first RPA reaction is mixed with the reagents for the secondary RPA reaction. This mixture is pumped by the second pump 1054 and the third pump 1058 through the first series mixing element 1064 and the second series mixing element 1066. After passing through the mixing element 1066, the mixture branches at the junction 1068 and again at the junction 1070, resulting in four streams of the reaction mixture. Each stream flows through the first reagent reservoir 1024, wherein the mixing cylinder 1072 is configured to mix the reaction mixture with reagent 1028 (e.g., Mg in the form of magnesium acetate). 2+ Mixing. From the first reagent reservoir 1024, each mixture flows through a second reagent reservoir 1026 containing reagent 1030. The reagents 1030 in the second reagent reservoir 1026 may be the same or different. In one example, at least two of the reagents 1030 include different RPA primers for a specific target of interest, such as influenza A virus and influenza B virus.
[0082] From the second reagent reservoir 1026, the third pump 1058 drives the mixture through the mixing element 1074 and into the secondary reaction chamber 1032. Secondary amplification occurs in the secondary reaction chamber 1032. The secondary reaction chamber 1032 can also serve as a detection chamber. In the nucleic acid amplification apparatus 1000, the secondary reaction chamber 1032 has an optically transparent cover, allowing an analyzer, for example, about [specific details about the apparatus], to be inserted into the nucleic acid amplification apparatus. Figure 15 The analyzer described in -18 optically detects the fluorescence signal generated when the fluorophore and quencher are separated by an exonuclease.
[0083] Figure 12 An exploded view of a nucleic acid amplification device 1200 for electrochemical detection is depicted. The nucleic acid amplification device 1200 is a layered microfluidic device comprising a sensor layer 1201, a top layer 1202, an intermediate layer 1204, and a base layer 1006. The base layer 1206 may include more than one component. As depicted, the base layer 1206 includes two components 1208 and 1210.
[0084] The intermediate layer 1204 includes inlets 1212 and 1214 and outlets 1216 and 1218, which are connected to the outlet and inlet of the sample module, respectively. The intermediate layer 1204 typically includes reagents, such as RPA reagents. Figure 12 As depicted, the main reaction chamber 1220 includes a solid reagent 1222 (e.g., Mg in the form of magnesium acetate). 2+ A stirrer 1223 may be embedded in a solid reagent 1222. In one example, the stirrer is a magnetic disk. The secondary reaction chamber 1232 may also serve as a detection chamber, wherein an orifice 1225 in the top layer 1202 allows liquid in the reaction chamber to contact electrodes on the underside of the sensor layer 1201. The intermediate layer 1204 may also include a flow detection chamber 1234, wherein the presence of fluid is electrically monitored by electrodes in the sensor layer 1201 superimposed on the orifice in the top layer 1202, such that liquid flowing through the flow detection chamber contacts the electrodes. A registration feature 1236 allows for the alignment of the nucleic acid amplification device 1200 in the analyzer.
[0085] Nucleic acid amplification device 1200 may include Figure 12 Additional features not described herein include pumps and microfluidic pathways. One or more of the pumps may be peristaltic pumps or syringe pumps. Based on the elapsed time or the flow of fluid through the flow detection chamber detected by sensors in the electroanalyzer, the pumps can selectively drive reagents from the sample module and primary reaction chamber 1220 to secondary reaction chamber 1232, metering aliquots of the sample as needed.
[0086] according to Figure 13 Describe the operation of the nucleic acid amplification device 1200 with a sample module. Figure 13 A top view of the intermediate layer is depicted. When the sample module is connected to the nucleic acid amplification device 1200, the outlet of the sample module is connected to the inlets 1212 and 1214 of the nucleic acid amplification device, and the inlets of the sample module are connected to the outlets 1216 and 1218 of the nucleic acid amplification device. Reagents in the sample module flow into the inlets 1212 and 1214 of the nucleic acid amplification device 1200 via the outlet of the sample module, and fluids (e.g., gas, liquid, or both) discharged from the nucleic acid amplification module flow into the inlets of the sample module via the outlets 1216 and 1218 of the nucleic acid amplification module.
[0087] More specifically, the sample and buffer solution flow from the sample chamber of the receiver module through the outlet into the inlet 1212 to hydrate with the RPA reagent (e.g., a dried oligomer) in the sample chamber of the delivery module. A first pump 1240 propels this main reaction mixture forward through a first flow detection chamber 1242, into the first pump, through a mixing chamber 1244, to a second flow detection chamber 1246, and finally to the main reaction chamber 1220. The main reaction chamber 1220 contains the RPA reagent 1222 (e.g., Mg2+ in the form of magnesium acetate). 2+It is connected to a heater and a mixer. The mixer may be present as a magnetic mixer 1248. After sufficient mixing time, the first pump 1240 advances the product formed in the main reaction chamber 1220 to the third flow detection chamber 1250. From the third flow detection chamber 1250, air and a portion of the product from the main RPA reaction in the main reaction chamber flow to the sample module via the discharge port 1216.
[0088] The second pump 1254 draws an aliquot of the product from the main reaction chamber 1220 from the bypass 1252 and flows to the fourth flow detection chamber 1256. The third pump 1258 draws reagents (e.g., buffer) for the secondary RPA reaction from the blank chamber of the transfer module through the outlet of the transfer module into the inlet 1214 of the nucleic acid amplification device 1200 and through the fifth flow detection chamber 1260. The fourth flow detection chamber 1256 and the fifth flow detection chamber 1260 are joined at the Y junction 1262, where a selected amount of product from the first RPA reaction is mixed with reagents from the secondary RPA reaction. This mixture is pumped by the second pump 1254 and the third pump 1258 through the first series of mixing elements 1264 and the second series of mixing elements 1266. After passing through the mixing element 1266, the mixture branches at the junction 1268 and again at the junction 1270, resulting in four streams of the reaction mixture. Each stream flows through the first reagent reservoir 1224, wherein the mixing cylinder 1272 is configured to mix the reaction mixture with reagent 1228 (e.g., Mg in the form of magnesium acetate). 2+ Mixing. From the first reagent reservoir 1224, each mixture flows through a second reagent reservoir 1226 containing reagent 1230. The reagents 1230 in the second reagent reservoir 1226 may be the same or different. In one example, at least two of the reagents 1230 include different RPA primers for a specific target of interest, such as influenza A virus and influenza B virus.
