VACTERL association marker, method for constructing an animal model and use thereof

CN122609702APending Publication Date: 2026-08-21SOUTH CHINA UNIV OF TECH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510197978.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-02-21
Publication Date
2026-08-21

AI Technical Summary

Benefits of technology

[0004] The present invention aims to at least partially address one of the technical problems existing in the prior art. To this end, the present invention provides a marker for VACTERL syndrome, namely the MED14 gene or MED14 protein, which can be used for prenatal diagnosis, newborn screening, auxiliary diagnosis, and as a target for constructing animal models of VACTERL syndrome, revealing the function and molecular mechanism of MED14 in embryonic development.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0005282064630000011
    Figure HDA0005282064630000011
  • Figure HDA0005282064630000021
    Figure HDA0005282064630000021
  • Figure HDA0005282064630000031
    Figure HDA0005282064630000031
Patent Text Reader

Abstract

The application provides a VACTERL association marker, a method for constructing an animal model and application of the method. The VACTERL association marker comprises a MED14 gene or a MED14 protein. The inventors find that by detecting a coding sequence of the MED14 gene or an amino acid sequence of the MED14 protein in a blood sample of an individual, whether the individual has the VACTERL association can be effectively evaluated, and a strong basis for diagnosis of the VACTERL association is provided. In addition, the MED14 gene or the MED14 protein can be used as a marker for construction of an animal model of the VACTERL association.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to a VACTERL syndrome marker, a method for constructing an animal model, and their uses. Background Technology

[0002] VACTERL syndrome is a rare group of multiple congenital malformations that include congenital developmental abnormalities in six major systems of the human body: vertebral defects (V), anal atresia (A), cardiac defects (C), tracheoesophageal fistula with esophageal atresia (TEF), renal dysplasia (R), and limb / radial defects (L). These malformations often occur in a non-random combination; clinically, diseases with at least three or more malformations are collectively referred to as VACTERL syndrome.

[0003] Therefore, it is of great significance to provide a biomarker for early diagnosis of VACTERL syndrome so that early intervention and treatment can be carried out. Summary of the Invention

[0004] The present invention aims to at least partially address one of the technical problems existing in the prior art. To this end, the present invention provides a marker for VACTERL syndrome, namely the MED14 gene or MED14 protein, which can be used for prenatal diagnosis, newborn screening, auxiliary diagnosis, and as a target for constructing animal models of VACTERL syndrome, revealing the function and molecular mechanism of MED14 in embryonic development.

[0005] Therefore, in a first aspect, the present invention proposes a biomarker for VACTERL syndrome. According to embodiments of the invention, the biomarker comprises the MED14 gene or the MED14 protein. The inventors have discovered that by detecting the coding sequence of the MED14 gene or the amino acid sequence of the MED14 protein in an individual's blood sample, the presence of VACTERL syndrome in an individual can be effectively assessed, providing strong evidence for the diagnosis of VACTERL syndrome. Furthermore, the MED14 gene or MED14 protein, as a biomarker, can be applied to the construction of animal models of VACTERL syndrome.

[0006] In a second aspect, the present invention proposes the use of the MED14 gene or MED14 protein as a biomarker, said biomarker having at least one of the following uses: for detecting VACTERL syndrome; or for constructing an animal model of VACTERL syndrome. The inventors have discovered that by detecting the coding sequence of the MED14 gene or the amino acid sequence of the MED14 protein in an individual's blood sample, the presence of VACTERL syndrome in an individual can be effectively assessed, providing strong evidence for the diagnosis of VACTERL syndrome. Furthermore, the MED14 gene or MED14 protein, as a biomarker, can be applied to the construction of an animal model of VACTERL syndrome.

[0007] In a third aspect, the invention proposes the use of reagents in the preparation of a kit for detecting VACTERL syndrome, wherein the reagents are used to detect the coding sequence of the MED14 gene or the amino acid sequence of the MED14 protein. As is known, detecting the amino acid sequence of the MED14 protein or the coding sequence of the MED14 gene in an individual's blood sample can effectively assess whether an individual has VACTERL syndrome, providing strong evidence for the diagnosis of VACTERL syndrome. Therefore, kits prepared using reagents for detecting the MED14 protein or the MED14 gene have advantages such as high detection accuracy or simple operation.

[0008] In a fourth aspect, the present invention provides a method for determining the origin of a sample. According to an embodiment of the present invention, the method includes: detecting the amino acid sequence of the MED14 protein or the coding sequence of the MED14 gene in a sample to be tested; and determining the origin of the sample to be tested based on the detection result of the amino acid sequence of the MED14 protein or the coding sequence of the MED14 gene. Thus, by using the method of the present invention, the origin of a sample to be tested can be determined by detecting the amino acid sequence of the MED14 protein or the coding sequence of the MED14 gene in the sample to be tested.

[0009] In a fifth aspect, this invention proposes a CRISPR-Cas9 gene targeting system for constructing an animal model of VACTERL syndrome. According to embodiments of the invention, the CRISPR-Cas9 gene targeting system comprises: sgRNA specifically targeting the MED14 gene and the Cas9 protein. Therefore, the CRISPR-Cas9 gene targeting system of this invention can efficiently construct an animal model of VACTERL syndrome, providing an important tool for further elucidating the pathogenic mechanism of VACTERL syndrome and screening small molecule drugs that can improve the VACTERL syndrome phenotype or reduce the incidence of VACTERL syndrome.

[0010] In a sixth aspect, the present invention provides a method for constructing an animal model of VACTERL syndrome. According to an embodiment of the present invention, the method comprises: injecting the CRISPR-Cas9 gene targeting system described in the fifth aspect into the fertilized egg of the animal to induce a mutation in the amino acid sequence of the MED14 protein or a mutation in the coding sequence of the MED14 gene of the animal, thereby obtaining the VACTERL syndrome animal model. Thus, the animal model constructed using the method described in this invention is a heritable, clinically based disease model that can be used to further elucidate the pathogenic mechanism of VACTERL syndrome and to screen small molecule drugs that can improve the VACTERL syndrome phenotype or reduce the incidence of VACTERL syndrome.

