Postoperative pain medicine and use thereof

Abstract

The present application relates to the application of CXCR3 as a target point in the development or preparation of drugs for relieving pain induced by surgical and traumatic stimulation, in particular the application in the drugs for acute postoperative (traumatic) pain and chronic postoperative (traumatic) pain. The present application proves that the intervention of surgical and traumatic stimulation induced pain aiming at the target point of CXCR3 has an analgesic effect equivalent to morphine, and because the target point of the intervention of CXCR3 is different from the target points of opioid drugs, local anesthetics and non-steroidal anti-inflammatory drugs, the shortcomings of these drugs can be avoided. The present application enriches the types of drugs for treating pain in clinic, and also provides a new method and idea for the pain treatment and drug research and development targeting CXCR3.

Description

[0001] This invention belongs to the field of drug development target technology, specifically relating to the application of CXCR3 inhibitors in the preparation of drugs for treating pain, and particularly relating to the application of CXCR3 as a target in the development or preparation of drugs for relieving pain induced by surgery and trauma. Background Technology

[0002] According to the ICD-11 definition, postoperative or post-traumatic pain refers to pain located at the site of surgery or trauma that occurs or is aggravated after surgery or tissue injury. It is primarily caused by acute surgical stimulation, tension, and tissue trauma. Inflammatory pain is induced by chemical stimuli, while neuropathic pain is caused by central sensitization induced by nerve damage. Both surgical stimulation and tissue trauma can cause acute pain, which can cause significant distress for patients, including prolonged hospital stays, delayed postoperative recovery, and impacted disease prognosis. It is also a major factor affecting overall patient satisfaction. If the severity and duration of acute pain are not effectively controlled, the risk of it transforming into chronic pain, lasting for months or years, and even leading to disability, placing a heavy burden on families and society.

[0003] Currently, the main medications used clinically to treat pain induced by surgery and trauma are opioids, nerve conduction blockers, and nonsteroidal anti-inflammatory drugs (NSAIDs). However, these drugs all have significant side effects. Opioids can cause addiction, induce pain sensitization, and produce respiratory depression, urinary retention, and itching. Local anesthetic nerve blocks can cause toxic reactions and nerve damage. NSAIDs can cause gastrointestinal, cardiovascular, and coagulation disorders. These problems seriously affect the efficacy of these analgesics. Currently, there are no other classes of drugs available clinically specifically for treating pain induced by surgery and trauma, posing difficulties and challenges for clinicians in rational drug use. Therefore, there is an urgent clinical need to develop an analgesic based on a novel mechanism of action, particularly for treating acute postoperative or post-traumatic pain and chronic postoperative or post-traumatic pain. Summary of the Invention

[0004] To address the shortcomings of existing technologies, the first objective of this invention is to provide an application of CXCR3 and / or CXCL9 as diagnostic and / or companion diagnostic markers in evaluating postoperative or post-traumatic pain products.

[0005] A second objective of this invention is to provide the use of a CXCR3 inhibitor and / or a CXCL9 neutralizing antibody in the preparation of a medicament for treating postoperative or post-traumatic pain.

[0006] Preferably, the postoperative or post-traumatic pain is acute postoperative or post-traumatic pain or chronic postoperative or post-traumatic pain.

[0007] Preferably, the CXCR3 inhibitor is a drug that inhibits the expression level and / or biological activity of CXCR3 to relieve pain.

[0008] Preferably, the CXCR3 inhibitor is a drug that relieves pain by inhibiting the binding of CXCL9 to CXCR3.

[0009] Preferably, the CXCR3 inhibitor is a small molecule antagonist with a molecular weight of less than 900 Da, more preferably less than 800 Da, and even more preferably less than 700 Da.

[0010] Preferably, the CXCR3 inhibitor is a compound having the following structure (I), a pharmaceutically acceptable salt thereof, a solvate thereof, or a derivative thereof: (I) Among them, R 1 R 2 and R 3 It can be independently selected from hydrogen, halogen, and C. 1-10 Alkyl, optionally substituted C 1-10 Alkyl or optionally substituted ethers; the substituents on the alkyl or ether are selected from: halogen, hydroxyl, mercapto, amino, amide, C 1-10 Alkylamide or di(C) 1-10 Alkyl) amide group; Z is selected from CR a Or N, R a Selected from hydrogen, halogens, optionally substituted alkyl halides, or optionally substituted ethers; R 4 It is an optionally substituted C1-10 alkyl group, wherein the substituent on the alkyl group is selected from: halogen, hydroxyl, mercapto, amino, amide, C1-10 alkylamide or di(C1-10 alkyl)amide.

[0011] Preferably, The halogen is selected from F, Cl, Br or I; R 1 R 2 or R 3 Each is independently selected from the arbitrarily substituted C 1-10 Alkyl or optionally substituted ethers.

[0012] The optional substitution of C 1-10 Alkyl groups preferably have halogenated C 1-10 Alkyl groups; such as monohalogenated, dihalogenated, or trihalogenated C4 groups. 1-10 Alkyl; more preferably trihalogenated C 1-10 Alkyl groups, such as trihalomethyl, trihaloethyl, trihalopropyl, or trihalobutyl; more preferably, such as trifluoromethyl.

[0013] The optionally substituted ether is selected from the optionally substituted C 1-10 Alkyl ethers; such as monohalogenated, dihalogenated, or trihalogenated C460-hydroxyl groups. 1-10 Alkyl ethers; more preferably trihalogenated C 1-10 Alkyl ethers, such as trihalomethyl ethers, trihaloethyl ethers, trihalopropyl ethers, or trihalobutyl ethers; more preferably, such as trifluoromethyl ethers.

[0014] R 4 Selected from methyl, ethyl, propyl, or butyl; Z is selected from N.

[0015] More preferably, R 1 Selected from H, R 2 Selected from F, R 3 Selected from CF3, R 4 Selected from ethyl; Or R 1 Selected from H, R 2 Selected from -O-CF3, R 3 Selected from H, R 4 Selected from ethyl.

[0016] According to an embodiment of the present invention, R 1 R 2 and R 3 Each element is independently selected from hydrogen, halogen, halogenated C1-10 alkyl, or halogenated C1-10 alkyl ether. Z is selected from N. R 4 Selected from methyl, ethyl, propyl or butyl.

[0017] According to embodiments of the present invention, the CXCR3 inhibitor may be a compound having the following structure, a pharmaceutically acceptable salt thereof, a solvate thereof, or a derivative thereof: or , The CXCR3 inhibitor may be an R-isomer, an S-isomer, or a mixture thereof.

[0018] The inhibitor may be compound A (CAS No. 473719-41-4). ; Alternatively, the CXCR3 inhibitor is compound B (CAS No.: 906805-42-3). .

[0019] Compound A is a potent and selective chemokine (CXC matrix) receptor 3 (CXCR3) antagonist. Molecular weight: 603.59; Molecular formula: C 32 H 28 F3N5O4; Specificity: Selectivity for CXCR3 exceeds 1000-fold.

[0020] Compound B, SCH 546738, is a potent, orally active, non-competitive CXCR3 antagonist. Previous studies have reported that SCH 546738 inhibits the binding of CXCL10 and CXCL11 receptors and the chemotaxis of activated human T cells, with an affinity constant (Ki) of 0.4 nM for the human CXCR3 receptor. Currently, SCH 546738 has demonstrated therapeutic effects in several immune-related disease studies, such as reducing leukocyte infiltration into joints and structural damage to bone and cartilage in a mouse CIA model; significantly reducing disease severity in rat and mouse experimental autoimmune encephalomyelitis models; and achieving a dose-dependent prolongation of rat cardiac allogeneic graft survival.

[0021] A third object of the present invention is to provide a medicament for treating postoperative or post-traumatic pain, the medicament comprising a CXCR3 inhibitor and a pharmaceutically acceptable carrier or excipient, wherein the postoperative or post-traumatic pain is acute or chronic.

[0022] Preferably, the CXCR3 inhibitor is compound A or a pharmaceutically acceptable salt, solvate, or derivative thereof.

[0023] Preferably, the drug can be administered by injection, oral administration, inhalation, transdermal administration, topical cream or gel or powder, or rectal administration, and the injection is further preferably intrathecal injection, intraperitoneal injection, or intravenous injection.

[0024] Preferably, the concentration of compound A or its pharmaceutically acceptable salt, solvate or derivative thereof is 2-10 μg / μL, for example 2 μg / μL, 3 μg / μL, 4 μg / μL, 5 μg / μL, 6 μg / μL, 7 μg / μL, 8 μg / μL, 9 μg / μL, or 10 μg / μL.

