Application of gpx7 in liver regeneration and liver function recovery after hepatectomy

CN122609708APending Publication Date: 2026-08-21THE AFFILIATED HOSPITAL OF SOUTHWEST MEDICAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202611017117.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-07-09
Publication Date
2026-08-21

AI Technical Summary

Technical Problem

[0004]截至目前,现有技术中并未公开GPX7在肝细胞再生、以及肝切除后肝功能恢复中的应用

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122609708A_ABST
    Figure CN122609708A_ABST
Patent Text Reader

Abstract

The application discloses application of GPX7 in liver regeneration and recovery of liver function after liver resection, and proves that the expression level of GPX7 changes synchronously with the liver regeneration capacity through a partial liver resection model, and that overexpression of GPX7 significantly promotes the regeneration capacity of mice after PHx operation, thereby confirming that GPX7 can be used as a key regulation target point of liver regeneration, and providing a new detection treatment target and drug development direction for liver regeneration disorder or poor recovery of liver function after operation, and having a clear application scene and conversion value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to the application of GPX7 in liver regeneration and liver function recovery after liver resection. Background Technology

[0002] The liver possesses a strong regenerative capacity and plays a crucial role in tissue repair following partial hepatectomy, liver transplantation, liver trauma, and various acute and chronic liver injuries. Sufficient and orderly liver regeneration is a key factor in maintaining postoperative liver function recovery, reducing the risk of liver failure, and improving patient prognosis. However, in clinical practice, some patients experience decreased hepatocyte proliferation and impaired liver regeneration due to factors such as underlying liver disease, fatty liver, liver fibrosis, cholestasis, ischemia-reperfusion injury, drug-induced injury, metabolic abnormalities, or advanced age. This leads to delayed liver function recovery, and in severe cases, can result in small liver syndrome, postoperative liver failure, or even death. Therefore, identifying novel molecular targets that can promote hepatocyte proliferation, improve liver regeneration capacity, and accelerate liver function recovery has significant clinical implications and application value.

[0003] Glutathione peroxidase 7 (GPX7) is a member of the glutathione peroxidase family, primarily located in the endoplasmic reticulum compartment, and participates in maintaining cellular redox homeostasis, controlling protein folding quality, and regulating stress responses. Studies have shown that GPX7 is related to cellular stress adaptation, maintaining proliferative status, and responding to tissue damage. For example, in normal physiological conditions or early stages of diseases such as non-alcoholic steatohepatitis (NASH), GPX7 can help resist oxidative stress; furthermore, in the pathological state of hepatocellular carcinoma (HCC), the role of GPX7 becomes complex and exhibits both pro- and anti-cancer properties.

[0004] To date, the application of GPX7 in hepatocyte regeneration and liver function recovery after liver resection has not been disclosed in existing technologies. Summary of the Invention

[0005] This invention experimentally revealed that the expression dynamics of GPX7 during liver regeneration are synchronous with changes in liver regeneration capacity, indicating that GPX7 can influence regeneration capacity after hepatectomy and can be used to assess liver regeneration capacity after hepatectomy. Furthermore, compared to wild-type mice undergoing 70% hepatectomy, GPX7-overexpressing mice showed significantly improved liver recovery after hepatectomy, including promoting hepatocyte proliferation, promoting liver function recovery, and increasing the residual liver weight-to-body weight ratio. Their recovery was significantly better than that of wild-type mice undergoing 70% hepatectomy, demonstrating that GPX7 has a promoting effect on liver regeneration after hepatectomy.

[0006] Mechanistic studies have revealed that GPX7 can influence the expression levels of molecules related to the Hippo-YAP signaling pathway and regulate YAP-related proliferative transcription programs. The Hippo-YAP signaling pathway is a crucial pathway regulating organ size, tissue repair, and cell proliferation, with molecules such as MST, MOB1, LATS1 / 2, and YAP forming its core regulatory axis. When the Hippo kinase cascade is activated, LATS1 / 2 promotes YAP phosphorylation, leading to cytoplasmic retention or degradation of YAP, thereby inhibiting YAP / TEAD-mediated transcription of proliferation-related genes. Conversely, YAP activation and nuclear translocation promote cell proliferation and tissue repair. Therefore, it is inferred that GPX7 may participate in liver regeneration by regulating the Hippo-YAP pathway, promoting liver regeneration through interventions related to endoplasmic reticulum homeostasis, redox regulation, or cytoskeleton / mechanical transduction molecules.