[0011] In a seventh aspect, the present invention provides an animal model. According to an embodiment of the invention, the animal model is constructed using the method described in the fifth aspect. Thus, the animal model of the present invention is a heritable, clinically based disease model that can be used to further elucidate the pathogenesis of VACTERL comorbidity and to screen small molecule drugs that can improve the VACTERL comorbidity phenotype or reduce the incidence of VACTERL comorbidity.

[0012] In an eighth aspect of the invention, the invention proposes uses of the animal model described in the seventh aspect. According to embodiments of the invention, the uses include at least one of the following: studying the pathogenic molecular mechanisms of VACTERL syndrome; screening potential therapeutics for VACTERL syndrome; and studying gene-environment interactions.

[0013] Additional aspects and advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention. Attached Figure Description

[0014] The above and / or additional aspects and advantages of the present invention will become apparent and readily understood from the description of the embodiments taken in conjunction with the following drawings, in which:

[0015] Figure 1 This is the clinical phenotype observed in a two-month-old male patient with VACTERL syndrome according to Embodiment 1 of the present invention; wherein,

[0016] a represents the median center of gravity as shown on a chest CT scan;

[0017] b is a polydactyly of the right hand detected through physical examination and X-ray imaging, located on the outer side of the right thumb;

[0018] c shows a congenital absence of the sacrococcygeal bone in a sagittal CT image (right side, compared with a normal sacrococcygeal bone on the left side);

[0019] d represents anal atresia (left side) and hypospadias (right side) discovered during a physical examination;

[0020] e shows the rectourethral fistula (left) as seen in a colonic contrast examination and concurrent cystourethrography, the ureteral reflux as seen in cystourethrography (middle), and the rectourethral fistula (right) as indicated by colonoscopy during anal reconstruction.

[0021] f represents the Sanger sequencing validation of the point mutation;

[0022] Figure 2 It is the zebrafish MED14 according to Embodiment 3 of the present invention. Δ17- / - Figure showing the construction and validation results of the mutant; where a represents MED14. Δ17- / - A schematic diagram of the mutation, with the red box indicating the target site of the PvuII enzyme;

[0023] b represents wild-type (square), heterozygous (triangular), and homozygous MED14 Δ17- / - PvuII enzyme digestion of (circular) zebrafish genomic DNA;

[0024] c represents wild-type and MED14 hatched between 24 and 96 hours later. Δ17- / - In vivo images of mutants;

[0025] d represents wild type and MED14 Δ17- / - The level of MED14 protein in mutant embryos;

[0026] Figure 3 It is the zebrafish MED14 according to Embodiment 2 of the present invention. Δ17- / - Phenotypic results of mutant embryos exhibiting VACTERL syndrome (the number to the right of the bottom right corner indicates the total number of embryos examined, while the number to the left indicates the number of embryos consistent with the image shown); among them,

[0027] a is MED14 Δ17- / - The mutant exhibits a defect in cardiac loop formation and hatches (hpf) after 48 hours in MED14 with a Tg(cmlc2-kalta4-p2a-mCherry) background. Δ17- / - Evaluation of heart tube loop formation in mutant or wild-type (WT) embryos (left) or whole in situ hybridization (WISH) using the cmlc2 probe (right). The percentage of affected embryos is indicated. Scale bar: 50 micrometers.

[0028] b refers to WT and MED14 hatched 3 to 5 days after hatching (dpf). Δ17- / - Alcian blue staining of mutants, scale bar: 100 micrometers;

[0029] c represents WT and MED14 after 9 days of incubation (dpf). Δ17- / - Alcian blue and alizarin red S staining of mutants;

[0030] d represents WT and MED14 at the specified time point. Δ17- / - A lateral live image of the cloaca of a mutant embryo;

[0031] e is WT and MED14 Δ17- / - α-PKC immunostaining of mutant embryos, with cell nuclei contrasted with DAPI staining, scale bar: 30 micrometers;

[0032] f is MED14 Δ17- / - Rhodamine dixylselan excretion assay of mutants, in which rhodamine dixylselan was injected into MED14 Δ17 The foregut of mutants or WT;

[0033] g is used to evaluate MED14 Δ17- / - Kidney function of mutants, WT and MED14 Δ17- / - The mutant was injected with 40-kDa rhodamine-labeled dixexlan via the cardiac sinus vein;

[0034] Figure 4 This is a schematic diagram illustrating the editing of the MED14 gene using CRISPR / Cas9 technology according to Embodiment 3 of the present invention;

[0035] Figure 5 The image shows the phenotype of VACTERL syndrome-like MED14-I556V mutant mice according to Example 3 of the present invention; wherein,

[0036] a) Examination of the internal organs of 3-month-old mice revealed a midline heart in MED14-I556V mice;

[0037] b shows representative images of shortened phalanges in MED14-I556V mice, obtained by measuring phalangeal bone length in WT (wild-type) and MED14-I556V mice at 3 months after birth.

[0038] c shows the measurement of phalangeal bone length in WT and MED14-I556V mice at 3 months after birth, and is a summary of measurements of shortened phalangeal bones in MED14-I556V mice, where D1 represents the nearest phalangeal bone at the bottom of the image.

[0039] d represents a miniature CT experiment showing that the sacrococcygeal joint is incompletely formed in approximately 20% of MED14-I556V mutant mice at E18.5 (day 18.5 of embryonic development). The affected area is magnified for better observation, where 'a' represents the sacrococcygeal bone in WT and 'a" represents the sacrococcygeal bone in the mutant.