[0089] From the second reagent reservoir 1226, the third pump 1258 drives the mixture through the mixing element 1274 and into the secondary reaction chamber 1232. Secondary amplification occurs in the secondary reaction chamber 1232. The secondary reaction chamber 1232 can also serve as a detection chamber. In the nucleic acid amplification apparatus 1200, the liquid in the secondary reaction chamber 1232 contacts electrodes on the underside of the sensor layer 1201, such that the nucleic acid amplification apparatus is configured such that an analyzer inserted therein detects electrons generated by oxidation by a redox-active compound, for example, as described in U.S. Serial No. 62 / 300,242, which is cleaved from an RPA probe labeled with the redox-active compound.
[0090] Figure 14A top view of a nucleic acid amplification apparatus 1200 is depicted, wherein electrodes in a sensor layer 1201 are superimposed on orifices in a top layer 1202 and an intermediate layer 1204. The electrodes are located on the underside of the sensor layer 1201 to contact the flow sensing detectors 1246, 1250, 1256, and 1260 and the liquid in the reaction chamber 1232. In one example, the sensing electrodes and the conductive traces connecting the sensing electrodes to terminals electrically connected to an analyzer can be formed by arranging a first conductive layer on the sensor layer. In another example, the first conductive layer can be arranged on a second conductive layer on the sensor layer. The electrodes can be electrically insulated by shielding the conductive layer and arranging a dielectric layer over the exposed areas. In one example, the first conductive material comprises carbon. In another example, the second conductive material comprises silver. As used herein, "arrangement" includes printing methods, such as screen printing. When a silver plating layer is placed under a carbon layer, the resulting conductive traces typically have lower resistance compared to conductive traces formed using carbon alone. In both instances, the electrochemical measurements were performed on a carbon surface.
[0091] Flow sensor detectors 1246 and 1250 are each electrically connected to two liquid sensing electrodes. For flow sensor detector 1246, liquid sensing electrodes 1400 and 1402 are electrically connected to wires 1404 and 1406, which are electrically connected to connectors 1408 and 1410, respectively. Flow sensor detectors 1256 and 1260 are each electrically connected to four liquid sensing electrodes. For flow sensor detector 1260, liquid sensing electrodes 1412 and 1414 are electrically connected to wires 1420 and 1422, which are electrically connected to connectors 1428 and 1430, respectively. Electrodes 1416 and 1418 are electrically connected to wires 1424 and 1426, which are electrically connected to connectors 1432 and 1434, respectively. Each detection chamber 1232 is connected to three measuring electrodes, including a reference electrode 1436, a working electrode 1438, and a counter electrode 1440, and each electrode is electrically connected to a connector via a wire. The wire may be a conductive trace comprising a conductive material (e.g., silver). The connector is configured to engage terminals in the analyzer.
[0092] Liquid sensing electrodes operate according to the principle of conductivity. That is, a voltage is applied to the terminal, and when fluid comes into contact with the sensing electrode in the corresponding chamber, current flows through the liquid, and the analyzer detects the current flow. For the measuring electrode, a potential is applied between the counter electrode and the working electrode; a reference electrode is used to ensure that the applied potential is as expected. When operating in current measurement mode, current flows in proportion to the concentration of the electroactive material in contact with the working electrode (in practice, electron acceptance or emission depends on whether oxidation or reduction of the target material occurs at a given potential). In differential pulse voltammetry mode, potentials are swept from one voltage to another, and the resulting current is recorded as a result of oxidation or reduction of the electroactive material, yielding peaks and / or troughs.
[0093] Figure 15 A nucleic acid amplification system 1500 is described, comprising a nucleic acid amplification device 1502 inserted into an analyzer 1504. The nucleic acid amplification device 1502 and the analyzer can be configured for optical or electrochemical detection of RPA products. In some cases, the nucleic acid amplification device is inserted into the analyzer to initiate the assessment of the presence of the target nucleic acid in a sample provided to the nucleic acid amplification device. In other cases, a sample module is subsequently connected to the nucleic acid amplification device to initiate the assessment of the presence of the target nucleic acid in the sample. In still other cases, the assessment of the presence of the target nucleic acid in a sample provided to the nucleic acid amplification device is initiated by the user after inserting the nucleic acid amplification device or assembly into the analyzer.
[0094] like Figure 16 As depicted, nucleic acid amplification apparatus 1502 and analyzer 1504 are configured for optical detection of RPA products. Specifically, analyzer 1504 is configured to detect fluorescence from fluorescent probes attached to RPA products in the detection chamber of nucleic acid amplification apparatus 1502. Analyzer 1504 includes a light source, an excitation light guide 1600 corresponding to each light source, an emission light guide 1602 corresponding to each emission light guide, and a photodetector. The light source is typically a light-emitting diode (LED), and the LED is selected to achieve a good match between the LED emission peak and the absorption of the target fluorescent label. Analyzer 1504 incorporates a skewed geometry to allow fluorescence measurements from multiple reaction units using a single optical emission filter.
[0095] Figure 17 Depicting Figure 16 A magnified view of a portion. For example... Figure 17As depicted, analyzer 1504 includes four light sources to allow fluorescence measurements from four detection chambers 1700 in nucleic acid amplification device 1502. Excitation light guides 1600 to direct light from the light sources to the detection chambers 1700, and emission light guides 1602 to direct fluorescence emission from the detection chambers to conventional photodiodes via filters. The four measurement channels are distinguished by time-division multiplexing of the four light sources. Each excitation light guide 1600 is configured to direct incident light from one light source to a target in a plane such that the angle between the incident light and the plane is between 30° and 60° (e.g., 40°), and each emission light guide 1602 is configured to direct emitted light from the target to a photodetector such that the angle between the emitted light and the target is between 40° and 60° (e.g., 30°). The analyzer 1504 typically includes a first lens and a second lens corresponding to each light source, wherein each corresponding excitation light guide is configured to collimate light propagating from the corresponding light source through the first lens and guide the collimated light via total internal reflection at an angle relative to the second lens.
[0096] Figures 18A-18C The skew geometry of analyzer 1504 is depicted. Figures 18A-18C The angles depicted are illustrative and chosen for ease of explanation, but these angles can be changed in the implementation of analyzer 1500. For example... Figure 18A As depicted, the rotation axis is oriented at 45° relative to the line connecting the reaction chamber 1700. This configuration helps to avoid positional collisions between the excitation and emission photoguides. Figure 18B The excitation optical axis, which is at a 30° angle relative to the normal to the surface of the detection chamber (rotating about the y-axis in the x-plane), is depicted. Figure 18C The emission optical axis is depicted at 40° relative to the normal to the detection chamber surface (rotation about an orthogonal axis, i.e., about the x-axis in the yz plane). The center of rotation is located below the normal liquid surface position (e.g., 0.1 to 1 mm below). Other combinations of angles are listed in Table 1 below. The maximum bend angle in both the excitation and emission optical guides is typically 45° or less.