[0025] Preferably, the injectable dose of compound A or its pharmaceutically acceptable salts, solvates or derivatives thereof is 4-50 mg / kg, more preferably 5-40 mg / kg, for example 4 mg / kg, 5 mg / kg, 6 mg / kg, 7 mg / kg, 8 mg / kg, 9 mg / kg, 10 mg / kg, 11 mg / kg, 12 mg / kg, 13 mg / kg, 14 mg / kg, 15 mg / kg, 16 mg / kg, 17 mg / kg, 18 mg / kg, 19 mg / kg, 20 mg / kg, 21 mg / kg, 22 mg / kg, 23 mg / kg, 24 mg / kg, 25 mg / kg, 26 mg / kg, 27 mg / kg, 28 mg / kg, 29 mg / kg, 30 mg / kg, 31 mg / kg, 32 mg / kg, 33 mg / kg, 34 mg / kg, 35 mg / kg, 36 mg / kg, 37 mg / kg, 38 mg / kg, 39 mg / kg, etc. mg / kg, 40 mg / kg, 41 mg / kg, 42 mg / kg, 43 mg / kg, 44 mg / kg, 45 mg / kg, 46 mg / kg, 47 mg / kg, 48 mg / kg, 49 mg / kg, 50 mg / kg.

[0026] Preferably, the intrathecal injection is a single injection; the intravenous injection is multiple injections at intervals of 10 h to 23 h. For example, 10 h, 11 h, 12 h, 13 h, 14 h, 15 h, 16 h, 17 h, 18 h, 19 h, 20 h, 21 h, 22 h, and 23 h.

[0027] Preferably, postoperative or post-traumatic pain is acute postoperative or post-traumatic pain or chronic postoperative or post-traumatic pain.

[0028] A fourth object of the present invention is to provide a method for treating postoperative or post-traumatic pain, the method comprising the step of administering a therapeutically effective amount of a CXCR3 inhibitor to a subject in need, the subject being a mammal, preferably a human.

[0029] Preferably, the CXCR3 inhibitor is compound A, compound B, or a pharmaceutically acceptable salt, solvate, or derivative thereof.

[0030] Preferably, the postoperative or post-traumatic pain is acute postoperative or post-traumatic pain or chronic postoperative or post-traumatic pain.

[0031] A fifth objective of this invention is to provide a kit for diagnosing and / or accompanying diagnoses of postoperative or post-traumatic pain.

[0032] Preferably, the markers include CXCR3 and / or CXCL9.

[0033] Preferably, the levels of CXCR3 and / or CXCL9 factors are directly proportional to the degree of pain.

[0034] Preferably, the mRNA expression levels of CXCR3 and / or CXCL9 are directly proportional to the degree of pain.

[0035] Preferably, CXCL9 and / or CXCR3 are mostly expressed in DRG neurons.

[0036] A sixth objective of the present invention is to provide a method for diagnosing or accompanying the diagnosis of postoperative or post-traumatic pain, including the step of detecting the levels of CXCL9 and CXCR3 factors.

[0037] Preferably, the step involves detecting and comparing the levels of CXCL9 and CXCR3 factors before / after surgery or before / after trauma.

[0038] Preferably, the levels of CXCL9 and CXCR3 factors in DRG neurons are detected.

[0039] Preferably, the step of detecting the content of CXCL9 and CXCR3 factors.

[0040] The seventh objective of this invention is to provide the use of a CXCL9 neutralizing antibody, a ligand corresponding to the CXCR3 receptor, in the preparation of a medicament for relieving postoperative or post-traumatic pain.

[0041] An eighth object of the present invention is to provide the use of compounds of structure (I), pharmaceutically acceptable salts thereof, solvates thereof or derivatives thereof in the preparation of medicaments for the prevention and / or treatment of postoperative or post-traumatic pain, structure (I) and its substituents being defined above.

[0042] The beneficial effects of this invention are: Experimental verification shows that differential gene expression profile analysis of DRG cells in the surgical incision-induced tissue trauma model reveals that the chemokine CXCL9 is one of the most significantly differentially expressed genes and potentially associated with pain. The mRNA expression levels of CXCL9 and CXCR3 in the surgical incision model are significantly higher than those in the sham incision group. CXCL9 and CXCR3 are expressed in most DRG neurons. In application, CXCL9 and CXCR3 can be used as pain markers for the diagnosis or accompanying diagnosis of postoperative or post-traumatic pain levels. The levels of CXCR3 and / or CXCL9 are directly proportional to the degree of pain, and can therefore be used to assess, diagnose, or accompany the diagnosis of postoperative or post-traumatic pain levels. Compared with existing pain objectification tools, this invention provides more objective and stable detection of factor levels.

[0043] Furthermore, experimental verification has clearly demonstrated that intervention targeting CXCR3 to induce pain during surgical trauma has an analgesic effect equivalent to morphine. Simultaneously, because the target of CXCR3 differs from that of opioids, local anesthetics, and nonsteroidal anti-inflammatory drugs (NSAIDs), it avoids the drawbacks of these drug classes. This invention has also experimentally confirmed that, compared to morphine, compounds A or B do not have addictive properties or cause pain sensitization.

[0044] This invention discloses CXCR3 as a target for the preparation of therapeutic drugs targeting pain induced by surgery and trauma, thereby alleviating pain induced by surgery and trauma. This enriches the variety of drugs used clinically to treat pain and provides new methods and ideas for pain treatment and drug development targeting CXCR3. Attached Figure Description

[0045] Figure 1 This shows the differential gene expression in DRG tissues of a postoperative (traumatic) pain model at different time points (A: Schematic diagram of experimental procedure; BC: Heatmap of differential gene expression between the surgical group and the control group at time points ZT0 and ZT12; D: DEG and overlap between the two groups; EF: Difference in CXCL9 expression between the surgical group and the control group at time points ZT0 and ZT12).

[0046] Figure 2 This describes the differential gene expression in DRG tissues of a postoperative (traumatic) pain model at different time points (compared to the ZT0 corresponding group). P <0.01, *** P <0.001; compared with the corresponding control group, # P <0.05, ### P <0.001).

[0047] Figure 3 CXCL9 and CXCR3 are expressed in mouse DRG neurons.

[0048] Figure 4 The CXCR3 gene knockout mouse acute surgical incision model showed a significant and substantial improvement in pain.

[0049] Figure 5 Intrathecal injection of recombinant CXCL9 protein induced pain sensitization in normal mice (*) p <0.05、** p <0.01 compared to the solvent group).

[0050] Figure 6 Intrathecal injection of CXCL9 neutralizing antibodies relieves postoperative (traumatic) pain in a surgical model mouse (*). p <0.05、** p <0.01、****p <0.0001 compared to the solvent group).

[0051] Figure 7 Intrathecal injection of compound A relieves postoperative (traumatic) pain in a mouse model of surgical incision (***) p <0.001、**** p <0.0001 compared to the solvent group).

[0052] Figure 8 Intravenous injection of compound B significantly improved acute postoperative pain induced by plantar incision in mice.

[0053] Figure 9 Compound A, administered intravenously, relieves postoperative (traumatic) pain in a mouse model of surgical incision (*). p <0.05、**** p <0.0001 compared to the solvent group).

[0054] Figure 10 This is a comparison of the analgesic effects of intravenous injection of compound A and its isomers with the same dose of morphine (*). p <0.05、** p <0.01、*** p <0.001、**** p <0.0001 compared to the solvent group).

[0055] Figure 11 The effects of intravenous injection of compound A and morphine on OFT in normal mice (**) p< 0.01, *** p< 0.001 compared to the solvent group).

[0056] Figure 12 The effect of intravenous injection of compound A and morphine on the mechanical pain threshold of normal mice (*) p <0.05、** p <0.01 compared to the solvent group).

[0057] Figure 13 Compound A, administered intravenously, relieves chronic postoperative (traumatic) pain in SMIR model mice. p <0.001、**** p <0.0001 compared to the solvent group).

[0058] Terminology Definitions and Explanations The term "pharmaceutically acceptable salt" in this document means that the compound can exist in various pharmaceutically acceptable salt forms. If the compound has a basic center, it can form an acid addition salt; if the compound has an acidic center, it can form a base addition salt; if the compound contains both an acidic and a basic center, it can also form an inner salt. Preferably, the pharmaceutically acceptable salt is selected from one or more of the compound's hydrochloride, sulfate, bitartrate, p-toluenesulfonate, maleate, and methanesulfonate salts.

[0059] The term "derivative" herein includes ester derivatives and / or derivatives having or providing the same biological function and / or activity as any of the relevant compounds of this invention. Therefore, for the purposes of this invention, the term also includes prodrugs of the compounds. A "prodrug" includes any compound that, after oral or parenteral administration, is metabolized in vivo to form experimentally detectable amounts of the compound within a predetermined timeframe (e.g., at dosing intervals between 6 and 24 hours, i.e., once to four times daily).