[0007] Based on experimental results and mechanistic analysis, one objective of this invention is to provide the application of a GPX7 expression level detection reagent in the preparation of a product for assessing liver regeneration capacity after partial hepatectomy. The GPX7 expression level detection reagent is used to determine the quality of liver regeneration after hepatectomy or to predict recovery outcomes.

[0008] Furthermore, the product for assessing liver regeneration capacity after partial hepatectomy also includes reagents for detecting Cyclin D1 expression levels and / or reagents for detecting PCNA expression levels. In this technical solution, GPX7 can be used in combination with Cyclin D1, PCNA, or a combination of GPX7 with Cyclin D1 and PCNA to jointly assess the liver's regeneration capacity after partial hepatectomy.

[0009] In some preferred embodiments, the GPX7 expression level detection reagent includes a primer pair for amplifying GPX7, the primer pair comprising:

[0010] Forward primer: 5'-CTTCAAGTACCTAACCCAGACTT-3' (SEQ ID NO: 2)

[0011] Reverse primer: 5'-TGCTCTGTAATACGGGGCTTG-3' (SEQ ID NO: 3).

[0012] Another object of the present invention is to provide the use of GPX7 protein and / or reagents that increase GPX7 expression levels in the preparation of drugs that promote liver regeneration.

[0013] Furthermore, the reagent that increases GPX7 expression level is a GPX7 expression promoter.

[0014] Furthermore, the liver regeneration-promoting drug is applied 24-72 hours after partial hepatectomy.

[0015] Another object of the present invention is to provide a pharmaceutical composition comprising GPX7 protein and / or an agent that increases GPX7 expression, and a pharmaceutically acceptable carrier.

[0016] In some embodiments, the reagent for increasing GPX7 expression can be a GPX7 recombinant expression vector, which includes an expression vector and a GPX7 nucleic acid molecule inserted into the expression vector. The GPX7 recombinant expression vector can increase the expression level of GPX7 in liver tissue or hepatocytes, thereby promoting hepatocyte proliferation, improving liver tissue repair and improving liver function recovery.

[0017] In one or more embodiments, the expression vector includes viral vectors and non-viral vectors. The viral vectors include adenovirus, adeno-associated virus, lentivirus, Coxsackievirus, herpes simplex virus, measles virus, Newcastle disease virus, parvovirus, poliovirus, reovirus, vaccinia virus, vesicular stomatitis virus, or other suitable viral vectors in the prior art. The non-viral vectors include plasmid vectors, liposomes or lipid complexes, cationic polymers, chitosan polymers, nanoparticle carriers, exosome delivery systems, or other vectors capable of delivering GPX7 nucleic acid molecules or GPX7 protein.

[0018] Furthermore, the reagent for increasing GPX7 expression includes an adeno-associated virus vector carrying the GPX7 gene.

[0019] Furthermore, the adeno-associated virus vector is AAV8-TBG-GPX7, wherein AAV8 is adeno-associated virus type 8 and TBG is the thyroxine-binding globulin promoter.

[0020] In some embodiments, the pharmaceutical composition may be prepared as an injection, a lyophilized powder for injection, a sustained-release formulation, a nanoformation, a liposome formulation, an exosome formulation, or other pharmaceutical forms suitable for in vivo delivery.

[0021] In some embodiments, the pharmaceutical composition may be administered via intravenous injection, portal vein administration, hepatic artery administration, intraperitoneal injection, local administration, transdermal administration, gene gun delivery, viral vector delivery, nanomaterial delivery, or other acceptable methods.

[0022] In some embodiments, when the pharmaceutical composition is administered to animals, including humans, the dosage may be adjusted according to the subject's age, weight, liver function status, disease severity, extent of liver resection, route of administration, and frequency of administration, and may be determined with reference to animal experimental results and actual clinical conditions.

[0023] Furthermore, the pharmaceutical composition is used to promote hepatocyte growth and / or to repair liver tissue damage.