[0097] Table 1. Angles of excitation and emission light guides Analyzer 1504 includes a controller operatively connected to a light source and a photodetector. The controller causes the light source to begin generating incident light and to begin collecting emitted light from the detection chamber. Analyzer 1504 typically includes a single photodetector and a single emission filter operatively located between the emission light guide and the photodetector; however, in some embodiments, one or more additional photodetectors, emission filters, or both may be present.
[0098] While the apparatus and methods described herein have been described as applications of recombinase polymerase amplification (RPA) technology, other isothermal techniques for amplifying and detecting target nucleic acids, such as nick generation and extension amplification (NEAR) techniques, can also be performed in the apparatus described herein. The methods for RPA amplification and detection of RPA amplification products described herein are detailed in U.S. Patent Nos. 7,399,590, 8,580,507, 7,270,981, 7,399,590, 7,666,598, 7,435,561, 9,469,867, 9,057,097, 8,071,308, 8,637,253, and 8,062,850. NEAR methods are described in U.S. Patent Application Publications Nos. 2009 / 0081670 and 2009 / 0017453. Each of the foregoing references is incorporated herein by reference in its entirety and is considered a part of this disclosure.
[0099] As described here, RPA employs an enzyme called a recombinase, which pairs oligonucleotide primers with homologous sequences in the template double-stranded nucleic acid. RPA introduces the following: a recombinase for inserting two primers into the template double-stranded DNA; a single-stranded DNA-binding protein for stabilizing the replacement strand of the DNA and preventing primer replacement; and a replacement strand polymerase for extending the primers bound to the template DNA. In this way, DNA synthesis targets a boundary site in the template double-stranded nucleic acid. Using two or more sequence-specific (e.g., gene-specific) primers, if the template nucleic acid is present, an exponential amplification reaction begins. The reaction progresses rapidly, specifically amplifying the sequence present within the template double-stranded nucleic acid from only a few copies of the template nucleic acid to detectable levels of amplified product within minutes. The RPA process is performed isothermally at physiological temperatures (e.g., 37–42 °C). The RPA method is disclosed in, for example, US 7,270,981, US 7,399,590, US 7,666,598, US 7,435,561, US 2009 / 0029421 and WO 2010 / 141940, all of which are incorporated herein by reference.
[0100] RPA integrates into the cellular DNA replication and repair mechanisms, establishing a 'kinetic' recombination environment with recombinase loading and unloading rates sufficient to maintain high levels of recombination activity achievable in the presence of specific crowding reagents. The advantages of RPA lie in its combination of the sensitivity, specificity, and most other features of PCR, without the need for thermal cycling and with exceptional speed and robustness of the disconnection temperature setting. RPA benefits from: the potential use of various nucleic acid processing enzymes, such as known repair endonucleases, which are at least partially unused in other processes due to the need for thermally stable equivalents; poor regulation in the absence of auxiliary proteins such as single-stranded DNA binding proteins; or combinations thereof.
[0101] In simple terms, RPA includes the following steps: First, a recombinase agent is contacted with a first nucleic acid primer and a second nucleic acid primer to form a first nucleoprotein primer and a second nucleoprotein primer. Second, the first nucleoprotein primer and the second nucleoprotein primer are contacted with a double-stranded target sequence to form a first double-stranded structure in the first portion of the first strand and a double-stranded structure in the second portion of the second strand, so that the 3' ends of the first nucleic acid primer and the second nucleic acid primer are facing each other on the given template DNA molecule. Third, the 3' ends of the first nucleoprotein primer and the second nucleoprotein primer are extended by DNA polymerase to produce a first double-stranded nucleic acid and a second double-stranded nucleic acid, as well as a first substitution strand and a second substitution strand of the nucleic acid. Steps two and three are repeated until the desired degree of amplification is achieved.
[0102] This disclosure also provides a method for performing nested RPA within a microfluidic cylinder or device. In nested RPA, a first region of nucleic acid is amplified by RPA to form a first amplified region. A second region of nucleic acid, completely within the first amplified region, is then amplified by RPA to form a second amplified region. This process can be repeated multiple times. For example, a third region of nucleic acid, completely within the second region, can be amplified from the second amplified region by RPA.
[0103] The RPA reagents disclosed herein may contain a set of primers for amplifying a target nucleic acid sequence. Primers may include sequences complementary to the target nucleic acid sequence or sequences different from the target nucleic acid sequence at one or more positions. As described herein, RPA amplification products using primers different from the target nucleic acid sequence at one or more positions may differ from the target sequence at one or more positions. The amplification products of the RPA reaction described herein may include the target cleavage sequence.
[0104] This set of RPA primers can amplify a target nucleic acid sequence or introduce a sequence that differs from the target nucleic acid sequence at one or more positions. This introduced sequence can consist of a target cleavage sequence. The first primer can be complementary to the target nucleic acid sequence. The second primer can include a first portion complementary to the target nucleic acid sequence and a second portion that differs from the target nucleic acid sequence at one or more positions. When both primers amplify the nucleic acid sequence, the second primer incorporates one or more different positions into the amplification product. This amplified region differs from the target nucleic acid sequence at one or more positions and can consist of a target cleavage sequence.
[0105] The RPA compositions disclosed herein contain recombinases that may be derived from prokaryotes, viruses, or eukaryotes. Exemplary recombinases include RecA and UvsX (e.g., RecA or UvsX proteins obtained from any species) and fragments or mutants thereof, as well as combinations thereof. RecA and UvsX proteins can be obtained from any species. RecA and UvsX fragments or mutant proteins can also be produced using available RecA and UvsS proteins and nucleic acid sequences, as well as molecular biology techniques (see, for example, the mutant form of UvsX described in U.S. Patent No. 8,071,308). Exemplary UvsX proteins include those derived from the following: myoviridae phages, such as T4, T2, T6, Rb69, Aeh1, KVP40, Acinetobacter phage 133, Aeromonas phage 65, cyanophage P-SSM2, cyanophage PSSM4, cyanophage S-PM2, Rb14, Rb32, Aeromonas phage 25, Vibrio phage nt-1, phi-1, Rb16, Rb43, phage 31, phage 44RR2.8t, Rb49, phage Rb3, and phage LZ2. Other exemplary recombinase proteins include archaea RADA and RADB proteins and eukaryotic (e.g., plant, mammal, and fungal) Rad51 proteins (e.g., RAD51, RAD51B, RAD51C, RAD51D, DMC1, XRCC2, XRCC3, and recA) (see, for example, Lin et al., Proc. Natl. Acad. Sci. USA 103:10328-10333, 2006).