[0060] The term "solvent" as used herein refers to a solvate formed by incorporating molecules of a non-toxic, pharmaceutically acceptable solvent (hereinafter referred to as a solvating solvent) into the solid structure (e.g., crystal structure) of a compound of the present invention. Examples of such solvents include water, alcohols (e.g., ethanol, isopropanol, and butanol), and dimethyl sulfoxide. A solvate can be prepared by recrystallizing the compound of the present invention with a solvent or solvent mixture containing a solvating solvent. Whether a solvate is formed in any given case can be determined by analyzing the crystals of the compound using known standard techniques such as thermogravimetric analysis (TGE), differential scanning calorimetry (DSC), and X-ray crystallography. A solvate can be stoichiometric or non-stoichiometric. Particularly preferred solvates are hydrates, and examples of hydrates include monohydrates and dihydrates.

[0061] The term "optionally substituted" in this document means that the group referred to by the term may be unsubstituted or may be substituted by one or more groups independently selected from acyl, alkyl, alkenyl, alkynyl, thioalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkylalkenyl, heterocycloalkyl, cycloalkylheteroalkyl, cycloalkoxy, cycloalkenoxy, cycloamino, halogen, carboxyl, haloalkyl, and haloalkynyl. Acryloxy, heteroalkyl, heteroalkenylhexynyl, heteroalkoxy, hydroxy, hydroxyalkyl, alkoxy, thioalkoxy, alkenyloxy, haloalkoxy, haloalkenyl, haloalkynyl, haloalkenyloxy, nitro, amino, nitroalkyl, nitroalkenyl, nitroalkynyl, nitroheterocyclic, alkylamino, dialkylamino, alkenylamine, aminoalkyl, alkynylamino, acyl, alkoxy, alkyloxyalkyl, alkoxyaryl, alkoxycarbonyl, alkoxycycloalkyl, alkoxyheteroaryl, alkoxyheterocyclic alkyl, alkenyl, acetylyl, acylamino, diacylamino, acyloxy, alkylsulfonyloxy, heterocycle, heterocyclic alkenyl, heterocyclic alkyl, heterocyclic alkylalkyl, heterocyclic alkylalkenyl Heterocyclic alkyl alkenyl, heterocyclic alkyl heteroalkyl, heterocyclic alkoxy, heterocyclic alkenyloxy, heterocyclic oxy, heterocyclic amino, alkyl sulfinyl, alkyl sulfonyl, alkyl sulfinyl, alkyl carbonyloxy, alkyl thio, acyl thio, amino sulfonyl, phosphorus-containing groups such as phosphonyl and phosphonyl oxy, sulfinyl, sulfinylamino, sulfonyl, sulfonylamino, aryl, arylalkyl, arylalkoxy, arylamino, aryl heteroalkyl, heteroaryl, heteroarylalkyl, heteroaryl alkenyl, heteroaryl alkynyl, heteroaryl heteroalkyl, heteroarylamino, heteroaryloxy, aryl alkenyl, arylalkyl, alkyl aryl, alkyl heteroaryl, aryloxy, aryl sulfonyl, cyano, cyanate, isocyanate.

[0062] Unless otherwise stated, "alkyl" as a group or part of a group refers to a straight-chain or branched aliphatic hydrocarbon group, preferably C1-C. 12 Alkyl, more preferably C1-C 10 Alkyl groups, preferably C1-C6. Examples of suitable straight-chain and branched C1-C6 alkyl substituents include methyl, ethyl, n-propyl, 2-propyl, n-butyl, sec-butyl, tert-butyl, hexyl, etc. The group can be a terminal group or a bridging group.

[0063] The term "therapeutic effective amount" or "effective amount" herein refers to the amount of a compound disclosed and / or described herein that, when administered to a patient requiring this treatment, is sufficient to achieve the treatment as defined herein. A therapeutically effective amount of a compound may be an amount sufficient to treat pain. Therapeuticly effective amounts will vary depending on factors such as the subject being treated and their disease condition, the subject's weight and age, the severity of the disease condition, the dosing regimen to be followed, the timing of administration, and the method of administration, all of which can be readily determined by one of ordinary skill in the art.

[0064] The term “treatment” in this article includes one or more of the following: suppressing a disease or condition; slowing or halting the development of clinical symptoms of a disease or condition; and / or alleviating a disease or condition (i.e., causing relief or resolution of clinical symptoms), and both complete or partial reduction of clinical symptoms of a disease or condition.

[0065] The term "therapeutic effect" in this article refers to the effect resulting from treatment, which at the animal level manifests as alteration, usually reduction or improvement of symptoms of disease or disease condition, or cure of disease or disease condition.

[0066] The term "acute postoperative (traumatic) pain" or "acute postoperative or post-traumatic pain" in this article refers to pain caused by surgical (traumatic) procedures, generally related to the tissue damaged by the surgery (traumatic) procedure, appearing immediately after the surgery (traumatic) and gradually subsiding as the tissue heals. Typically, the duration of acute postoperative (traumatic) pain is less than 3 months.

[0067] The term “chronic postoperative (traumatic) pain” or “chronic postoperative or post-traumatic pain” in this article refers to persistent pain following surgery (trauma), usually lasting more than 3 months, and which cannot be explained by other causes such as infection or other causes of pain.

[0068] The term "subject" in this article refers to an animal, such as a mammal. Mammals include, for example, mice, rats, dogs, cats, pigs, sheep, horses, cattle, and humans. Detailed Implementation

[0069] The present invention will be further described in detail below with reference to specific embodiments. It should be understood that the following embodiments are merely illustrative and explanatory of the present invention and should not be construed as limiting the scope of protection of the present invention. All technologies implemented based on the above content of the present invention are covered within the scope of protection intended by the present invention.

[0070] Example 1: Differential gene expression profile analysis of DRG cells in a surgically induced tissue trauma model at different time points The inventors discovered through preliminary clinical studies that postoperative pain levels differed between patients who underwent surgery in the morning and those who underwent surgery in the afternoon; this phenomenon was also observed in experimental animal studies. Using high-throughput sequencing, they aimed to screen for key factors and intervention targets, and subsequently launched a series of studies: 1. Experimental Methods Subjects: Male C57BL / 6J mice, 8-12 weeks old.

[0071] (1) Processing and grouping Morning incision surgery group (ZT0P, n=3): Incision surgery model was established between 8-9 am.

[0072] Afternoon incision surgery group (ZT12 P, n=3): Incision surgery model was established between 7-8 pm.

[0073] Morning sham surgery group (ZT0C, n=3): A sham incision surgical model was established between 8 and 9 am.

[0074] Afternoon sham surgery group (ZT12 C, n=3): A sham incision surgical model was established between 7-8 pm.

[0075] (2) Construction of a plantar incision pain model Mice were placed in an anesthesia induction box and anesthetized with 4% isoflurane. After anesthesia, they were removed and maintained with 1.5-2% isoflurane.

[0076] Disinfect the right hind paw with iodine solution. Using a No. 11 scalpel, make a longitudinal incision of about 0.5 cm from the front edge of the right heel toward the toes, through the skin and fascia of the sole of the foot, to expose the plantar muscle. Use curved forceps to lift the plantar muscle and make a longitudinal incision in the plantar muscle with the tip of the scalpel, but do not cut the plantar muscle.

[0077] The incision was closed with 6-0 surgical sutures, disinfected again with iodine, and the mice were returned to their cages. Pain thresholds were measured 24 hours before modeling and at 2 hours, 6 hours, 12 hours, 24 hours, 2 days, 4 days, and 7 days after modeling.

[0078] Sham surgery treatment: Except for not making incisions and suturing, the other procedures were the same as those in the experimental group.

[0079] (3) Sample collection and high-throughput transcriptomics analysis Twenty-four hours after the incision surgical model was established, mice were anesthetized with isoflurane and euthanized by decapitation. Spray disinfectant alcohol onto the back of the mice and cut off the skin on the back; use microscissors to cut the muscles along both sides of the spine, tear off the dorsal muscles of the spine, cut open the spinal canal, and take the L4-L6 segment DRG (dorsal root ganglion) tissue from the surgical side of the mice; mix 3 mice into one sample and perform high-throughput transcriptomics sequencing.

[0080] 2. Experimental Results like Figure 1 : Transcriptomic results showed that at time point ZT0 (morning), the surgical group had 103 upregulated genes and 85 downregulated genes compared to the control group, totaling 188 genes with differential expression. At time point ZT12 (afternoon), the surgical group had 106 upregulated genes and 93 downregulated genes compared to the control group, totaling 199 genes with differential expression. DEG overlap results showed that 26 genes had differential expression between the surgical group and the control group at both time points. Chemokine CXCL9 was one of the most significant differentially expressed genes among the 26 and is potentially related to pain.