[0040] e shows that HE staining (left) and PAS staining (right) on E18.5 indicate reduced glomerular size in some MED14-I556V mutant mice. Glomeruli are highlighted by arrows. Scale bar: 100 micrometers.

[0041] f represents the glomerular size of the WT and MED14-I556V mutants measured at E18.5. *p<0.05, p value was determined by an unpaired two-tailed Student's t-test. Detailed Implementation

[0042] The embodiments of the present invention are described in detail below. The embodiments described below are exemplary and are only used to explain the present invention, and should not be construed as limiting the present invention.

[0043] It should be noted that the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of indicated technical features. Therefore, a feature defined as "first" or "second" may explicitly or implicitly include one or more of that feature. Furthermore, in the description of this invention, unless otherwise stated, "a plurality of" means two or more.

[0044] To facilitate understanding of the invention, certain technical and scientific terms are specifically defined below. Unless otherwise expressly defined elsewhere in this document, all other technical and scientific terms used herein have the meanings commonly understood by one of ordinary skill in the art to which this invention pertains.

[0045] In this document, the terms “comprising” or “including” are open-ended expressions, meaning they include the contents specified in this invention but do not exclude other aspects.

[0046] In this document, the terms “optionally,” “optionally,” or “optionally” generally refer to an event or condition that may, but may not, occur, and the description includes both cases in which the event or condition occurs and cases in which the event or condition does not occur.

[0047] In this document, the term "marker" or "biomarker" should be interpreted broadly to include any detectable biological indicator that can reflect an abnormal state, which may include genetic markers, species markers (genus markers), and functional markers. The meaning of genetic marker is not limited to existing genes that can express and have biological activity as proteins, but also includes any nucleic acid fragment, which can be DNA or RNA, modified DNA or RNA, or unmodified DNA or RNA. Specifically, the biomarkers of this invention are protein or nucleic acid fragments.

[0048] Combined VACTERL malformation is a hereditary disorder affecting multiple organs, including the vertebrae, anus, trachea, esophagus, kidneys, heart, and limbs. It has a relatively high incidence, approximately 1 in 10,000 to 1 in 40,000, with males significantly more affected than females. However, its pathogenesis is poorly understood, and early diagnostic techniques and precise treatment options are lacking. Treatment for children with combined VACTERL malformation primarily involves surgical intervention for easily detectable malformations, such as esophageal and anal atresia. Defects in organs such as the spine, heart, and kidneys are often overlooked, posing a serious threat to the child's growth and development.

[0049] Furthermore, many key scientific questions regarding VACTERL syndactyly remain unanswered: What are the pathogenic genes for VACTERL syndactyly? Does it exhibit X-chromosome linkage? During embryonic mesoderm formation and differentiation into various lineages in patients with VACTERL syndactyly, at what developmental stage and for which cell type fate determination is impaired? What is the functional mechanism of gene-environment interactions in the development of VACTERL syndactyly? Due to the lack of clinically significant genetic animal models, little is known about these scientific questions. More importantly, the lack of animal models has prevented large-scale screening of small molecule compounds that can improve developmental defects in VACTERL syndactyly.

[0050] In view of this, the inventors of this invention performed whole-exome sequencing and bioinformatics analysis on blood samples from a child with VACTERL syndesmosis and their parents, discovering a gene mutation in mediator complex subunit 14 (MED14). Therefore, the inventors used this gene as a biomarker. Compared to traditional biomarkers, MED14 can more comprehensively label VACTERL syndesmosis, effectively assessing the presence of VACTERL syndesmosis in individuals and providing strong evidence for its diagnosis. Furthermore, the inventors used this gene mutation as a target to prepare an animal model of the disease to reveal changes in cell fate, analyze the pathogenic molecular mechanisms, and elucidate the functional mechanism of gene-environment interactions in the development of VACTERL syndesmosis. Simultaneously, it can also be used to screen small molecule compounds that can significantly improve developmental defects in VACTERL syndesmosis.

[0051] VACTERL Syndrome Markers and Uses

[0052] In a first aspect, the present invention proposes a biomarker for VACTERL syndrome. According to embodiments of the invention, the biomarker comprises the MED14 gene or the MED14 protein. The inventors have found that by detecting the coding sequence of the MED14 gene or the amino acid sequence of the MED14 protein in an individual's blood sample, the presence of VACTERL syndrome in an individual can be effectively assessed, providing strong evidence for the diagnosis of VACTERL syndrome. Furthermore, the MED14 gene or MED14 protein can be used as a biomarker to construct animal models of VACTERL syndrome.

[0053] In some embodiments of the present invention, the MED14 gene is located on the X chromosome.

[0054] In a second aspect, the present invention proposes the use of the MED14 gene or MED14 protein as a biomarker, said biomarker having at least one of the following uses: for detecting VACTERL syndrome; or for constructing an animal model of VACTERL syndrome. The inventors have discovered that by detecting the coding sequence of the MED14 gene or the amino acid sequence of the MED14 protein in an individual's blood sample, the presence of VACTERL syndrome in an individual can be effectively assessed, providing strong evidence for the diagnosis of VACTERL syndrome. Furthermore, the MED14 gene or MED14 protein can be used as a biomarker to construct an animal model of VACTERL syndrome.

[0055] In a third aspect, the invention provides the use of reagents in the preparation of a kit for detecting VACTERL syndrome, wherein the reagents are used to detect the coding sequence of the MED14 gene or the amino acid sequence of the MED14 protein. As is known, detecting the amino acid sequence of the MED14 protein or the coding sequence of the MED14 gene in an individual's blood sample can effectively assess whether an individual has VACTERL syndrome, providing strong evidence for the diagnosis of VACTERL syndrome. Therefore, a kit prepared using reagents that detect the amino acid sequence of the MED14 protein or the coding sequence of the MED14 gene has advantages such as high detection accuracy or simple operation.