[0024] In one or more embodiments, the pharmaceutical composition has the following characteristics:

[0025] To increase the proportion of Ki67-positive cells in liver tissue 24-72 hours after partial hepatectomy, preferably 48-72 hours;

[0026] Upregulates the protein expression level of proliferating cell nuclear antigen (PCNA) in liver tissue;

[0027] Control the excessive release of ALT and AST within 24-48 hours after partial hepatectomy, and restore ALT and AST to normal levels after 72 hours; or

[0028] It improves the pathological structure of liver tissue, making the liver cells more neatly arranged.

[0029] Another object of the present invention is to provide the use of GPX7 as a target in screening drugs that promote liver regeneration or improve liver function recovery.

[0030] In some embodiments, in vitro cell models or animal models with reduced, knocked-down, knocked-out, or overexpressed GPX7 expression are constructed to screen candidate drugs that promote hepatocyte proliferation, promote liver tissue repair, improve liver function recovery, alleviate liver insufficiency, or reduce the risk of complications related to liver insufficiency.

[0031] In some preferred embodiments, the in vitro cell model includes hepatocytes, hepatic progenitor cells, primary hepatocytes, hepatocyte lines, or hepatoid cells induced from stem cells. The animal model includes partial hepatectomy models, liver injury regeneration models, liver transplant regeneration models, liver ischemia-reperfusion injury repair models, or other animal models related to insufficient liver regeneration.

[0032] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0033] This invention, through a partial hepatectomy model, demonstrates that GPX7 expression levels change synchronously with liver regeneration capacity, and that GPX7 overexpression significantly promotes regeneration capacity in mice after PHx surgery. This confirms that GPX7 can serve as a key regulatory target for liver regeneration, providing a new detection and treatment target and drug development direction for liver regeneration disorders or poor postoperative liver function recovery, with clear application scenarios and translational value. Attached Figure Description

[0034] The accompanying drawings, which are included to provide a further understanding of embodiments of the invention and form part of this application, do not constitute a limitation thereof. In the drawings:

[0035] Figure 1 This illustrates the relative expression level of GPX7 mRNA at time points after 70% partial hepatectomy in a specific embodiment of the present invention.

[0036] Figure 2 The paper illustrates the expression level of GPX7 protein at specific time points after 70% partial hepatectomy in a specific embodiment of the present invention.

[0037] Figure 3 The GPX7 expression level in the GPX7 overexpression group is shown in a specific embodiment of the present invention;

[0038] Figure 4 The residual liver weight / body weight ratio trend is shown in a specific embodiment of the present invention in the GPX7 overexpression group;

[0039] Figure 5 The variation trends of ALT(A) and AST(B) in the GPX7 overexpression group are shown in a specific embodiment of the present invention;

[0040] Figure 6 The following is a comparison of H&E staining and Ki67 staining of liver tissues in the overexpression group and the control group two days after surgery, as shown in a specific embodiment of the present invention.

[0041] Figure 7 The Western Blot results of GPX7 and PCNA two days post-surgery are shown in a specific embodiment of the present invention. Detailed Implementation

[0042] To make the objectives, technical solutions, and advantages of the present invention clearer, the present invention will be further described in detail below with reference to the embodiments and accompanying drawings. The illustrative embodiments and descriptions of the present invention are only used to explain the present invention and are not intended to limit the present invention.

[0043] All raw materials used in this invention are not particularly limited in their source; they can be purchased commercially or prepared using conventional methods well-known to those skilled in the art. The purity of all raw materials used in this invention is not particularly limited; however, analytical grade or conventional purity requirements in the biopharmaceutical field are preferred. All raw materials used in this invention have brand names and abbreviations that are conventional in the field, and each brand name and abbreviation is clearly defined within its relevant application. Those skilled in the art can obtain these materials from commercial sources or prepare them using conventional methods based on the brand name, abbreviation, and corresponding application.

[0044] The technology involved in this invention is a conventional technique for molecular cloning. The enzymes, primers, reagents and reaction conditions involved can be reasonably selected based on the experience of those skilled in the art, unless otherwise specified. The reagents and consumables involved are common commercial products, and the detection methods and instruments involved are well known and skillfully mastered by those skilled in the art.

[0045] Unless otherwise stated, the experimental methods in the examples use existing experimental procedures and are performed strictly in accordance with the kit manufacturer's instructions.