[0106] In any process of this disclosure, the recombinase (e.g., UvsX) can be a mutant or hybrid recombinase. In some embodiments, a mutant UvsX is an Rb69UvsX comprising at least one mutation in the Rb69UvsX amino acid sequence, wherein the mutation is selected from the group consisting of: (a) an amino acid at position 64 that is not histidine, a serine at position 64, one or more glutamic acid residues added to the C-terminus, one or more aspartic acid residues added to the C-terminus, and combinations thereof. In other embodiments, a mutant UvsX is a T6UvsX comprising at least one mutation in the T6UvsX amino acid sequence, wherein the mutation is selected from the group consisting of: (a) an amino acid at position 66 that is not histidine; (b) a serine at position 64; (c) one or more glutamic acid residues added to the C-terminus; (d) one or more aspartic acid residues added to the C-terminus; and (e) combinations thereof. When using a hybrid recombinase protein, the hybrid protein can be, for example, a UvsX protein comprising at least one region comprising an amino acid sequence derived from a different UvsX species. The region can be, for example, the DNA-binding loop-2 region of UvsX.
[0107] The DNA polymerases disclosed herein can be eukaryotic or prokaryotic polymerases. Examples of eukaryotic polymerases include pol-α, pol-β, pol-δ, pol-ε, and their mutants or fragments, or combinations thereof. Examples of prokaryotic polymerases include *Escherichia coli* DNA polymerase I (e.g., the Klenow fragment), bacteriophage T4gp43 DNA polymerase, large fragment of *Bacillus stearothermophilus* polymerase I, Phi-29 DNA polymerase, T7 DNA polymerase, *Bacillus subtilis* Pol I, *Staphylococcus aureus* Pol I, *Escherichia coli* DNA polymerase I, *Escherichia coli* DNA polymerase II, *Escherichia coli* DNA polymerase III, *Escherichia coli* DNA polymerase IV, *Escherichia coli* DNA polymerase V, and their mutants or fragments, or combinations thereof. In some embodiments, the DNA polymerase lacks 3'-5' exonuclease activity. In some implementations, the DNA polymerase has strand substitution properties, such as large fragments of pol I or pol V class prokaryotic polymerases.
[0108] In addition, one or more single-stranded DNA-binding proteins can be used to stabilize nucleic acids during various exchange reactions in the reaction. One or more single-stranded DNA-binding proteins can be derived from or obtained from any species, such as prokaryotes, viruses, or eukaryotic species. Non-limiting illustrative single-stranded DNA-binding proteins include *Escherichia coli* SSB and DNA-binding proteins derived from: Myocaudal phages, such as T4, T2, T6, Rb69, Aeh1, KVP40, *Acinetobacter* phage 133, *Aeromonas* phage 65, cyanophage P-SSM2, cyanophage PSSM4, cyanophage S-PM2, Rb14, Rb32, *Aeromonas* phage 25, *Vibrio* phage nt-1, phi-1, Rb16, Rb43, phage 31, phage 44RR2.8t, Rb49, phage Rb3, and phage LZ2. Other examples of single-stranded DNA-binding proteins include A. denitrificans Alide_2047, Burkholderia thailandensis BthaB_33951, Prevotella pallens HMPREF9144_0124, and the eukaryotic single-stranded DNA-binding protein replication protein A.
[0109] Any RPA process disclosed herein can be performed in the presence of a crowding agent. In some embodiments, the crowding agent may include polyethylene glycol, polyethylene oxide, polyvinyl alcohol, polystyrene, Ficoll, dextran, poly(vinylpyrrolidone) (PVP), Triton-X, and albumin. In some embodiments, the crowding agent has a molecular weight of less than 200,000 Daltons. In some embodiments of any aspect described herein, the composition comprises a crowding agent selected from the group consisting of: polyethylene glycol (PEG) (e.g., PEG1450, PEG3000, PEG8000, PEG10000, PEG14000, PEG15000, PEG20000, PEG250000, PEG30000, PEG35000, PEG40000, PEG compounds with a molecular weight between 15,000 and 20,000 Daltons, or combinations thereof), dextran, polyvinyl alcohol, polyvinylpyrrolidone, Triton-X, and Ficoll. In some embodiments, the crowding agent is present in the reaction mixture at a concentration between 1% and 15% by weight or volume of the reaction mixture, for example, between any two concentration values selected from 1.0%, 1.5%, 2.0%, 2.5%, 3.0%, 3.5%, 4.0%, 4.5%, 5.0%, 5.5%, 6.0%, 6.5%, 7.0%, 7.5%, 8.0%, 8.5%, 9.0%, 9.5%, 10.0%, 10.5%, 11.0%, 11.5%, 12.0%, 12.5%, 13.0%, 13.5%, 14.0%, 14.5%, and 15.0%.
[0110] If a recombinase-loaded protein is used, it can be of prokaryotic, viral, or eukaryotic origin. Exemplary recombinase-loaded proteins include *Escherichia coli* RecO, *Escherichia coli* RecR, UvsY, and their mutants or fragments, or combinations thereof. Exemplary UvsY proteins include those derived from: Myocaudal phages, such as T4, T2, T6, Rb69, Aeh1, KVP40, *Acinetobacter* phage 133, *Aeromonas* phage 65, cyanophage P-SSM2, cyanophage PSSM4, cyanophage S-PM2, Rb14, Rb32, *Aeromonas* phage 25, *Vibrio* phage nt-1, phi-1, Rb16, Rb43, phage 31, phage 44RR2.8t, Rb49, phage Rb3, and phage LZ2. In any of the processes disclosed herein, the recombinase loading agent may be derived from Myocaudalidae phages. Myocaudalidae phages may be, for example, T4, T2, T6, Rb69, Aeh1, KVP40, Acinetobacter spp. phage 133, Aeromonas spp. phage 65, cyanophage P-SSM2, cyanophage PSSM4, cyanophage S-PM2, Rb14, Rb32, Aeromonas spp. phage 25, Vibrio spp. phage nt-1, phi-1, Rb16, Rb43, phage 31, phage 44RR2.8t, Rb49, phage Rb3, or phage LZ2.