[0056] In some embodiments of the present invention, the reagents include specific amplification primers and / or specific recognition probes for the MED14 gene, or reagents that specifically recognize the MED14 protein.

[0057] In some embodiments of the present invention, the reagent is adapted to detect the amino acid sequence of the MED14 protein by at least one of chromatography, mass spectrometry, and sequencing; or the reagent is adapted to detect the coding sequence of the MED14 gene by at least one of quantitative real-time PCR, fluorescence in situ hybridization, and polymerase chain reaction.

[0058] Methods for determining sample source

[0059] In a fourth aspect, the present invention provides a method for determining the origin of a sample. According to an embodiment of the present invention, the method includes: detecting the amino acid sequence of the MED14 protein or the coding sequence of the MED14 gene in a sample to be tested; and determining the origin of the sample to be tested based on the detection result of the amino acid sequence of the MED14 protein or the coding sequence of the MED14 gene. Thus, by using the method of the present invention, the origin of a sample to be tested can be determined by detecting the amino acid sequence of the MED14 protein or the coding sequence of the MED14 gene in the sample to be tested.

[0060] In some embodiments of the present invention, the detection result is whether the amino acid at position 550 of the amino acid sequence of the MED14 protein has been mutated or whether the base at position 1648 of the coding sequence of the MED14 gene has been mutated.

[0061] In some embodiments of the present invention, a mutation occurs at amino acid position 550 of the amino acid sequence of the MED14 protein or at base position 1648 of the coding sequence of the MED14 gene, wherein the sample to be tested is derived from a patient with VACTERL syndrome.

[0062] In some embodiments of the present invention, the amino acid at position 550 of the amino acid sequence of the MED14 protein is not mutated or the base at position 1648 of the coding sequence of the MED14 gene is not mutated, meaning that the sample to be tested is derived from a patient who does not have VACTERL syndrome.

[0063] In some embodiments of the present invention, the base mutation at position 1648 of the coding sequence of the MED14 gene includes c.1648A>G; or the amino acid mutation at position 550 of the amino acid sequence of the MED14 protein includes P.I550V.

[0064] CRISPR-Cas9 gene targeting system and methods for constructing an animal model of VACTERL syndrome.

[0065] In a fifth aspect, this invention proposes a CRISPR-Cas9 gene targeting system for constructing an animal model of VACTERL syndrome. According to embodiments of the invention, the CRISPR-Cas9 gene targeting system comprises: sgRNA specifically targeting the MED14 gene and the Cas9 protein. Therefore, the CRISPR-Cas9 gene targeting system of this invention can efficiently construct an animal model of VACTERL syndrome, providing an important tool for further elucidating the pathogenic mechanism of VACTERL syndrome and screening small molecule drugs that can improve the VACTERL syndrome phenotype or reduce the incidence of VACTERL syndrome.

[0066] In some embodiments of the present invention, the CRISPR-Cas9 gene targeting system further includes ssODA (single-strand oligo DNA).

[0067] In some embodiments of the present invention, the animal model is at least one of a zebrafish model and a mouse model.

[0068] In some embodiments of the present invention, the animal model is a zebrafish model, and the sequence of the sgRNA is shown in SEQ ID NO: 1.

[0069] 5'-TCGGTTCGGACGGGCAGTGGTGC-3' (SEQ ID NO: 1)

[0070] In some embodiments of the present invention, the animal model is a mouse model, the sequence of the sgRNA is shown in SEQ ID NO: 4 and SEQ ID NO: 5, and the sequence of the ssODA is shown in SEQ ID NO: 6.

[0071] 5'-CTGCTAGGAAGACCGGTCTATGG-3' (SEQ ID NO: 4)

[0072] 5'-GAAGCCATGGGTGGTCAGTGGG-3' (SEQ ID NO: 5)

[0073] 5'-TGTTTTATTAAACTTACTCGCCTTCCACAGTACTACgTTGTTGTGGAAATGCTTGA GGTTCCTAATAAGCCTACGCAGCTACATATAACTATTACTTTATGTCGGTGAGTACTGC AGATCGTGAGGACAG-3' (SEQ IDNO: 6)

[0074] In the specific implementation, the Cas9 protein is a common tool sequence in the field of genetic engineering (e.g., reported in Mali P, Yang L, Esvelt KM, Aach J, Guell M, et al. (2013) RNA-guided human genome engineering via Cas9. Science 339:823-826), and the recognizable PAM sequence is 5'-NGG-3'.

[0075] In a sixth aspect, the present invention provides a method for constructing an animal model of VACTERL syndrome. According to an embodiment of the present invention, the method comprises: injecting the CRISPR-Cas9 gene targeting system described in the fifth aspect into the fertilized egg of the animal to induce a mutation in the amino acid sequence of the MED14 protein or a mutation in the coding sequence of the MED14 gene of the animal, thereby obtaining the VACTERL syndrome animal model. Thus, the animal model constructed using the method described in this invention is a heritable, clinically based disease model that can be used to further elucidate the pathogenic mechanism of VACTERL syndrome and to screen small molecule drugs that can improve the VACTERL syndrome phenotype or reduce the incidence of VACTERL syndrome.

[0076] In some embodiments of the present invention, the amino acid sequence mutation of the MED14 protein includes P.I550V. That is, the isoleucine at position 550 of the amino acid sequence of the MED14 protein is mutated to valine.

[0077] In some embodiments of the present invention, the mutation in the coding sequence of the MED14 gene includes c.1648A>G. ​​That is, the adenine (A) at position 1648 of the coding sequence of the MED14 gene is mutated to guanine (G).