[0081] Example 2: Upregulation of mRNA encoding CXCL9 and CXCR3 in DRG tissue after incision surgery 1. Experimental Methods Subjects: Male C57BL / 6J mice, 8-12 weeks old (1) Processing and grouping Morning incision surgery group (ZT0PINC): Incision surgery model was established between 8 and 9 am.

[0082] Afternoon incision surgery group (ZT12 PINC): Incision surgery model was established between 7-8 pm.

[0083] Morning sham surgery group (ZT0Sham): A sham incision surgical model was established between 8 and 9 a.m.

[0084] Afternoon sham surgery group (ZT12 Sham): A sham incision surgical model was established between 7 and 8 pm.

[0085] The plantar incision pain model was constructed as in Example 1, with 12 mice treated in each group.

[0086] (2) Real-time PCR detection of mRNA level changes After anesthetizing mice with isoflurane, DRG tissue samples were taken from the L4-L6 segment, using the same method as step 1 (3) in Example 1. RNA was extracted according to the Trizol (Thermofisher, No. 15596026CN) instructions; SuperScript™ III First-Strand Synthesis SuperMix for qRT-PCR Kit (Thermofisher, No. 18080400) reverse transcription, reaction system as follows: Reagent Name mass / volume 2X RT Reaction Mix 10 μL RT Enzyme Mix 2 μL RNA 1 μg DEPC water Up to 20 μL Changes in gene expression levels were detected by real-time PCR using the PowerUp SYBR Green Master Mix kit (Thermofisher, No. A46110).

[0087] 1) The reaction system is as follows: Reagent Name mass / volume PowerUp™ SYBR™ Green Master Mix (2X) 5 μL upper primer 1 μL lower primer 1 μL cDNA template 1 uL Nuclease-Free Water 2 μL 2) The reaction system was placed in a StepOnePlus Real-Time PCR instrument and the reaction conditions were as follows: preheating at 50°C for 2 minutes, denaturation at 95°C for 2 minutes, denaturation at 95°C for 15 seconds, annealing at 60°C for 15 seconds, chain extension at 72°C for 1 minute, and termination after 40 cycles.

[0088] 3) Three replicates were set for each sample, with β-actin as an internal reference. The results were analyzed by relative quantification using the 2-ΔΔCt method.

[0089] 4) Primer sequences are as follows: Gene (5′-3′) Bottom quotation (5′-3′) Annealing temperature (°C) CXCL9 CTCGGATCCGCCATGAAGTCCGCTGTTCTTTC TATGAATTCAAATTAACACTTTATGTTTTGTAG 60 CXCR3 GAGGTTAGTGAACGTCAAGTG GGGGTCCCTGCGGTAGATCTG 60 β-Actin AGAAGGACTCCTATGTGGGTGA CATGAGCTGGGTCATCTTTTCA 60 2. Experimental Results like Figure 2 : The mRNA expression levels of CXCL9 in the ZT0 PINC group and the ZT12 PINC group were higher than those in the corresponding Sham group, and the expression levels in the ZT12 PINC group and the Sham group were higher than those in the corresponding ZT0 group. The mRNA expression levels of CXCR3 in the ZT0 PINC group and the ZT12 PINC group were higher than those in the corresponding Sham group.

[0090] Example 3: Expression of CXCL9 and CXCR3 in DRG 1. Experimental Methods Subjects: Male C57BL / 6J mice, 8-12 weeks old.

[0091] (1) Animal perfusion sampling and dehydration Mice were anesthetized with 2.0% isoflurane, fixed on the operating table, and the thoracic cavity was cut open to fully expose the heart and aorta.

[0092] Insert the syringe needle into the heart, through the left ventricle to the ascending aorta and fix it in place. Cut open the left atrial appendage to form a perfusion cycle, and then perfuse 100 mL of 0.01 M PBS buffer and 100 mL of 4% paraformaldehyde fixative sequentially.

[0093] The ribs and vertebrae were cut open, and the lumbar enlargement of the spinal cord, the DRG and SCN (hypothalamus) tissues on both sides of L3-5 were removed and fixed in 4% paraformaldehyde fixative for 4 hours.

[0094] Remove the tissue and place it in a 20% sucrose solution (m / v) for dehydration, then place it in a refrigerator at 4°C to stand.

[0095] After the tissue has settled, replace it with a 30% sucrose solution (m / v) and store it in a 4°C refrigerator for later use.

[0096] (2) Frozen tissue sections Set the slicer head temperature to -20℃ and the slice thickness to 15 μm.

[0097] The tissues were arranged regularly on the specimen head, embedded with OTC glue, and then placed on the specimen stage to cool completely.

[0098] After the specimen has cooled completely, place the specimen head on the stage and begin slicing. Unfold the sliced ​​tissue and attach it to the glass slide.

[0099] When slicing, distinguish the left and right sides and the upper and lower segments of the spinal cord and mark them. After completion, store in a -80℃ refrigerator.

[0100] (3) Immunofluorescence detection Remove the preserved tissue sections and incubate them at room temperature for 30 minutes.

[0101] Add PBS buffer and rinse for 5 minutes.

[0102] After drawing circles around the tissue on the slide with an immunohistochemical pen, primary antibodies were added inside the circles: CXCL9 Rabbit Antibody (Thermofisher, No. 701117) + NeuN guinea pig Antibody (Sigma-Aldrich, No. ABN90); CXCR3 Rabbit Antibody (Thermofisher, No. PA5-23104) + NeuN guinea pig Antibody (Sigma-Aldrich, No. ABN90). Incubate overnight in a 4°C low-temperature room.

[0103] Remove the slide and rinse with PBS buffer for 5 minutes each time, 3 times.

[0104] Secondary antibodies were added: Cy™3 AffiniPure™ Donkey Anti-Rabbit (Jackson, No. AB_2307443) + Alexa Fluor® 647 Goat Anti-Guinea pigIgG H&L (Abcam, No. ab150187), and incubated at room temperature for 45 minutes.

[0105] After rinsing with PBS buffer for 5 minutes × 3 times, the slide was mounted with 50% glycerol, photographed using a laser confocal microscope, and the data was saved.

[0106] 2. Experimental Results like Figure 3 : CXCL9 and CXCR3 are expressed in mouse DRG and co-stained with the neuron-specific marker NeuN.

[0107] CXCL9 and CXCR3 are expressed in most DRG neurons.

[0108] Example 4: Pain in CXCR3 gene knockout mice after acute surgical incision showed significant and substantial improvement. Wild-type (WT) and CXCR3 knockout (CXCR3-KO) mice were subjected to an acute surgical incision model (PINC) experiment after one week of acclimatization. 1. Experimental Method: (1) Animal grouping CXCR3 knockout mice + PINC (n=8): CXCR3 knockout mice were used to establish the PINC model; Wild-type mice + PINC (n=8): Wild-type mice were used to create the PINC model.

[0109] (2) Establishment of mouse paw incision pain (PINC) model The specific procedure for the mouse plantar incision pain model (PINC) is as follows: mice are general anesthetized with 2% isoflurane to ensure an appropriate depth of anesthesia (no response when the foot is clamped).

[0110] Disinfect the right hind paw of the mouse with alcohol and iodine. After disinfection, make an incision of about 5 mm in the center of the right hind paw with a No. 111 blade (made in Korea). Use curved forceps to lift the paw muscle and then use the blade to make longitudinal cuts on the paw muscle 10 times (be careful to avoid damaging the nerves).

[0111] The skin was then sutured with 7-0 nylon sutures, and the wound was disinfected with iodine solution and blood removed. Finally, the mouse was returned to its cage, its body temperature was maintained with a heat blanket, and its recovery was observed.

[0112] 2. Mechanical pain threshold measurement Using Von Frey silk, the 50% claw retraction threshold in mice was determined by the up-down method as an indicator of mechanical hyperalgesia in mice.

[0113] Before the first pain test, mice were placed in the pain testing device for at least 0.5 hours to familiarize themselves with the testing room and device, for at least 3 days. On the day of the test, the mice were placed on a metal mesh pain testing frame, covered with a transparent plexiglass cage, and kept in a quiet environment with suitable lighting, allowing them to acclimatize for 15 minutes.

[0114] After the mice have fully adapted to the environment, use Von Frey silk (0.04, 0.07, 0.16, 0.4, 0.6, 1.0, 1.4, 2.0, 4.0 g) to vertically stimulate the test area on the bottom of the hind paw for 3-5 seconds. The force should be such that the Von Frey silk is slightly bent. The initial test intensity is 0.6 g.

[0115] If a positive reaction occurs during the test (such as rapidly retracting the claws, shaking the claws, or licking the claws), then a lower-level Von Frey silk test is used; if the test result is negative (no positive reaction behavior), then a higher-level Von Frey silk test is used.