[0111] The amplification methods applicable to the present invention include amplification methods in which the polynucleotide does not undergo sufficient temperature to denature the double-stranded polynucleotide during amplification. For example, the amplification of the polynucleotide can be performed at temperatures exceeding about 90°C, about 80°C, about 70°C, or about 60°C during amplification. In embodiments, the amplification of the polynucleotide is performed under conditions that do not undergo sufficient denaturation of the double-stranded polynucleotide during amplification. For example, the amplification can be performed under physical, chemical, or thermal conditions that do not undergo sufficient denaturation of the double-stranded polynucleotide during amplification.
[0112] The amplification methods applicable to the present invention include amplification methods that involve performing the amplification at temperatures where the polynucleotide does not first undergo sufficient denaturation to the double-stranded polynucleotides present in the sample. For example, the amplification of the polynucleotide can be performed at temperatures where the polynucleotide does not first undergo denaturation above about 90°C, about 80°C, about 70°C, about 60°C, or about 55°C. In some embodiments, the polynucleotide and / or its amplicon is detected at such excessive temperatures. In some embodiments, the amplification of the polynucleotide is performed under conditions where the polynucleotide does not first undergo sufficient denaturation to the double-stranded polynucleotides present in the sample. For example, the amplification can be performed under physical, chemical, or thermal conditions where the polynucleotide does not first undergo sufficient denaturation to the double-stranded polynucleotides present in the sample.
[0113] The amplification method applicable to the method of the present invention includes an amplification method performed over a total time (T), which begins with a step of combining the polynucleotide with sufficient reagents for amplification and ends when the amplification has been performed in a sufficient amount to allow for qualitative or quantitative determination of the polynucleotide or its amplicon. In any such embodiment, the total time T may be about 45 minutes or less, about 30 minutes or less, about 20 minutes or less, or about 15 minutes or less.
[0114] Polynucleotide amplification includes, for example, polynucleotide amplification of at least about 10 6 Times, at least about 10 7 Times, at least about 10 8 Times, at least about 10 9 Times, at least about 10 10 Times, at least about 10 11 times or at least about 10 12 This type of amplification can occur within time T.
[0115] The amplification methods applicable to the methods of this invention include “real-time” or “quantitative” polynucleotide amplification methods known to those skilled in the art. These methods detect the accumulation of polynucleotide amplification products after each amplification cycle in real time as the reaction progresses, thereby allowing for the determination of amplification kinetics. Real-time methods are quantitative because the time (e.g., the number of cycles) to reach a specific threshold concentration of the amplification product is directly related to the initial copy number of the target nucleotide. According to some embodiments, the amplification reaction is monitored by electrochemical detection using the oligonucleotide probes described herein. Example
[0116] Example 1: Nested RPA Amplification Figures 19A-19D The results represent the analysis performed using a nested RPA method on a microfluidic card as described herein. The results demonstrate that nested RPA assays can distinguish samples with different known targets. Samples were obtained from a commercial supplier of influenza-positive and influenza-negative sample materials. A series of measurements were performed using a total of ninety samples: thirty samples were known to be positive for influenza A (Inf A), ten samples were known to be positive for influenza B (Inf B), and fifty samples were known to be negative for either influenza A or B. Each sample was applied to a single assay device, and measurements were obtained from each of the four detection chambers on the assay card.
[0117] exist Figures 19A-19DIn each experiment shown, the reaction products were detected using fluorescently labeled probes. Detection of the RPA reagent using labeled probes is as previously described and typically includes at least one probe with a detectable label for detecting the amplification target (if present). The probe may include fluorine and a quencher, which are separated upon cleavage by a nuclease when the probe hybridizes to a complementary polynucleotide sequence (if present in the amplification reaction products). When samples were tested using electrochemically labeled probes, similar results (not shown) were obtained using ninety samples to differentiate whether the samples were influenza A-positive, influenza B-positive, or negative controls.
[0118] The combined results of fluorescence and electrochemical probe measurements are depicted in Tables 2A-2D. Each table includes comparative measurements performed using standard commercial qPCR assays conducted by the supplier of the influenza sample materials. qPCR was performed by the commercial supplier of the sample materials upon sample acquisition, and the results were used to classify the samples as positive or negative, and as fluA or fluB; the classified samples were appropriately stored and supplied in virus delivery medium (VTM). VTM had no significant effect on RPA performance.
[0119] Table 2A. Fluorescence detection of influenza A samples Table 2B. Fluorescence detection of influenza B samples Table 2C. Electrochemical detection of influenza A samples Table 2D. Electrochemical detection of influenza B samples Because the nucleic acid sequence of influenza A is known to change frequently from year to year, the RPA assay was developed to incorporate two different primer and probe sets targeting different nucleotide regions to maximize the likelihood of identifying samples that are positive for influenza A.
[0120] Primers and probes used in the RPA assays described herein are listed below as SEQ ID NOs 1 through 21. During the first round of nested amplification, the major primer sequence is used to contact the entire sample in the first reaction chamber for major amplification. The major amplification product is then used to contact minor primers and probes in individual minor reaction chambers to specifically amplify the corresponding target material using InfAPA, InfAPB2, InfB PA, and IC, thereby generating a signal as long as fluA or fluB is present in the patient sample. When probes are used for fluorescence measurements, these probes are designed to be cleaved by exonuclease III (Exo); probes for electrochemistry are designed to be used with the nuclease 8-oxoguanine DNA glycosylase (fpg). Examples of suitable electrochemical probes are described in co-pending application PCT / US2017 / 019446, filed February 24, 2017, and are incorporated herein by reference in their entirety.