[0078] In some embodiments of the present invention, the animal is at least one of zebrafish and mouse.

[0079] In some embodiments of the present invention, the animal is a zebrafish, and the method includes: 1) injecting sgRNA and Cas9 protein from the CRISPR-Cas9 gene targeting system into zebrafish fertilized eggs, wherein the sequence of the sgRNA is shown in SEQ ID NO: 1, to obtain F0 generation zebrafish with MED14 gene mutation; 2) hybridizing the F0 generation zebrafish with wild-type zebrafish to obtain F1 generation heterozygous zebrafish; 3) self-pollinating the F1 generation heterozygous zebrafish to obtain homozygous zebrafish with MED14 gene mutation, wherein the homozygous zebrafish with MED14 gene mutation is the VACTERL syndrome animal model.

[0080] In some embodiments of the present invention, the animal is a mouse, and the method includes: 1) injecting sgRNA, Cas9 protein, and ssODA from the CRISPR-Cas9 gene targeting system into mouse zygotes, transplanting the zygotes into pseudopregnant recipient mice for gestation, and obtaining F0 generation mice with MED14 gene mutation, wherein the sequence of the sgRNA is shown in SEQ ID NO: 4 and SEQ ID NO: 5, and the sequence of the ssODA is SEQ ID NO: 6; 2) crossing the F0 generation mice with wild-type mice to obtain F1 generation heterozygous mice; 3) self-crossing the F1 generation heterozygous mice to obtain homozygous mice with MED14 gene mutation, wherein the homozygous mice with MED14 gene mutation are the VACTERL syndrome animal model.

[0081] Animal models and their uses

[0082] In a seventh aspect, the present invention provides an animal model. According to an embodiment of the invention, the animal model is constructed using the method described in the sixth aspect. Thus, the animal model of the present invention is a heritable, clinically based disease model that can be used to further elucidate the pathogenesis of VACTERL comorbidity and to screen small molecule drugs that can improve the VACTERL comorbidity phenotype or reduce the incidence of VACTERL comorbidity.

[0083] In an eighth aspect of the invention, the invention proposes uses for animal models of VACTERL syndrome constructed using the method described in the sixth aspect or the animal models described in the seventh aspect. According to embodiments of the invention, the uses include at least one of the following: studying the pathogenic molecular mechanisms of VACTERL syndrome; screening potential therapeutic agents for VACTERL syndrome; and studying gene-environment interactions.

[0084] The embodiments of the present invention are described in detail below. These embodiments are exemplary and are only used to explain the present invention, and should not be construed as limiting the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. Reagents or instruments used, unless otherwise specified, are all commercially available conventional products.

[0085] Example 1: Screening for genes associated with VACTERL syndrome

[0086] The applicant team of this invention received a male child patient in the outpatient clinic with a median cardiac position (CMP). Figure 1 a) Multiple fingers on the right hand ( Figure 1 b) Partial loss of the sacrococcygeal vertebrae ( Figure 1 c) Anal atresia ( Figure 1 (left image of d), hypospadias ( Figure 1 (left and right images of d) and rectovesical fistula ( Figure 1 The patient presented with clinical symptoms such as e) and was diagnosed with VACTERL complex malformation. Whole-exome sequencing and bioinformatics analysis of blood samples from the child and parents revealed a mutation in the MED14 (mediator complex subunit 14, MED14) gene (c.1648A>G; P.I550V), causing a mutation of isoleucine at position 550 of the MED14 protein to valine. Figure 1 f). The MED14 gene is located on the X chromosome. The mutated gene in the affected child is inherited from his mother, who is a carrier of the gene mutation.

[0087] Example 2: Construction and Research of the Zebrafish Model

[0088] To further investigate the pathogenesis of VACTERL-related malformations and provide a theoretical basis and technical support for the diagnosis and treatment of related diseases, the inventors utilized CRISPR / Cas9 genome editing technology to construct a MED14 mutant line. Δ17- / - The homozygous mutant zebrafish line was constructed as follows:

[0089] 1. Collect fertilized eggs within 15-30 minutes after zebrafish fertilization;

[0090] 2. The sgRNA sequence 5'-TCGGTTCGGACGGGCAGTGGTGC-3' (SEQ ID NO: 1) of MED14 and the Cas9 protein were injected into fertilized eggs at the 1 / 2 cell stage of zebrafish using a microinjection apparatus. The injected fertilized eggs were then fed for three months to obtain F0 generation animals.

[0091] 3. The F0 generation zebrafish obtained in step 2 were hybridized with wild-type zebrafish. The resulting F1 generation embryos were placed in a 28°C incubator for 24 hours. The F1 generation embryos were lysed using an alkaline lysis method and then used as templates for PCR experiments. The primer sequences used in the PCR experiment were: forward primer: 5'-TTCTATGTACTGTGAAAGATATGACCAG-3' (SEQ ID NO: 2), reverse primer: 5'-ATGACCATTCAAAACAACG AGAAGTC-3' (SEQ ID NO: 3). The PCR reaction system is shown in Table 1.

[0092] Table 1

[0093] reagents Dosage Taq Mix 5μL forward primer 0.5μL reverse primer 0.5μL Lysed embryo template 0.5μL <![CDATA[ddH2O]]> 3.5μL

[0094] After the PCR experiment, a 545bp band was generated. The PCR product was digested with T7 restriction enzyme, and the corresponding mutation was identified in the F1 generation germ cells. It can then be inferred that the F0 generation zebrafish germ cells carry the corresponding mutation. The F1 generation embryos were raised for three months until sexual maturity to obtain MED14 heterozygous zebrafish.

[0095] 4. Self-crossing of MED14 heterozygous zebrafish with the same genotype revealed that the wild-type product contained a PvuII restriction enzyme site, while the mutant product lacked this site. Therefore, adding PvuII restriction enzyme to the PCR product prevented digestion of the mutant, thus obtaining homozygous MED14 gene mutant zebrafish (MED14) using this method. Δ17- / - (Homozygous mutant zebrafish).