[0116] If 0.6g is a positive reaction, test 4 more times after the first negative reaction and record the results; if 0.6g is a negative reaction, test 4 more times after the first positive reaction and record the results; if the positive result is continuous, record up to the maximum value of 4.0g; if the negative result is continuous, record up to the minimum value of 0.04g.

[0117] The method described in the reference (PMID: 7990513) uses Matlab software to calculate the 50% PWT value.

[0118] Vonfrey tests were performed at 2h, 6h, 12h and 24h after PINC surgery.

[0119] 3. Result Description: like Figure 4 As shown, the changes in 50% withdrawal threshold (PWT) at different time points before and after plantar incision surgery (marked by red arrows). Mechanical pain threshold measurements were taken at baseline (BL) and at 2h, 6h, 12h, and 24h postoperatively. Data are expressed as mean ± standard error (n=8), ****p<0.0001, CXCR3-KO vs WT. We further evaluated the role of CXCR3 in plantar incision-induced postoperative pain. There was no statistically significant difference in baseline mechanical pain threshold between wild-type (WT) and CXCR3 knockout (CXCR3-KO) mice. Following plantar incision surgery, wild-type mice showed a significant decrease in pain threshold within 2 hours and maintained a low level until 24 hours. However, CXCR3-KO mice maintained a relatively stable pain threshold level throughout the entire postoperative period (2h–24h), close to their baseline value. This indicates that CXCR3 deficiency can significantly alleviate the decrease in mechanical pain threshold induced by plantar incision surgery.

[0120] Example 5: Intrathecal injection of the CXCL9 recombinant protein, the ligand corresponding to the CXCR3 receptor, induced hyperalgesia in normal mice. 1. Experimental Methods Subjects: Male C57BL / 6J mice, 8-12 weeks old.

[0121] Drug: CXCL9 recombinant protein (LifeSpan BioSciences, LS-G24556-50).

[0122] Solvent: Physiological saline.

[0123] (1) Drugs and grouping CXCL9 group (n=11): Normal mice were intrathecally injected with 200 ng / 5 μL of recombinant CXCL9 protein; Solvent control group (n=7): Normal mice were injected intrathecally with 5 μL of physiological saline.

[0124] (2) Intrathecal injection Mice were placed in an anesthesia induction box and anesthetized with 4% isoflurane. After anesthesia, they were removed and anesthesia was maintained with 1.5-2% isoflurane. Using a 30G microsyringe, with the L5-L6 interspinous space as the puncture point, place the left thumb and stop on both sides of the interspinous space and stretch the skin outward, and hold the microsyringe in the right hand to slowly insert the needle vertically into the interspinous space. When the rat exhibits a tail-flicking motion, the assistant presses on the jugular vein on one side of the rat, and injects 5 μL of the drug after aspirating cerebrospinal fluid with a syringe.

[0125] (3) Measurement of mechanical pain threshold Using Von Frey silk, the 50% claw retraction threshold in mice was determined by the up-down method as an indicator of mechanical hyperalgesia in mice.

[0126] Before the first pain test, mice were placed in the pain testing device for at least 0.5 hours to familiarize themselves with the testing room and device, for at least 3 days. On the day of the test, the mice were placed on a metal mesh pain testing frame, covered with a transparent plexiglass cage, and kept in a quiet environment with suitable lighting, allowing them to acclimatize for 15 minutes.

[0127] After the mice have fully adapted to the environment, use Von Frey silk (0.04, 0.07, 0.16, 0.4, 0.6, 1.0, 1.4, 2.0, 4.0 g) to vertically stimulate the test area on the bottom of the hind paw for 3-5 seconds. The force should be such that the Von Frey silk is slightly bent. The initial test intensity is 0.6 g.

[0128] If a positive reaction occurs during the test (such as rapidly retracting the claws, shaking the claws, or licking the claws), then a lower-level Von Frey silk test is used; if the test result is negative (no positive reaction behavior), then a higher-level Von Frey silk test is used.

[0129] If 0.6g is a positive reaction, test 4 more times after the first negative reaction and record the results; if 0.6g is a negative reaction, test 4 more times after the first positive reaction and record the results; if the positive result is continuous, record up to the maximum value of 4.0g; if the negative result is continuous, record up to the minimum value of 0.04g.

[0130] The method described in the reference (PMID: 7990513) uses Matlab software to calculate the 50% PWT value.

[0131] PWT was measured before administration (BL) and at 2, 6, 12 and 24 hours after administration.

[0132] 2. Experimental Results like Figure 5 Table 1: Table 1 Time point CXCL9 recombinant protein saline group BL 1.27±0.26 1.29±0.5 0.92 2h 0.86±0.37 1.23±0.29 0.03 6h 0.91±0.61 1.35±0.43 0.09 12h 1.07±0.35 1.15±0.19 0.53 24h 1.17±0.45 1.14±0.18 0.83 Area under the curve 4.06±0.62 4.95±0.47 0.005 Compared to the solvent control group, the mechanical pain threshold was significantly reduced in mice 2 hours after intrathecal injection of recombinant CXCL9 protein. p< 0.01), recovers in 24 hours; Compared to the solvent control group, the area under the curve of the mechanical pain threshold after intrathecal injection of CXCL9 recombinant protein was significantly lower than that of the control group, indicating that intrathecal injection of CXCL9 recombinant protein can induce pain sensitization in normal mice.

[0133] Example 6: Intrathecal injection of the CXCL9 neutralizing antibody, the ligand corresponding to the CXCR3 receptor, can alleviate postoperative (traumatic) pain in mice undergoing incision surgery. 1. Experimental Methods Subjects: Male C57BL / 6J mice, 8-12 weeks old.

[0134] Drug: CXCL9 neutralizing antibody (R&D Systems, AF-492-SP).

[0135] Solvent: Physiological saline.

[0136] (1) Construction of the plantar incision pain model, the method is the same as step (2) in Example 1; (2) Drugs and grouping Foot incision + CXCL9 neutralizing antibody group (n=11): Mice with foot incision model were intrathecally injected with 200 ng / 5 μL of CXCL9 neutralizing antibody; Foot incision + solvent control group (n=10): 5 μL of physiological saline was injected intrathecally into mice with the foot incision model.

[0137] (3) Measurement of mechanical pain threshold Using Von Frey silk, the 50% claw retraction threshold of mice was detected by the Up-Down method as an indicator of mechanical hyperalgesia in mice, the method being the same as step 1 (3) in Example 5.

[0138] PWT was measured 24 h before surgery, 2 h after surgery, 6 h after surgery, 12 h after surgery, and 24 h after surgery.

[0139] 2. Experimental Results like Figure 6 Table 2: Table 2 Time point CXCL9 recombinant protein saline group BL 2.01±0.56 1.96±0.55 0.999 2h 2.24±0.73 1.14±0.58 0.005 6h 1.88±0.8 0.92±0.24 0.012 12h 2.03±0.81 0.89±0.35 0.004 24h 2.11±0.81 0.77±0.39 0.001 Area under the curve 8.21±1.08 4.31±0.61 <0.0001 The mechanical pain threshold of the plantar incision + CXCL9 neutralizing antibody group was significantly higher than that of the solvent control group at 2, 6, 12 and 24 hours after surgery, indicating that the CXCL9 neutralizing antibody can alleviate the hyperalgesia caused by plantar incision surgery. Compared to the solvent control group, the area under the curve of the mechanical pain threshold after intrathecal injection of CXCL9 neutralizing antibody was significantly higher than that of the control group, indicating that intrathecal injection of CXCL9 neutralizing antibody can relieve pain hypersensitivity caused by plantar incision surgery.

[0140] Example 7: Intrathecal inhibition of CXCR3 alleviates postoperative pain in a mouse model of surgical incision. 1. Experimental Methods Subjects: Male C57BL / 6J mice, 8-12 weeks old.

[0141] Drug: CXCR3 selective target inhibitor compound A (MCE, HY-15319).

[0142] Solvent: 20% 2-hydroxypropyl-β-cyclodextrin (m / v), dissolved in physiological saline.

[0143] (1) Construction of the plantar incision pain model, the method is the same as step (2) in Example 1.

[0144] (2) Drugs and grouping Compound A + incision surgery group (n=14): immediately after incision modeling (0 hours), 20 μg of compound A dissolved in 20% 2-hydroxypropyl-β-cyclodextrin (4 μg / μL*5 μL) was injected intrathecally.

[0145] Solvent control + incision surgery group (n=11): 5 μL of 20% 2-hydroxypropyl-β-cyclodextrin was injected intrathecally immediately after incision modeling (0 hours).

[0146] (3) Measurement of mechanical pain threshold Using Von Frey silk, the 50% claw retraction threshold of mice was detected by the Up-Down method as an indicator of mechanical hyperalgesia in mice, the method being the same as step 1 (3) in Example 5.