[0121] InfA[PA] main amplification primers >FluAPAR111 TGCATGTGTGAGGAAGGAGTTGAACCAAG*A(SEQ ID NO.1) >FluAPAF523 AAATTGCTTTCTCATTGTTCAGGCACTTAGGG*A(SEQ ID NO.2) InfA[PB2] main amplification primers >FluAPB2F201 GAACTGAGTAACCTTGCAAARGGGGAAAAGG*C(SEQ ID NO.3) FluAPB2F218 GAACTGAGTAACCTTGCAAAAGGGGAAAAAG*C(SEQ ID NO.4) FluAPB2R103 AYTAATTGATGGCCATCCGAATTCTTTTGGTCGCT*G(SEQ ID NO.5) InfB[PA] main amplification primers >FluBPAF44 AAGGATTGGCTGATGATTACTTTTGGAAAAAGAAA*G(SEQ ID NO.6) FluBPAR42 TAATTCAGCCTGAAGTTCTGTGAGTCTGCTTAG*C(SEQ ID NO.7) Xcon main amplification primers XConF7 AATCATGAACCTCATGGCATCTTCCCTCGCCGC*C(SEQ ID NO.8) XConR6 ACAATGCAATCATATGCTTCTGCTATGTTAAGC*G(SEQ ID NO.9) InfA[PA] Secondary amplification primers >FLUPAF507ii AACCTGGGACCTTTGATCTTGGGGGGCTATAT*G(SEQ ID NO.10) >FLUAPAR106ii ATGTGTTAGGAAGGAGTTGAACCAAGAAGCAT*T(SEQ ID NO.11) InfA[PA]Exo probe >FluAPAExoP12dFAM F=dT-FAM,H=THF (base-free mimic),Q=dT-BHQ-1,3'=blocks C3 spacer GAACCAAGATGCATTRAGCAAAACCCAGGGAFHAQTAATCAGGCACTC(SEQ ID NO.12) InfA[PB2] secondary amplification primers FluAPB2F403 AATGTGCTAATYGGGCAAGGAGACGTGGTGTTG*G(SEQ ID NO.13) FluAPB2R703 GGCCATCCGAATTCTTTTGGTCGCTGTCTGG*C(SEQ ID NO.14) InfA[PB2]Exo probe >FluAPB2ExoP2 F=dT-FAM,H=THF (base-free mimic),Q=dT-BHQ-1,3'=blocks C3 spacer CGAATTCTTTTGGTCGCTGTCTGGCTGTCAGTAAGFHQGCTAGAGTCCCG(SEQ ID NO.15) InfB[PA] Secondary amplification primers >MSFBPA_F6+1-2 GGAAAAAGAAAGAAAAGCTGGGAAATAGCATG*G(SEQ ID NO.16) >MSFBPA_R6+1 GCTTAGCACTCTCCCTTTCCCTCTCCTCATCCAAT*G(SEQ ID NO.17) InfB[PA]Exo probe >MSFBPAx1 F=dT-FAM,H=THF (base-free mimic),Q=dT-BHQ-1,3'=blocks C3 spacer ACTGATGATATTCAGCTACAATCAAGACFAHQCGTTAAGTAATGAA(SEQ ID NO.18) Xcon secondary amplification primers XConR13 TTCCAGTCAGTCCTAGTCAGAAACGGTCCTTAGAC*G(SEQ ID NO.19) >APOBEXTF GCCAGGTTTATAGCACACTTGTCACCTA*C(SEQ ID NO.20) Xcon Exo probe >APOB1FAM F=dT-FAM,H=THF (base-free mimic),Q=dT-BHQ-1,3'=blocks C3 spacer GCCAGGTTTATAGCACACTTGTCACCTACAQTHCFGATTGGTGGACTCT(SEQ ID NO.21) Figure 19A This represents the results obtained when 90 samples were exposed to InfAPARPA primers and probes. The results showed that the InfAPA primers detected 24 out of 30 InfA-positive samples; none of the InfB or negative samples showed a reaction with the InfAPA primers. Figure 19B The results show that all InfA samples provided a positive reaction when exposed to the InfAPB2 primers and probe; neither InfB nor negative samples showed any reaction with the InfAPB2 primers and probe. Figure 19C The results show that all InfB samples gave a positive reaction when exposed to InfB PA primers and probes; InfA and negative control samples did not give any reaction. Figure 19DThis indicates that no sample showed a positive signal when the negative control primer (Xcon) and probe were used.
[0122] exist Figures 19A-19D In each of the data, the dashed line represents the baseline threshold, which is measured as three standard deviations above the maximum negative result. The data demonstrate that the combined use of RPA primers and probes targeting the InfAPA and InfAPB2 regions can identify influenza A-positive samples with 100% accuracy, proving that the assay format described herein can successfully detect the presence of influenza viruses with different nucleotide sequences.
[0123] Other implementation plans Many embodiments of the invention have been described. However, it should be understood that various modifications can be made without departing from the spirit and scope of the invention. Therefore, other embodiments are within the scope of the following claims.
[0124] This invention includes the following: 1. A method comprising: Providing samples to a microfluidic device; and Amplifying the target polynucleotide sequence in the sample, wherein the amplification includes: The sample is subjected to a first round of amplification to obtain a first amplification product; and The first amplification product is subjected to a second round of amplification to obtain a second amplification product, wherein the second amplification product contains a smaller sequence that is completely contained within the first amplification product generated during the first round of amplification.
[0125] 2. The method of Project 1, further comprising detecting the second amplification product.
[0126] 3. The method as described in Project 2, wherein the detection of the second amplification product includes: The second amplification product was labeled with a first oligonucleotide linked to a fluorophore and a quencher to obtain a labeled second product; The quencher is cleaved from the labeled second amplification product; and Optical detection of the signal from the fluorophore, wherein a detectable signal indicates the presence of the second amplification product.
[0127] 4. The method as described in Project 3, wherein the cleavage of the quencher is performed using a nuclease.
[0128] 5. As described in Project 4, the nuclease targets double-stranded DNA.
[0129] 6. The method as described in Project 5, wherein the nuclease is a formamidopyrimidine-DNA glycosylase.
[0130] 7. The method as described in Project 2, wherein the detection of the second amplification product includes: The second amplification product is labeled with a first oligonucleotide linked to a redox moiety to obtain a labeled second amplification product; The redox moiety is cleaved from the labeled second amplification product; and Electrochemical detection of the signal from the cleaved redox moiety, wherein a detectable signal indicates the presence of the second amplification product.
[0131] 8. The method of Project 7, wherein the redox portion is selected from the group consisting of: phenothiazines, phenoxazines, ferrocene, ferricyanides, ruthenium(III), osmium(II), anthraquinones, phenothiazines and their derivatives.
[0132] 9. The method as described in Project 7, wherein the redox cleavage is performed using a nuclease.
[0133] 10. The method as described in Project 9, wherein the nuclease targets double-stranded DNA.
[0134] 11. The method of Project 10, wherein the nuclease is a formamidopyrimidine-DNA glycosylase.
[0135] 12. The method described in Project 1, further comprising: The second amplification product is amplified a third time to obtain a third amplification product; and the third amplification product is detected, wherein the third amplification product contains a smaller sequence that is completely contained within the second amplification product generated during the second amplification period.