[0096] The zebrafish MED14 gene has 29 exons, and the inventors chose the first exon (exon 1) as the target. The constructed MED14... Δ17- / - A comparison of the genes of homozygous mutant zebrafish and wild-type zebrafish revealed that, compared to the wild-type, the constructed MED14... Δ17- / - The mutant line contains a 17-base pair deletion, which will lead to the premature appearance of the stop codon (e.g., Figure 2 (as shown in a).

[0097] Genotyping using PvuII restriction enzyme digestion can distinguish between homozygous mutants, heterozygotes, and wild-type embryos. The specific procedure is as follows: After the PCR experiment in step 3, add 0.1 μL of PvuII restriction enzyme (NEW ENGLANDBiolabs, R3151S) and 1 μL of rCutSmart to the reaction product, incubate at 37°C for 3 hours, and then perform electrophoresis. The PvuII restriction enzyme cleavage site is 5'-CAG↓CTG-3'. After the PCR experiment, wild-type embryos contain the PvuII restriction site, while the PvuII restriction site is absent in the mutant product. Therefore, the wild-type PCR product will be completely cleaved into 372bp and 173bp fragments after digestion, the homozygote still has a large 545bp fragment, and the heterozygote contains all three fragments (e.g., 372bp and 173bp). Figure 2 (as shown in b).

[0098] For MED14 Δ17- / - Homozygous mutant zebrafish and wild-type zebrafish were observed, and live images from 24 to 96 hours were obtained, as shown below. Figure 2 As shown in c, this is consistent with previous findings in MED14 knockout mutants (Burrows et al., 2015), MED14 Δ17- / - The homozygous mutant began to show pericardial edema 24 hours after hatching.

[0099] To further verify that the constructed mutant was a loss of function mutant, 200 wild-type and 200 mutant embryos at 24 hpf (hours post-fertilization) were collected. Immunoblot analysis was performed on the lysates of the wild-type and mutant embryos. The specific procedure was as follows: First, the embryos were demembraned using a demembranous enzyme. Then, the embryos were collected into 2 ml centrifuge tubes and gently pipetted until the yolk was completely dissolved. The tubes were then centrifuged at 3500 rpm for 5 minutes at 4°C. The embryos were then resuspended in PBS and initially lysed using a hand-held homogenizer. The tubes were then centrifuged again at 3500 rpm for 5 minutes at 4°C. The supernatant was discarded, RIPA lysis buffer was added, the embryos were resuspended, and the tubes were homogenized for 10 minutes. After homogenization, the tubes were centrifuged at 12000 rpm for 5 minutes at 4°C. The supernatant was collected, 6× protein loading buffer was added, and the tubes were incubated at 100°C for 5 minutes. SDS-PAGE was then performed after the incubation period. After SDS-PAGE, the membrane was transferred and blocked with skim milk powder. Following blocking, it was incubated overnight with MED14 (Thermo Fisher, PA5-79655, 1:200) antibody and β-Tubulin (CW, CE0089, 1:5000) antibody. After primary antibody incubation, the membrane was washed three times with MABT solution for 10 minutes each time. Then, it was incubated with secondary antibody for one hour, followed by three washes with MABT solution for 10 minutes each time, and then developed. Western blot results are shown below. Figure 2 As shown in d, this indicates the constructed MED14 Δ17- / - The MED14 protein in the mutant cannot be translated normally due to the premature appearance of the stop codon, and the MED14 protein is basically missing, which is a loss-of-function mutant.

[0100] For MED14 Δ17- / - Phenotypic analysis was performed on homozygous mutant zebrafish and wild-type zebrafish. Whole-cell in situ hybridization was conducted 48 hours after hatching (48 hpf) in a Tg (cmlc2-kalta4-p2a-mCherry) background or using the cmlc2 probe to evaluate MED14. Δ17- / - mutant zebrafish (MED14) Δ17- / - Heart loop formation in wild-type zebrafish (WT); WT and MED14 3 to 5 days after hatching (dpf) Δ17- / - Perform Alcian blue staining; for WT and MED14 incubated for 9 days. Δ17- / - Alcian blue and alizarin red S staining was performed; WT and MED14 were stained at 48h, 72h and 120h after incubation. Δ17- / - Lateral live imaging of the cloaca of embryos was performed; WT and MED14 embryos were subjected to incubation for 72 hours. Δ17- / -Embryos were subjected to α-PKC immunostaining; WT and MED14 embryos were subjected to immunostaining after 120 hours of incubation. Δ17- / - Rhodamine dixylselan excretion test was performed, in which rhodamine dixylselan was injected into MED14. Δ17- / - Or WT foregut; assess WT and MED14 Δ17- / - Kidney function, for WT and MED14 Δ17- / - 40-kDa of rhodamine-labeled dixylblue was injected via the cardiac sinus, and fluorescence intensity was measured in each fish at baseline and at 1, 5, and 24 hours later.

[0101] The results are as follows Figure 3 As shown, compared to wild-type zebrafish, MED14 Δ17- / - Mutant zebrafish exhibit mesocentricity ( Figure 3 a) The pectoral fins (homogeneous organs of the human upper limbs) are short. Figure 3 b) Vertebral absence ( Figure 3 c) Cloacal atresia ( Figure 3 df), developmental defects such as kidney and urinary system abnormalities (df), Figure 3 g) This animal model comprehensively replicates various symptoms of VACTERL syndesmosis in humans. Therefore, this animal model is a heritable, clinically based disease model that can be used to further elucidate the pathogenesis of VACTERL syndesmosis and to screen small molecule drugs that can improve the VACTERL syndesmosis phenotype or reduce the incidence of VACTERL syndesmosis.