[0046] Experimental materials:

[0047] C57BL / 6 mice (6-7 weeks old) were purchased from Jiangsu Huachuang Xinno Pharmaceutical Technology Co., Ltd., and housed in the standard laboratory environment of Southwest Medical University. The AAV8-TBG vector was synthesized by Chengdu Bowen Biotechnology Co., Ltd. Anti-GPX7 antibody and anti-PCNA, etc., were purchased from Proteintech or Yuantai Biotechnology Co., Ltd.

[0048]

Example 1

[0049] In this embodiment, the left lobe, middle lobe, and caudate lobe were removed according to the standard surgical procedure to establish a 70% partial hepatectomy model (PHx). Liver tissue and serum were collected at 0, 48, and 120 hours postoperatively, and the changes in the relative expression level of GPX7 mRNA after partial hepatectomy were detected by qRT-PCR.

[0050] Specifically, a specific PCR primer pair was first designed based on the mouse GPX7 gene sequence (NCBI Reference Sequence: NC_000070.7). The mouse GPX7 gene corresponds to the GPX7 gene from *Mus musculus*, whose official gene name is glutathione peroxidase 7, NCBI Gene ID is 67305, its mRNA reference sequence is NM_024198.3, and its encoded protein reference sequence is NP_077160.1. Specifically, the nucleotide sequence of GPX7 (SEQ ID NO: 1) is as follows:

[0051] ATGGTTGCAGCTGTGGCGACGGCGTGGCTGCTCCTGTGGGCCGCGGCCTGCGCGCAATCCGAGCAGGACTTCTACGACTTCAAGGCGGTCAACATCCGGGGCAAGCTGGTGTCGCTGGAGAAGTACCGTGGCTCGGTTTC CCTGGTGGTGAACGTAGCTAGCGAATGTGGCTTCACAGACCAGAACTACCGAGCCTTGCAGCAGCTGCAGCGGGACCTGGGCCCCCATCATTTTAATGTGCTTGCCTTCCCTTGCAACCAGTTTGGCCAACAGGAACCAG ACACCAACAGGGAGATTGAGAACTTTGCCCGCCGCACCTACAGTGTCTCTTTTCCCATGTTTAGCAAGATCGCAGTCACTGGCACTGGTGCCCACCCTGCCTTCAAGTACCTAACCCAGACTTCTGGGAAGGAGCCCACC TGGAACTTCTGGAAGTACCTAGTGGACCCAGACGGAAAGGTGGTGGGAGCATGGGACCCCACTGTGCCAGTGGCGGAGATCAAGCCCCGTATTACAGAGCAGGTGATGAAACTCATCCTTCGGAAACGAGAAGACTTGTGA

[0052] Based on the nucleotide sequence of GPX7, PCR primer pairs for amplifying GPX7 were designed:

[0053] Forward primer: 5'-CTTCAAGTACCTAACCCAGACTT-3' (SEQ ID NO: 2)

[0054] Reverse primer: 5'-TGCTCTGTAATACGGGGCTTG-3' (SEQ ID NO: 3)

[0055] And, the GAPDH primer pair for the internal reference gene:

[0056] Forward primer: 5'-AGGTCGGTGTGAACGGATTTG‐3' (SEQ ID NO: 4)

[0057] Reverse primer: 5'-TGTAGACCATGTAGTTGAGGTCA‐3' (SEQ ID NO: 5)

[0058] Subsequently, total RNA was extracted from liver tissue or AML12 cells (Alpha Mouse Liver 12) using TRIzol reagent, and the purity and concentration of RNA (A260 / A280 ratio between 1.8 and 2.0) were detected using an ultra-micro nucleic acid analyzer.

[0059] The reverse transcription reaction system was prepared on ice under the following conditions:

[0060] 5x PrimeScript buffer: 4 μL

[0061] PrimeScript reverse transcriptase mixture: 1 μL

[0062] Oligo dT Primer (50 μM): 1 μL

[0063] Random 6-mer primers (100 μM): 1 μL

[0064] Total RNA: 1000 ng

[0065] RNase-Free dH2O: Add to a final volume of 20 μL

[0066] Reverse transcription reaction conditions: react at 37°C for 15 minutes, react at 85°C for 5 seconds, and then cool to 4°C for storage. The obtained cDNA was diluted 5 times and stored at -20°C.