[0136] 13. The method as described in Project 1, wherein the sample is obtained from an animal.
[0137] 14. The method of Item 13, wherein the sample obtained from the animal is obtained from the animal's blood, sputum, mucus, saliva, tears, or urine.
[0138] 15. The method as described in Item 13, wherein the sample is obtained from a human.
[0139] 16. The method of Project 1, wherein the target polynucleotide sequence is contained within the target nucleic acid.
[0140] 17. The method of Item 16, wherein the target nucleic acid is obtained from an animal pathogen.
[0141] 18. The method as described in Item 17, wherein the animal pathogen is a single-stranded DNA virus, a double-stranded DNA virus, or a single-stranded RNA virus.
[0142] 19. The method as described in Item 17, wherein the animal pathogen is a bacterium.
[0143] 20. The method of Item 16, wherein the target nucleic acid is double-stranded DNA, single-stranded DNA, or RNA.
[0144] 21. The method of Project 16, wherein the target nucleic acid is selected from the group consisting of: genomic DNA, plasmid DNA, viral DNA, mitochondrial DNA, cDNA, synthetic double-stranded DNA, and synthetic single-stranded DNA.
[0145] 22. The method as described in Project 16, wherein the target nucleic acid is viral DNA or viral RNA.
[0146] 23. The method as described in Item 17, wherein the animal pathogen is an influenza A virus or an influenza B virus.
[0147] 24. The method of Project 1, wherein two or more target polynucleotide sequences in the sample are amplified.
[0148] 25. The method of Item 24, wherein a target polynucleotide sequence containing an influenza A gene sequence and a target polynucleotide sequence containing an influenza B gene sequence are amplified.
[0149] 26. The method of Project 2, wherein two or more second amplification products are detected.
[0150] 27. The method of Item 26, wherein a second amplification product containing an influenza A gene sequence and a second amplification product containing an influenza B gene sequence are detected.
[0151] 28. A diagnostic card comprising: Card body, the card body comprising: (i) a main reaction chamber configured to perform a first nucleic acid amplification on a sample fluid within the reaction chamber to form a first amplification product; and (ii) One or more secondary reaction chambers, each secondary reaction chamber being configured to perform a second nucleic acid amplification on the first amplification product to form a second amplification product; A channel for supplying the sample fluid to the main reaction chamber; One or more detection chambers, said one or more detection chambers being fluidly connected to said one or more secondary reaction chambers; and A detection module, which is associated with each detection chamber.
[0152] 29. The diagnostic card as described in item 28, wherein the detection module is an optical module.
[0153] 30. The diagnostic card as described in item 28, wherein the detection module is a fluorescence detector.
[0154] 31. The diagnostic card as described in item 30, wherein the fluorescence detector includes a single light guide for directing illumination light to the one or more detection chambers, and discrete light guides for receiving reflected light from each detection chamber.
[0155] 32. The diagnostic card as described in item 28, wherein the detection module is an electrode module.
[0156] 33. The diagnostic card as described in item 32, wherein the detection module includes a series of conductive traces terminating in electrodes in each detection chamber.
[0157] 34. The diagnostic card as described in item 32, wherein the device includes additional conductive traces and electrodes for detecting the position of liquid in the microfluidic card.
[0158] 35. The diagnostic card as described in item 28, wherein the amplification includes a recombinase polymerase amplification (RPA) reaction.
[0159] 36. The diagnostic card as described in item 28 further includes a mixing component, a pump, and a connection port for connecting to the sample module.
[0160] 37. The diagnostic card as described in item 28, wherein the main reaction chamber is connected to a heater.
[0161] 38. The diagnostic card as described in item 28, wherein the main reaction chamber includes or is connected to a mixing component.
[0162] 39. A diagnostic card as described in Item 28, wherein each secondary reaction chamber contains a reagent.
[0163] 40. The diagnostic card as described in item 39, wherein the reagent comprises RPA reagent.
[0164] 41. The diagnostic card as described in item 40, wherein the RPA reagent is freeze-dried.
[0165] 42. The diagnostic card as described in item 28, wherein the main reaction chamber contains reagents.
[0166] 43. The diagnostic card as described in item 42, wherein the reagent comprises RPA reagent.
[0167] 44. The diagnostic card as described in item 43, wherein the RPA reagent is freeze-dried.
[0168] 45. The diagnostic card as described in item 28, wherein the sample fluid is a sample obtained from an animal.
[0169] 46. The diagnostic card as described in item 45, wherein the sample obtained from the animal is obtained from the animal's blood, sputum, mucus, saliva, tears, or urine.
[0170] 47. The diagnostic card as described in item 45, wherein the sample fluid is a sample obtained from a human.
[0171] 48. The diagnostic card as described in item 28, wherein the sample fluid contains target nucleic acid.
[0172] 49. The diagnostic card as described in item 48, wherein the target nucleic acid is obtained from an animal pathogen.
[0173] 50. The diagnostic card as described in item 49, wherein the animal pathogen is a single-stranded DNA virus, a double-stranded DNA virus, or a single-stranded RNA virus.
[0174] 51. The diagnostic card as described in item 49, wherein the animal pathogen is a bacterium.
[0175] 52. The diagnostic card as described in item 48, wherein the target nucleic acid is double-stranded DNA, single-stranded DNA, or RNA.
[0176] 53. The diagnostic card as described in item 48, wherein the target nucleic acid is selected from the group consisting of: genomic DNA, plasmid DNA, viral DNA, mitochondrial DNA, cDNA, synthetic double-stranded DNA, and synthetic single-stranded DNA.
[0177] 54. The diagnostic card as described in item 48, wherein the target nucleic acid is viral DNA or viral RNA.
[0178] 55. The diagnostic card as described in item 49, wherein the animal pathogen is an influenza A virus or an influenza B virus.
[0179] 56. The diagnostic card as described in Item 28, wherein the second amplification product is generated 30 minutes or less, 15 minutes or less, 10 minutes or less, or 5 minutes or less after the sample fluid is delivered to the diagnostic card.
[0180] 57. The diagnostic card as described in item 28, wherein the diagnostic card is disposable.
[0181] 58. The diagnostic card as described in Item 28 further includes additional reaction chambers, each configured to perform an additional round of nucleic acid amplification reaction to form additional amplification products, such that the amplification products from each of each successive n+1 rounds of amplification are smaller sequences completely contained within the amplification products of the preceding nth round.