[0102] Example 3: Construction and Study of a Mouse Model

[0103] The inventors further utilized CRISPR / Cas9 and DNA recombination technology to prepare a precisely gene-edited mouse MED14-I556V mutant (the isoleucine residue at position 556 of the mouse MED14 protein is highly conserved compared to that at position 550 of the human MED14 protein). The specific construction process is as follows:

[0104] 1. Design of sgRNA and single-stranded oligonucleotides (ssODA) based on target sequences: The sequence and structural information of the MED14 gene (Gene ID: 26896, https: / / www.ncbi.nlm.nih.gov / gene / 26896) were obtained from the NCBI mouse genome website. Following the CRISPR / Cas9-mediated site-directed mutagenesis target design principle, the isoleucine at position 556 of the mouse MED14 gene was mutated to valine, i.e., the A at position 1666 of the CDS region was mutated to G, and the corresponding codon was mutated from ATT to GTT. The mouse MED14 gene has 5 transcripts. Based on the structure of the MED14 gene and common transcripts, the 13th exon of the MED14-202 transcript (ENSMUST00000096495, NM-001048208.1) was selected for mutation. The exon sequences were analyzed, and two sgRNA sequences were designed (target sequences: 5'-CTGCTAGGAAGA CCGGTCTATGG-3' (SEQ ID NO: 4); 5'-GAAGCCATGGGTGGTCAGTGGG-3' (SEQ ID NO: 5)). Based on the sgRNA sequence, a design was created containing homologous arms and single-stranded oligonucleotides containing the target fragment. The sequences of the homologous arms are F: 5'-ACTTACTCGCCTTCCACAGT-3' (SEQ ID NO: 7); R: 5'-AACCTCAAGCATTTC CAC-3' (SEQ ID NO: 8), and the sequence of ssODA is 5'-TGTTTATTAAACTTACTCGCCTTCCAC AGTACTACgTTGTTGTGGAAATGCTTGAGGTTCCTAATAAGCCTACGCAGCTATCATATA ACTATTACTTTATGTCGGTGAGTACTGCAGATCGTGAGGACAG-3' (SEQ ID NO: 6). The design strategy is described in [link to design strategy]. Figure 4 .

[0105] 2. Micromanipulation and F0 generation identification

[0106] The aforementioned sgRNA, Cas9 protein, and ssODA were co-injected into the cytoplasm of mouse zygotes. Viable zygotes were then transferred into the uterus of pseudopregnant mice, and F0 generation mice were obtained after development and delivery. PCR amplification was performed on mouse tail tips. Initial screening primers were used to identify samples with inserted mutant genes, while negative samples without insertion were excluded. Positive mouse samples were selected for sequencing confirmation. The specific process is as follows:

[0107] Cut off 0.5 cm of the mouse tail tip and place it in a 1.5 mL EP tube. Add 400 μL of lysis buffer and 1 μL of proteinase K stock solution. Incubate the EP tube in a 55°C water bath overnight until digestion is complete. Extract genomic DNA using the phenol / chloroform method. The following reactants constitute a 20 μL reaction system: 2.0 μL template DNA, 10× buffer (containing Mg2+) 2+ 2.0 μL of dNTP mixture (10 mmol / L), 0.5 μL of primer mixture (a mixture of specific forward and reverse identification primers, with specific sequences F: 5'-GGACAACAGCGTTGCAAACAATCTA-3' (SEQ ID NO: 9); R: 5'-GCCTATATTTCCCCAAATTCTAGTTCAACT-3' (SEQ ID NO: 10)), 0.5 μL of DNA polymerase (5 U / μL), and 14.5 μL of ultrapure water. PCR reaction conditions: pre-denaturation 95℃ for 5 min; denaturation 95℃ for 30 s; annealing 58℃ for 30 s; extension 72℃ for 30 s; for a total of 40 cycles, followed by a final extension at 70℃ for 10 min, and then storage at 25℃. Identification was performed by agarose gel electrophoresis after PCR. A 2% (w / v) agarose gel was prepared, and 5 μL of the PCR final product was subjected to electrophoresis at 135V for 20 min. Electrophoresis images were analyzed using a gel imaging system. For further validation, the PCR product was cloned and sequenced using TA to obtain male F0 generation mice containing the mutant gene.

[0108] 3. Breeding homozygous mutant mice

[0109] Male F0 generation mice containing the mutant gene were bred with wild-type C57BL / 6J female mice to obtain F1 generation mice. Heterozygotes in the F1 generation were screened by PCR amplification and sequencing. Then, the F1 generation mice with heterozygous genotypes were used as parents to breed and obtain F2 generation mice. Genotyping of the F2 generation mice was then performed to screen out homozygous gene mice, thus completing the establishment of a homozygous mutant population.

[0110] The constructed MED14-I556V mutant mice were subjected to Sanger sequencing, which confirmed the mutation site, namely, the mutation of isoleucine at position 556 of the mouse MED14 protein into valine.

[0111] MED14-I556V mutant mouse embryos can be born normally. Detailed examinations were performed on multiple organs of the MED14-I556V mutant mice after birth. Toe bone length was measured in WT (wild-type) and MED14-I556V mice at 3 months of age. Mini-CT scans were performed on mice at E18.5 (embryonic day 18.5). HE and PAS staining were performed on the kidneys of mice at E18.5. Glomerular size was measured in WT and MED14-I556V mice at E18.5.

[0112] The results are as follows Figure 5 As shown, compared to wild-type mice, MED14-I556V mutant mice exhibited a combined VACTERL malformation phenotype: such as a median cardiac malformation (…). Figure 5 a) The length of the forelimb toes is significantly shortened ( Figure 5 bc), lumbar spine deformity and partial absence of the sacrum ( Figure 5 d) Significantly reduced glomerular volume, etc. Figure 5 ef).