[0067] Finally, the PCR reaction system (20 μL system) was prepared on ice:

[0068] 2× AceQ qPCR SYBR Green Master Mix: 10 μL

[0069] Forward primer (10 μM): 0.4 μL

[0070] Reverse primer (10 μM): 0.4 μL

[0071] cDNA template: 2 μL

[0072] ddH2O: 7.2 μL

[0073] Reaction conditions: Pre-denaturation: 95°C, 5 min; PCR reaction (40 cycles): 95°C for 20 s, 60°C for 20 s, 72°C for 20 s; Melting curve analysis: 65°C for 5 s, 95°C for 5 s. The relative expression level of GPX7 was calculated using the 2^(-ΔΔCt) method, with GAPDH used as an internal reference gene.

[0074] Test results as follows Figure 1 As shown, Cyclin D1, a key protein that drives cells to enter the S phase from the G1 phase, reached its peak 48 hours after surgery, reflecting that the liver reaches its most vigorous regeneration stage 48 hours after hepatectomy. At this time, the expression level of GPX7 also reached its peak, and its trend was highly consistent with that of Cyclin D1. This proves that the expression level of GPX7 changes synchronously with the liver regeneration capacity, and it is speculated that GPX7 has the potential to promote postoperative liver regeneration.

[0075]

Example 2

[0076] In this embodiment, based on a 70% partial hepatectomy model, liver tissue and serum were collected at 0, 24, 48, 72, and 120 hours postoperatively. Western blot analysis was used to detect changes in GPX7 expression levels after partial hepatectomy. For Western blot analysis, mouse liver tissue was extracted using RIPA lysis buffer, with protease and phosphatase inhibitors added to the lysis buffer. After protein quantification using the BCA method, equal amounts of protein from each group were separated by SDS-PAGE electrophoresis and transferred to PVDF membranes. The PVDF membranes were blocked with rapid blocking buffer, then incubated overnight at 4 °C with the corresponding primary antibody; subsequently, the corresponding secondary antibody was added, and the membranes were incubated at room temperature for 1 hour. After chemiluminescence staining, band images were acquired using an imaging system, and the expression levels of the target protein were analyzed.

[0077] Test results as follows Figure 2 As shown, the protein level of PCNA reached its peak 48 hours after surgery, indicating that a large number of hepatocytes were dividing and replicating DNA at this time. The expression level of GPX7 was highly consistent with that of PCNA, which also proved that the expression level of GPX7 changed synchronously with liver regeneration capacity, reflecting that liver regeneration capacity can be assessed by detecting the expression level of GPX7.

[0078]

Example 3

[0079] In this embodiment, the regulatory effect of GPX7 on liver regeneration was verified through in vivo animal experiments.

[0080] Specifically, a target gene fragment was designed based on the mouse Gpx7 CDS sequence and cloned into an AAV expression vector containing the TBG promoter to obtain the pAAV-TBG-Mouse Gpx7 recombinant plasmid. The Gpx7 CDS sequence is shown in SEQ ID NO:1. After confirming the sequence correctness by colony PCR, enzyme digestion identification, and Sanger sequencing, the recombinant plasmid was used for AAV8 virus packaging to prepare the rAAV8-Mouse Gpx7 overexpression vector. rAAV8-TBG-EGFP was used as a negative control vector. Subsequently, the above viral vector was injected into C57BL / 6 mice via tail vein injection at a dose of 5 × 10⁻⁶.11 Genome copy / animal. GPX7 expression in liver tissue was detected 4 weeks after injection, and a 70% partial hepatectomy model was established. Figure 3 The Western Blot results of GPX7 overexpressing mice (OE) and control mice (WT) are shown. It can be seen that the GPX7 expression level in GPX7 overexpressing mice is significantly higher than that in the control group.

[0081] Samples were collected at 0, 24, 48, 72, and 120 hours after a 70% partial hepatectomy. Figure 4 The figure shows the ratio of residual liver weight to body weight after surgery. As can be seen from the figure, during the critical window of liver function recovery of 48-72 hours, the residual liver weight / body weight ratio (FLR / BW) in the GPX7 overexpression group was significantly higher than that in the control group (p<0.001), indicating that GPX7 overexpression is beneficial to promoting liver regeneration.