[0182] 59. A reader configured to receive a diagnostic card as described in item 28, the reader including a detector configured to detect the presence of the second amplification product in the secondary reaction chamber.
[0183] 60. A nucleic acid amplification device, comprising: A first reaction chamber, the first reaction chamber being fluidly connected to a first inlet and a first outlet; A second reaction chamber, which is fluidly connected to a second inlet and a second outlet; Testing room; A first pump, wherein the first inlet is fluidly connected to the first reaction chamber via the first pump and the first outlet is fluidly connected to the first reaction chamber; A second pump, wherein the first reaction chamber is fluidly connected to the second reaction chamber via the second pump and the second outlet is fluidly connected to the second reaction chamber; A third pump, wherein the second inlet is fluidly connected to the second reaction chamber via the third pump.
[0184] 61. The nucleic acid amplification device as described in item 60, wherein the nucleic acid amplification device is a microfluidic device.
[0185] 62. The nucleic acid amplification apparatus as described in Item 60, wherein the first reaction chamber contains reagents.
[0186] 63. The nucleic acid amplification apparatus as described in item 62, wherein the first reaction chamber contains a catalyst.
[0187] 64. The nucleic acid amplification apparatus as described in item 63, wherein the catalyst comprises magnesium.
[0188] 65. The nucleic acid amplification apparatus of Item 60, further comprising a reagent reservoir, wherein the second pump and the third pump are fluidly connected to each second reaction chamber via the first reagent reservoir.
[0189] 66. The nucleic acid amplification apparatus as described in Item 60, wherein the second pump and the third pump are fluidly connected to each second reaction chamber via a first reagent reservoir and a second reagent reservoir.
[0190] 67. The nucleic acid amplification apparatus as described in item 66, wherein the first reagent reservoir and the second reagent reservoir are connected in series.
[0191] 68. The nucleic acid amplification apparatus as described in item 67, wherein the first reagent reservoir comprises an oligomer.
[0192] 69. The nucleic acid amplification apparatus as described in item 67, wherein the second reagent reservoir comprises magnesium.
[0193] 70. The nucleic acid amplification apparatus as described in Item 66, wherein each second reaction chamber is a detection chamber.
[0194] 71. The nucleic acid amplification apparatus as described in item 70, wherein a portion of each detection chamber is optically transparent.
[0195] 72. The nucleic acid amplification apparatus as described in item 70 further includes electrodes connected to each detection chamber.
[0196] 73. The nucleic acid amplification device as described in item 72, wherein three electrodes are connected to each detection chamber.
[0197] 74. The nucleic acid amplification device as described in Project 60 further includes a fluid detection zone.
[0198] 75. The nucleic acid amplification apparatus as described in item 74, wherein the first pump and the first reaction chamber are connected via a first detection zone.
[0199] 76. The nucleic acid amplification apparatus as described in item 74, wherein the second pump and the second reaction chamber are connected via a second detection zone.
[0200] 77. The nucleic acid amplification apparatus as described in item 74, wherein the third pump and the second reaction chamber are connected via a third detection zone.
[0201] 78. The nucleic acid amplification apparatus as described in item 74, wherein the third pump and the first reaction chamber are connected via a fourth detection zone.
[0202] 79. The nucleic acid amplification device as described in item 74, wherein a portion of each detection area is optically transparent.
[0203] 80. The nucleic acid amplification apparatus as described in Item 74 further includes a flow detection chamber connected to each detection zone.
[0204] 81. The nucleic acid amplification apparatus as described in Item 60, further comprising a heater connected to the first reaction chamber.
[0205] 82. The nucleic acid amplification apparatus as described in Item 60, wherein the first reaction chamber includes a stirrer.
[0206] 83. The nucleic acid amplification apparatus of Item 60, wherein the first pump is configured to provide a sample to be delivered to the nucleic acid amplification apparatus to the first reaction chamber via the first inlet.
[0207] 84. The nucleic acid amplification apparatus of Item 60, wherein the second pump and the third pump are configured to combine reagents delivered to the body of the nucleic acid amplification apparatus via the second inlet with products from the first reaction chamber to obtain a reaction mixture.
[0208] 85. The nucleic acid amplification apparatus of item 84, wherein the second pump and the third pump are configured to provide a portion of the reaction mixture to each of the second reaction chambers.
Claims
1. A method comprising: Provide the sample to the microfluidic device; as well as Amplifying the target polynucleotide sequence in the sample, wherein the amplification includes: The sample was subjected to a first round of amplification to obtain a first amplification product; as well as The first amplification product is subjected to a second round of amplification to obtain a second amplification product, wherein the second amplification product contains a smaller sequence that is completely contained within the first amplification product generated during the first round of amplification.
2. The method of claim 1, further comprising detecting the second amplification product.
3. The method of claim 2, wherein the detection of the second amplification product comprises: The second amplification product was labeled with a first oligonucleotide linked to a fluorophore and a quencher to obtain a labeled second product; The quencher is cleaved from the labeled second amplification product; as well as Optical detection of the signal from the fluorophore, wherein a detectable signal indicates the presence of the second amplification product.
4. The method of claim 3, wherein the cleavage of the quencher is performed using a nuclease.
5. The method of claim 4, wherein the nuclease targets double-stranded DNA.
6. The method of claim 5, wherein the nuclease is a formamidopyrimidine-DNA glycosylase.
7. The method of claim 2, wherein the detection of the second amplification product comprises: The second amplification product is labeled with a first oligonucleotide linked to a redox moiety to obtain a labeled second amplification product; The redox moiety is cleaved from the labeled second amplification product; as well as Electrochemical detection of the signal from the cleaved redox moiety, wherein a detectable signal indicates the presence of the second amplification product.
8. The method of claim 7, wherein the redox portion is selected from the group consisting of phenothiazines, phenothiazines, ferrocene, ferricyanides, ruthenium(III), osmium(II), anthraquinones, phenothiazines, and their derivatives.
9. The method of claim 7, wherein the redox cleavage is performed using a nuclease.
10. The method of claim 9, wherein the nuclease targets double-stranded DNA.
Citation Information
Patent Citations
Nicking and extension amplification reaction for the exponential amplification of nucleic acids
US20090017453A1
Recombinase polymerase amplification
US20090029421A1
Nicking and extension amplification reaction for the exponential amplification of nucleic acids
US20090081670A1
Recombinase polymerase amplification
US7270981B2
Recombinase polymerase amplification
US7399590B2