[0147] PWT was measured 24 h before surgery, 3 h, 6 h, 12 h and 24 h after surgery.

[0148] 2. Experimental Results like Figure 7 Table 3: Table 3 Time point control group Group A of compounds BL 1.86±0.52 2.16±0.76 0.726 2h 0.88±0.18 2.36±0.94 <0.001 6h 0.87±0.25 2.14±0.77 <0.001 12h 0.77±0.35 2.03±0.84 <0.001 24h 0.68±0.21 2.02±0.93 <0.001 Area under the curve 8.73±1.21 3.81±0.43 <0.0001 There was no statistically significant difference in PWT between the two groups 24 hours before surgery (BL). p >0.1), indicating that the baseline values ​​of the two groups were the same before the intervention.

[0149] At four time points—2h, 6h, 12h, and 24h post-surgery—the PWT values ​​in compound A group were significantly higher than those in the control group.p< The result was 0.001, indicating that intrathecal injection of compound A could significantly reverse the decrease in pain threshold in mice caused by incision surgery.

[0150] Example 8: Intravenous injection of CXCR3 selective target inhibitor compound A relieves postoperative (traumatic) pain in a surgical model mouse. 1. Experimental Methods Subjects: Male C57BL / 6J mice, 8-12 weeks old.

[0151] Drug: CXCR3 selective target inhibitor compound A (MCE, HY-15319).

[0152] Solvent: 20% 2-hydroxypropyl-β-cyclodextrin (m / v), dissolved in physiological saline.

[0153] (1) Construction of the plantar incision pain model, the specific method is the same as step (2) in Example 1; (2) Drugs and grouping Compound A + incision surgery group (n=10): Compound A, 4 mg / kg (4 μg / μL), dissolved in 20% 2-hydroxypropyl-β-cyclodextrin, was injected via the tail vein immediately after incision modeling (0 hours), 10 hours, 22 hours and 46 hours later.

[0154] Solvent control + incision surgery group (n=12): 20% 2-hydroxypropyl-β-cyclodextrin was injected via tail vein immediately after incision modeling (0 hours), 10 hours, 22 hours and 46 hours (injection volume was the same as compound A + incision surgery group).

[0155] (3) Measurement of mechanical pain threshold Using Von Frey silk, the 50% claw retraction threshold of mice was detected by the Up-Down method as an indicator of mechanical hyperalgesia in mice, the method being the same as step 1 (3) in Example 5.

[0156] PWT was measured 24 hours before surgery, and 2 hours, 6 hours, 12 hours, 24 hours, 2 days, 4 days, and 7 days after surgery.

[0157] 2. Experimental Results like Figure 8 Table 4: Table 4 Time point control group Group A of compounds BL 1.75±0.64 1.91±0.6 0.998 2h 0.78±0.16 1.5±0.61 0.038 6h 0.87±0.35 1.51±0.64 0.105 12h 0.84±0.36 1.5±0.46 0.015 24h 0.76±0.36 1.26±0.31 0.016 2d 0.86±0.45 1.48±0.41 0.024 4d 1.08±0.42 1.36±0.68 0.932 7d 1.72±0.83 1.71±0.64 >0.9999 Area under the curve 10.42±1.03 6.93±0.82 <0.0001 There was no statistically significant difference in PWT between the two groups 24 hours before surgery (BL). p >0.1), indicating that the baseline values ​​of the two groups were the same before intervention; 6 hours after the operation, the PWT value of compound A group was higher than that of the control group, although the difference was not statistically significant. p The value is close to 0.1 (p =0.1051); on postoperative days 4 and 7, the model was in the recovery period, and there was no statistically significant difference between the two groups ( p >0.1).

[0158] At four time points—2h, 12h, 24h, and 48h post-surgery—the PWT values ​​in compound A group were significantly higher than those in the control group. p The value <0.05 indicates that compound A can significantly reverse the decrease in pain threshold in mice caused by incision surgery.

[0159] Example 9: Intravenous injection of compound B improved acute postoperative pain induced by plantar incision (PINC) in mice. 1. Experimental Materials Compound B used in this invention was purchased from MCE (HY-10017) and prepared using 20% ​​sulfobutyl ether β-cyclodextrin. Male C57BL / 6J mice aged 7-8 weeks were purchased from Beijing Vital River Pharmaceutical Co., Ltd., and were subjected to experiments after one week of acclimatization.

[0160] 2. Experimental Methods (1) Animal grouping Sham+vehicle (n=6): Normal mice were injected with 20% sulfobutyl ether β-cyclodextrin via the tail vein; PINC+vehicle (n=6): PINC model mice were injected with 20% sulfobutyl ether β-cyclodextrin via the tail vein; PINC+ compound B-4 mg (n=6): PINC model mice were injected via tail vein with 4 mg / kg of compound B (MCE, HY-10017, dissolved in 20% sulfobutyl ether β-cyclodextrin). PINC+ compound B-8 mg (n=6): 8 mg / kg of compound B (MCE, HY-10017, dissolved in 20% sulfobutyl ether β-cyclodextrin) was injected into the tail vein of PINC model mice.

[0161] 3. Establishment of a mouse model of plantar incision pain (PINC) The mouse foot incision pain model was established using the following procedure: mice were given general anesthesia with 2% isoflurane to ensure an appropriate depth of anesthesia (no reaction when the foot was clamped).

[0162] Disinfect the sole of the mouse's right hind paw with alcohol and iodine. After disinfection, make an incision of about 5 mm in the center of the sole of the mouse's right hind paw with a No. 111 blade (made in Korea). Use curved forceps to lift the foot muscle and then use the blade to make longitudinal cuts on the foot muscle 10 times (be careful to avoid damaging the nerves). The skin was then sutured with 7-0 nylon sutures, and the wound was disinfected with iodine and the blood was removed. Finally, the mice were returned to their cages, their body temperature was maintained using a warming blanket, and their recovery was observed. Postoperatively, the drug was administered via the tail vein immediately, at 10 h, 22 h, and 46 h.

[0163] 4. Mechanical pain threshold measurement Using Von Frey wire, the 50% mechanical withdrawal threshold in mice was detected by the Up-Down method as an indicator of mechanical hyperalgesia in mice, following the same procedure as step (3) in Example 5. Von Frey detection was performed before PINC surgery and at 2 h, 6 h, 12 h, 24 h, and 48 h after surgery.

[0164] 5. Experimental Results like Figure 9 As shown, PINC surgical modeling significantly reduced the mechanical pain threshold in mice. The area under the curve (AUC) of compound B after tail vein injection at 4 mg / kg or 8 mg / kg was significantly higher than that in the PINC+vel group. This indicates that tail vein injection of compound B can effectively alleviate hyperalgesia induced by plantar incision surgery.

[0165] Example 10: Intravenous injection of compound A and its isomers relieves pain in mice equivalent to morphine. 1. Experimental Methods Subjects: Male C57BL / 6J mice, 8-12 weeks old.

[0166] Drugs: Compound A (MCE, HY-15319), morphine hydrochloride injection (Hubei Renfu Pharmaceutical Co., Ltd.)

[0167] Solvent: Compound A was prepared as 20% 2-hydroxypropyl-β-cyclodextrin (m / v) and dissolved in physiological saline; morphine hydrochloride injection was dissolved in physiological saline.

[0168] (1) Construction of the plantar incision pain model, the specific method is the same as step (2) in Example 1.

[0169] (2) Drugs and grouping Compound A 5 mg / kg + PINC group (n=13): Compound A (4 μg / μL) 5 mg / kg dissolved in 20% 2-hydroxypropyl-β-cyclodextrin was injected via the tail vein immediately after incision modeling (0 hours) and 22 hours later.

[0170] Morphine 5mg / kg + PINC group (n=8): Morphine injection solution (4μg / μL) 5mg / kg dissolved in normal saline was injected via the tail vein immediately after incision modeling (0 hours) and 22 hours later.

[0171] Solvent control + PINC (n=8): physiological saline was injected via the tail vein immediately after incision modeling (0 hours) and 22 hours later, at a concentration of 1.25 μL / g.

[0172] (3) Measurement of mechanical pain threshold Using Von Frey silk, the 50% claw retraction threshold of mice was detected by the Up-Down method as an indicator of mechanical hyperalgesia in mice, the method being the same as step 1 (3) in Example 5.

[0173] PWT was detected 24 hours before modeling, 2 hours after modeling, and 24 hours after modeling.

[0174] 2. Experimental Results like Figure 10 Table 5: Table 5 Time point Compound A morphine solvent BL 2.08±0.61 2.16±0.71 2.11±0.64 2h 1.72±0.97 1.83±1.34 0.97±0.35 24h 1.76±0.68 1.86±0.82 0.54±0.21 Area under the curve 3.65±0.82 3.84±1.09 2.3±0.42 There was no statistically significant difference in PWT among the four groups 24 hours before modeling (BL). p >0.1), indicating that the baseline values ​​of the four groups were the same before the intervention.