[0082] Regarding liver function indicators, serum ALT (alanine aminotransferase) and AST (aspartate aminotransferase) levels were measured 48 hours post-surgery. Results showed that, compared to the control group, the serum ALT and AST levels in the GPX7 overexpression group were significantly lower, suggesting that GPX7 overexpression can alleviate hepatocellular damage after 70% partial hepatectomy and improve postoperative liver function recovery. Combined with the increased expression of hepatocyte proliferation-related proteins such as PCNA and Cyclin D1 in the GPX7 overexpression group in Examples 1 and 2, this further demonstrates that GPX7 overexpression not only helps alleviate postoperative liver damage but also promotes hepatocyte proliferation and liver regeneration.

[0083] like Figure 6 As shown in the H&E staining, at 48 hours post-surgery, the H&E sections of the overexpression group (AAV-GPX7) exhibited relatively intact liver tissue structure, with more regular hepatocyte arrangement, clearer cell outlines and nuclei, and no obvious cell swelling, cytoplasmic loosening, or vacuolar changes. This suggests that the GPX7 overexpression group showed better morphological recovery than the control group (Ctrl). Simultaneously, Ki67 immunohistochemistry showed a significantly higher proportion of Ki67-positive hepatocytes in the overexpression group at 48 hours compared to the control group, indicating that more residual hepatocytes were in a state of active proliferation. These results demonstrate that GPX7 overexpression can improve the morphological recovery of liver tissue after partial hepatectomy and promote the proliferation of residual hepatocytes.

[0084] Furthermore, Figure 7The Western blot results show the changes in GPX7 and PCNA two days post-surgery. The GPX7 expression level in the overexpression group was significantly higher than that in the control group, and the PCNA expression level was also significantly higher. As a marker related to cell proliferation and DNA synthesis, the increased expression of PCNA further suggests that GPX7 overexpression can promote hepatocyte proliferation, thereby contributing to the repair of residual liver tissue volume and functional recovery after partial hepatectomy.

[0085] Therefore, it can be seen that the expression changes of GPX7 are closely related to the hepatocyte proliferation status and the liver function recovery process during the critical window of 48-72 hours after hepatectomy, providing a new molecular marker and potential treatment time window for postoperative liver function support, intervention for insufficient liver regeneration, and prognostic assessment.

[0086] The specific embodiments described above further illustrate the purpose, technical solution, and beneficial effects of the present invention. It should be understood that the above description is only a specific embodiment of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. Application of GPX7 expression level detection reagent in the preparation of products for assessing liver regeneration capacity after partial hepatectomy.

2. The application according to claim 1, characterized in that, The product for assessing liver regeneration capacity after partial hepatectomy also includes reagents for detecting Cyclin D1 expression levels and / or reagents for detecting PCNA expression levels.

3. The application according to claim 1 or 2, characterized in that, The GPX7 expression level detection reagent includes primer pairs for amplifying GPX7, the primer pairs comprising: Forward primer: 5'-CTTCAAGTACCTAACCCAGACTT-3' (SEQ ID NO: 2) Reverse primer: 5'-TGCTCTGTAATACGGGGCTTG-3' (SEQ ID NO: 3).

4. Application of GPX7 protein and / or reagents that increase GPX7 expression levels in the preparation of drugs that promote liver regeneration.

5. The application according to claim 4, characterized in that, The reagent that increases GPX7 expression level is a GPX7 expression promoter.

6. The application according to claim 4 or 5, characterized in that, The liver regeneration-promoting drug is applied 24-72 hours after partial hepatectomy.

7. A pharmaceutical composition, characterized in that, Includes GPX7 protein and / or reagents that increase GPX7 expression, as well as pharmaceutically acceptable vectors.

8. The pharmaceutical composition according to claim 7, characterized in that, The reagents used to increase GPX7 expression include adeno-associated virus vectors carrying the GPX7 gene.

9. A pharmaceutical composition according to claim 8, characterized in that, The adeno-associated virus vector is AAV8-TBG-GPX7, where AAV8 is adeno-associated virus type 8 and TBG is the thyroxine-binding globulin promoter.

10. The use of a pharmaceutical composition according to any one of claims 7 to 9, characterized in that, The pharmaceutical composition is used to promote hepatocyte growth and / or to repair liver tissue damage.