[0113] Therefore, the MED14-I556V mutant mice comprehensively reproduced the symptoms of human patients with VACTERL comorbidity, indicating that this animal model is a heritable, clinically based disease model that can be used to further elucidate the pathogenesis of VACTERL comorbidity and to screen small molecule drugs that can improve the VACTERL comorbidity phenotype or reduce the incidence of VACTERL comorbidity.

[0114] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "example," "specific example," or "some examples," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the present invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Moreover, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of different embodiments or examples.

[0115] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.

Claims

1. A VACTERL characteristic marker, characterized in that, The biomarkers include the MED14 gene or the MED14 protein.

2. Use of the MED14 gene or MED14 protein as a biomarker, said biomarker having at least one of the following uses: Used to detect VACTERL syndrome; Alternatively, an animal model of VACTERL syndrome could be constructed.

3. The use of the reagents in the preparation of the kit, wherein the kit is used to detect VACTERL syndrome, and the reagents are used to detect the coding sequence of the MED14 gene or the amino acid sequence of the MED14 protein; Optionally, the reagents include specific amplification primers and / or specific recognition probes for the MED14 gene, or reagents that specifically recognize the MED14 protein; Optionally, the reagent is adapted to detect the amino acid sequence of the MED14 protein by at least one of chromatography, mass spectrometry, and sequencing; Alternatively, the reagent may be adapted to detect the coding sequence of the MED14 gene by at least one of quantitative real-time PCR, fluorescence in situ hybridization, or polymerase chain reaction.

4. A method for determining the source of a sample, characterized in that, include: Detect the amino acid sequence of the MED14 protein or the coding sequence of the MED14 gene in the sample to be tested; Based on the detection results of the amino acid sequence of the MED14 protein or the coding sequence of the MED14 gene, the source of the sample to be tested is determined. Optionally, the detection result is whether the amino acid at position 550 of the amino acid sequence of the MED14 protein has been mutated or whether the base at position 1648 of the coding sequence of the MED14 gene has been mutated. Optionally, a mutation occurs at amino acid position 550 of the amino acid sequence of the MED14 protein or at base position 1648 of the coding sequence of the MED14 gene, indicating that the sample to be tested is derived from a patient with VACTERL syndrome. Optionally, the amino acid at position 550 of the amino acid sequence of the MED14 protein or the base at position 1648 of the coding sequence of the MED14 gene is not mutated, provided that the sample to be tested is derived from a patient who does not exhibit VACTERL syndrome. Optionally, the base mutation at position 1648 of the coding sequence of the MED14 gene includes c.1648A>G; or the amino acid mutation at position 550 of the amino acid sequence of the MED14 protein includes P.I550V.

5. A CRISPR-Cas9 gene targeting system for constructing an animal model of VACTERL syndrome, characterized in that, include: It specifically targets the sgRNA and Cas9 protein of the MED14 gene.

6. The CRISPR-Cas9 gene targeting system according to claim 5, characterized in that, Further including ssODA; Optionally, the animal model is at least one of a zebrafish model and a mouse model; Optionally, the animal model is a zebrafish model, and the sequence of the sgRNA is shown in SEQ ID NO: 1; Optionally, the animal model is a mouse model, the sequence of the sgRNA is shown in SEQ ID NO: 4 and SEQ ID NO: 5, and the sequence of the ssODA is shown in SEQ ID NO:

6.

7. A method for constructing an animal model of VACTERL syndrome, characterized in that, include: The CRISPR-Cas9 gene targeting system according to any one of claims 5-6 is injected into the animal zygote to cause mutations in the amino acid sequence of the MED14 protein or the coding sequence of the MED14 gene of the animal, thereby obtaining the VACTERL syndrome animal model.

8. The method according to claim 7, characterized in that, The amino acid sequence of the MED14 protein has been mutated, including P.I550V; Optionally, the coding sequence of the MED14 gene may be mutated, including c.1648A>G; Optionally, the animal is at least one of zebrafish and mouse.

9. The method according to claim 8, characterized in that, The animal is a zebrafish, and the method includes: 1) The sgRNA and Cas9 protein in the CRISPR-Cas9 gene targeting system were injected into zebrafish fertilized eggs. The sequence of the sgRNA is shown in SEQ ID NO: 1, to obtain F0 generation zebrafish with MED14 gene mutation. 2) The F0 generation zebrafish were crossed with wild-type zebrafish to obtain the F1 generation heterozygous zebrafish; 3) The F1 generation heterozygous zebrafish were self-crossed to obtain homozygous zebrafish with the MED14 gene mutation. The homozygous zebrafish with the MED14 gene mutation is the VACTERL syndrome animal model. Optionally, the animal is a mouse, and the method includes: 1) The sgRNA, Cas9 protein, and ssODA of the CRISPR-Cas9 gene targeting system were injected into mouse zygotes, and the zygotes were transplanted into pseudopregnant recipient mice for gestation to obtain F0 generation mice with MED14 gene mutation. The sequence of the sgRNA is shown in SEQ ID NO: 4 and SEQ ID NO: 5, and the sequence of the ssODA is SEQ ID NO:

6. 2) The F0 generation mice were crossed with wild-type mice to obtain F1 generation heterozygous mice; 3) The F1 generation heterozygous mice were self-crossed to obtain homozygous mice with the MED14 gene mutation. The homozygous mice with the MED14 gene mutation were the VACTERL syndrome animal model.

10. Use of the VACTERL syndrome animal model constructed by the method of any one of claims 7-9, wherein the use includes at least one of the following: Investigate the pathogenic molecular mechanisms of VACTERL syndrome; Screening for treatments for VACTERL syndrome; The study investigates the interaction between genes and the environment.