[0175] At two time points, 2 h and 24 h after modeling, the PWT values ​​of the compound A 5 mg / kg group and the morphine 5 mg / kg group were significantly higher than those of the solvent control group. p <0.05), indicating that intravenous injection of compound A 5 mg / kg and morphine 5 mg / kg can significantly reverse the surgical-induced decrease in pain threshold in mice.

[0176] At 2 h and 24 h after modeling, there was no statistically significant difference in PWT values ​​among the three groups (compound A 5 mg / kg group, morphine 5 mg / kg group), indicating that the analgesic effect of compound A 5 mg / kg is similar to that of morphine 5 mg / kg.

[0177] Example 11: Effects of intravenous injection of compound A and morphine on motor behavior in mice 1. Experimental Methods Subjects: Male C57BL / 6J mice, 8-12 weeks old.

[0178] Drugs: Compound A (MCE, HY-15319); Morphine Hydrochloride Injection (Hubei Renfu Pharmaceutical Co., Ltd.)

[0179] Solvent: Compound A was prepared as 20% 2-hydroxypropyl-β-cyclodextrin (m / v) and dissolved in physiological saline; morphine hydrochloride injection was dissolved in physiological saline.

[0180] (1) Drugs and grouping Group A (5 mg / kg, n=6): Compound A (4 μg / μL) was injected via tail vein at a dose of 5 mg / kg, which was dissolved in 20% 2-hydroxypropyl-β-cyclodextrin.

[0181] Compound A 10 mg / kg group (n=6): Compound A (8 μg / μL) 10 mg / kg dissolved in 20% 2-hydroxypropyl-β-cyclodextrin was injected via tail vein.

[0182] Morphine 5 mg / kg group (n=6): morphine injection solution (4 μg / μL) dissolved in normal saline was injected via the tail vein at a dose of 5 mg / kg.

[0183] Morphine 10 mg / kg group (n=6): morphine injection solution (8μg / μL) dissolved in normal saline was injected via the tail vein at a dose of 10 mg / kg.

[0184] Solvent control group: 1.25 μL / g of normal saline was injected via the tail vein.

[0185] (2) Open field test (OFT) The open field testing system consists of an open field box and a video tracking system; Before the experiment, mice were placed in the experimental environment for 5-10 minutes to acclimatize, in order to reduce pre-experimental stress. The OPT experiment was started 1-2 hours after drug administration. At the beginning of the experiment, the mice were gently placed in the center of the open field box, and the video tracking system was activated to continuously record the behavior of the mice for 5 minutes. Observe and record the total movement distance, time spent in the central area, number of times the mice stand up, number of fecal particles, modification behavior, speed and acceleration, and other indicators of the mice.

[0186] 2. Experimental Results like Figure 11 Table 6: Table 6 Grouping Total distance solvent Vehicle 60.12±10.02 / Compound A 5 mg / kg 66.88±54.39 0.7325 Compound A 10 mg / kg 57.62±9.66 0.8945 Morphine 5mg / kg 125.88±35.86 0.0018 Morphine 10mg / kg 201±34.31 <0.0001 Compared to the Vehicle (solvent) group, there was no statistically significant difference in movement distance between the compound A 5 mg / kg group and the compound A 10 mg / kg group. p >0.1); Compared to the Vehicle (solvent) group, mice in the morphine 5 mg / kg and morphine 10 mg / kg groups showed a significant increase in movement distance and exhibited marked abnormal activity. p <0.01); Example 12: Compared to morphine, intraperitoneal injection of compound A did not induce pain sensitization in normal mice. 1. Experimental Methods Subjects: Male C57BL / 6J mice, 8-12 weeks old.

[0187] Drugs: Compound A (MCE, HY-15319); Morphine Hydrochloride Injection (Hubei Renfu Pharmaceutical Co., Ltd.)

[0188] Solvent: Compound A was prepared as 20% 2-hydroxypropyl-β-cyclodextrin and dissolved in physiological saline; morphine hydrochloride injection was dissolved in physiological saline.

[0189] (1) Drugs and grouping Group A of compounds (n=8): Compound A dissolved in 20% 2-hydroxypropyl-β-cyclodextrin was administered via intraperitoneal injection.

[0190] Morphine group (n=8): Morphine solution dissolved in physiological saline was injected intraperitoneally.

[0191] Solvent control group (β-cyclodextrin, n=6): 20% 2-hydroxypropyl-β-cyclodextrin was injected intraperitoneally.

[0192] Solvent control group (physiological saline, n=6): intraperitoneal injection of physiological saline (2) Establishment of pain sensitization model Mice were intraperitoneally injected with compound A or morphine at doses of 10 mg / kg (2 μg / μL), 20 mg / kg (2 μg / μL), 30 mg / kg (5 μg / μL), 40 mg / kg (5 μg / μL), and 50 mg / kg (10 μg / μL) on days 1-5, respectively. The solvent control group was injected with the same volume of solvent (20% 2-hydroxypropyl-β-cyclodextrin or physiological saline). (3) Measurement of mechanical pain threshold Using Von Frey silk, the 50% claw retraction threshold of mice was detected by the Up-Down method as an indicator of mechanical hyperalgesia in mice, the method being the same as step 1 (3) in Example 5.

[0193] PWT was measured before drug injection, and 3 and 7 days after the last injection.

[0194] 2. Experimental Results like Figure 12 Table 7: Table 7 Time point Compound A morphine solvent physiological saline BL 1.64±0.42 2.05±0.81 1.48±0.46 1.98±0.57 3d 2.08±0.6 0.61±0.15 1.72±0.86 1.47±0.58 7d 1.87±0.33 0.85±0.43 1.47±0.27 1.87±0.51 Area under the curve 3.84±0.5 2.06±0.47 3.19±0.66 3.39±0.56 Compared to the Vehicle (solvent) group, there was no statistically significant difference in mechanical pain threshold between mice in the Compound A group at 3 and 7 days after the end of drug administration (p>0.1). Compared to the Vehicle group, the mechanical pain threshold of mice in the morphine group was significantly reduced 3 and 7 days after the end of drug administration, and the mice showed obvious hyperalgesia (p<0.01).

[0195] Example 13: Intravenous injection of compound A relieves chronic postoperative (traumatic) pain in SMIR model mice 1. Experimental Methods Subjects: Male C57BL / 6J mice, 8-12 weeks old.

[0196] Drug: CXCR3 selective target inhibitor compound A (MCE, HY-15319).

[0197] Solvent: 20% 2-hydroxypropyl-β-cyclodextrin (m / v), dissolved in physiological saline.

[0198] (1) Construction of a chronic pain model after surgery This experiment used a mouse skin / muscle incision and retraction (SMIR) model as a model of postoperative chronic pain. Mice were anesthetized with 2% isoflurane and fixed in a supine position. Hair was removed from the surgical area in the middle of the right hind limb, and the area was disinfected with iodine. The surgical area was repeatedly wiped with 75% alcohol to expose the saphenous vein. A 1.0–1.3 cm long skin incision was made 3 mm medial to the saphenous vein, exposing the superficial gracilis muscle. The superficial muscle was bluntly dissected, revealing the white adductor fascia. A self-made 1 cm wide micro-retractor was inserted. The skin / muscle was pulled apart, revealing the white adductor fascia, and retraction was maintained for 1 hour. During the retraction process, the saphenous nerve was stretched and displaced by the retractor, but because it was located on the surface of the muscle, it was not compressed by hard objects such as bone. The incision was kept moist with sterile saline gauze during retraction, and the skin / muscle was sutured with 6-0 nylon sutures after 1 hour.

[0199] (2) Drugs and grouping Compound A+SMIR group (n=10): Compound A, 4 mg / kg (4 μg / μL) dissolved in 20% 2-hydroxypropyl-β-cyclodextrin, was injected via the tail vein immediately after modeling (0 hours) and daily from 1 to 21 days.

[0200] Solvent control + SMIR group (n=12): 20% 2-hydroxypropyl-β-cyclodextrin was injected into the tail vein immediately after modeling (0 hours) and daily from day 1 to day 21 (injection volume was the same as that of compound A + incision surgery group).

[0201] (3) Measurement of mechanical pain threshold Using Von Frey silk, the 50% claw retraction threshold of mice was detected by the Up-Down method as an indicator of mechanical hyperalgesia in mice, the method being the same as step 1 (3) in Example 5.

[0202] PWT was measured 24 hours before surgery and 7, 14 and 21 days after surgery.

[0203] 2. Experimental Results like Figure 13 As shown in Table 8: Table 8 Time point control group Group A of compounds BL 1.98±0.39 2.09±0.56 0.5280 7d 0.50±0.19 1.16±0.18 0.0004 14d 0.60±0.20 1.29±0.52 0.0002 21d 0.55±0.22 1.37±0.32 <0.0001 Area under the curve 10.42±1.03 6.93±0.82 <0.0001 It is evident that there was no statistically significant difference in PWT between the two groups 24 hours preoperatively (BL). p >0.1), indicating that the baseline values ​​of the two groups were the same before intervention; at three time points of 7 days, 14 days, and 21 days after surgery, the PWT values ​​of compound A group were significantly higher than those of the control group ( p <0.05), the area under the curve of compound A was significantly higher than that of the control group ( p The result was <0.001, indicating that compound A could significantly reverse chronic pain in SMIR model mice.

[0204] The embodiments of the present invention have been described above. However, the present invention is not limited to the above embodiments. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. The use of CXCR3 and / or CXCL9 as diagnostic and / or companion diagnostic markers in evaluating postoperative or posttraumatic pain products.

2. Application of CXCR3 inhibitors and / or CXCL9 neutralizing antibodies in the preparation of drugs for treating postoperative or post-traumatic pain.

3. The application according to claim 1 or 2, characterized in that, The postoperative or post-traumatic pain refers to acute postoperative or post-traumatic pain or chronic postoperative or post-traumatic pain. The CXCR3 inhibitor is a drug that relieves pain by inhibiting the expression level and / or biological activity of CXCR3; preferably, the CXCR3 inhibitor is a drug that relieves pain by inhibiting the binding of CXCL9 to CXCR3; preferably, the CXCR3 inhibitor is a small molecule antagonist with a molecular weight of less than 900 Da, more preferably less than 800 Da, and more preferably less than 700 Da.

4. The application according to claim 3, characterized in that, The CXCR3 inhibitors are compounds having the following structure (I), pharmaceutically acceptable salts thereof, solvates thereof, or derivatives thereof: (I) Among them, R 1 R 2 and R 3 It can be independently selected from hydrogen, halogen, and C. 1-10 Alkyl, optionally substituted C 1-10 Alkyl or optionally substituted ethers; the substituents on the alkyl or ether are selected from: halogen, hydroxyl, mercapto, amino, amide, C 1-10 Alkylamide or di(C) 1-10 Alkyl) amide group; Z is selected from CR a Or N, R a Selected from hydrogen, halogens, optionally substituted alkyl halides, or optionally substituted ethers; R 4 It is an optionally substituted C1-10 alkyl group, wherein the substituent on the alkyl group is selected from: halogen, hydroxyl, mercapto, amino, amide, C1-10 alkylamide or di(C1-10 alkyl)amide; Preferably, the halogen is selected from F, Cl, Br, or I; R 1 R 2 Or R 3 Each is independently selected from the arbitrarily substituted C 1-10 Alkyl or optionally substituted ethers; The optional substitution of C 1-10 Alkyl groups preferably have halogenated C 1-10 Alkyl groups; such as monohalogenated, dihalogenated, or trihalogenated C4 groups. 1-10 Alkyl; more preferably trihalogenated C 1-10 Alkyl groups, such as trihalomethyl, trihaloethyl, trihalopropyl, or trihalobutyl; more preferably, such as trifluoromethyl; The optionally substituted ether is selected from the optionally substituted C 1-10 Alkyl ethers; such as monohalogenated, dihalogenated, or trihalogenated C460-hydroxyl groups. 1-10 Alkyl ethers; more preferably trihalogenated C 1-10 Alkyl ethers, such as trihalomethyl ethers, trihaloethyl ethers, trihalopropyl ethers, or trihalobutyl ethers; more preferably, such as trifluoromethyl ethers; R 4 Selected from methyl, ethyl, propyl, or butyl; Z is selected from N; More preferably, R 1 Selected from H, R 2 Selected from F, R 3 Selected from CF3, R 4 Selected from ethyl; or R 1 Selected from H, R 2 Selected from -O-CF3, R 3 Selected from H, R 4 Selected from ethyl.

5. The application according to claim 4, characterized in that, The CXCR3 inhibitors are compounds, pharmaceutically acceptable salts, solvates, or derivatives thereof with the following structures: or , The CXCR3 inhibitor may be an R-isomer, an S-isomer, or a mixture thereof of the compound; Preferably, the CXCR3 inhibitor is compound A. Or the CXCR3 inhibitor is compound B. 。 6. A medicine for treating postoperative or post-traumatic pain, characterized in that, The drug comprises a CXCR3 inhibitor and a pharmaceutically acceptable carrier or excipient, preferably, the CXCR3 inhibitor is compound A, compound B or a pharmaceutically acceptable salt, solvate or derivative thereof, wherein compound A or compound B is as defined in claim 7; Preferably, the drug can be administered by injection, oral administration, inhalation, transdermal administration, topical cream or gel or powder, or rectal administration, and the injection is further preferably intrathecal injection, intraperitoneal injection, or intravenous injection; Preferably, the concentration of compound A or its pharmaceutically acceptable salt, solvate or derivative thereof is 2-10 μg / μL, for example 2 μg / μL, 3 μg / μL, 4 μg / μL, 5 μg / μL, 6 μg / μL, 7 μg / μL, 8 μg / μL, 9 μg / μL, 10 μg / μL; Preferably, the injectable dose of compound A or its pharmaceutically acceptable salts, solvates or derivatives thereof is 4-50 mg / kg, more preferably 5-40 mg / kg, for example 4 mg / kg, 5 mg / kg, 6 mg / kg, 7 mg / kg, 8 mg / kg, 9 mg / kg, 10 mg / kg, 11 mg / kg, 12 mg / kg, 13 mg / kg, 14 mg / kg, 15 mg / kg, 16 mg / kg, 17 mg / kg, 18 mg / kg, 19 mg / kg, 20 mg / kg, 21 mg / kg, 22 mg / kg, 23 mg / kg, 24 mg / kg, 25 mg / kg, 26 mg / kg, 27 mg / kg, 28 mg / kg, 29 mg / kg, 30 mg / kg, 31 mg / kg, 32 mg / kg, 33 mg / kg, 34 mg / kg, 35 mg / kg, 36 mg / kg, 37 mg / kg, 38 mg / kg, 39 mg / kg, etc. mg / kg, 40 mg / kg, 41 mg / kg, 42 mg / kg, 43 mg / kg, 44 mg / kg, 45 mg / kg, 46 mg / kg, 47 mg / kg, 48 mg / kg, 49 mg / kg, 50 mg / kg; Preferably, the intrathecal injection is a single injection; the intravenous injection is multiple injections at intervals of 10-23 hours; for example, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, and 23 hours. The postoperative or post-traumatic pain mentioned refers to acute postoperative or post-traumatic pain or chronic postoperative or post-traumatic pain.

7. A method for treating postoperative or post-traumatic pain, characterized in that, The method includes the step of administering a therapeutically effective amount of a CXCR3 inhibitor to a subject in need, preferably, the CXCR3 inhibitor being compound A, compound B, or a pharmaceutically acceptable salt, solvate, or derivative thereof, and the subject being a mammal, preferably a human; preferably, the postoperative or post-traumatic pain is acute postoperative or post-traumatic pain and chronic postoperative or post-traumatic pain, and compound A and compound B are as defined in claim 5.

8. A kit for diagnosing and / or comorbid diagnosing postoperative or post-traumatic pain, characterized in that, The markers include CXCR3 and / or CXCL9. Preferably, the levels of CXCR3 and / or CXCL9 are directly proportional to the degree of pain. Preferably, the mRNA expression levels of CXCR3 and / or CXCL9 are directly proportional to the degree of pain. Preferably, CXCL9 and / or CXCR3 are mostly expressed in DRG neurons.

9. A method for diagnosing or accompanying diagnoses of the degree of pain after surgery or trauma, characterized in that: The method includes steps for detecting CXCL9 and CXCR3 factor levels; preferably, steps for detecting and comparing CXCL9 and CXCR3 factor levels before / after surgery or before / after trauma; preferably, steps for detecting CXCL9 and CXCR3 factor levels in DRG neurons; and preferably, steps for detecting CXCL9 and CXCR3 factor content.

10. The application of a CXCR3 receptor-corresponding ligand CXCL9 neutralizing antibody in the preparation of drugs to relieve postoperative or post-traumatic pain; Alternatively, the use of compounds of structure (I), their pharmaceutically acceptable salts, solvates, or derivatives thereof in the preparation of medicaments for the prevention and / or treatment of postoperative or post-traumatic pain, characterized in that... The structure (I) compound and its substituents are defined as in claim 4, preferably, the structure (I) compound is compound A or compound B as defined in claim 5.

Images