A gene detection kit for evaluating the administration of tacrolimus and a method of use

Abstract

The application belongs to the technical field of gene detection, and specifically discloses a gene detection kit for evaluating the use of tacrolimus and a use method, wherein the kit comprises a primer pair for detecting a CYP3A5*3 gene rs776746 site, a wild-type probe, a mutant-type probe and a PCR reaction solution; the use method comprises the following steps: extracting sample DNA, preparing a PCR reaction system containing components of the kit, performing real-time fluorescent quantitative PCR amplification, and performing gene typing interpretation according to a fluorescent signal. Compared with the prior art, the application realizes rapid and accurate identification of the CYP3A5*3 gene rs776746 site genotype in a single reaction tube through specific primers and probes, effectively solves the problems of long detection period, complex operation and high cost in the prior art when detecting CYP3A5*3 gene polymorphism, and realizes rapid, accurate and simple gene typing detection.

Description

Technical Field

[0001] This invention belongs to the field of gene detection technology, and in particular relates to a gene detection kit and method of use for evaluating tacrolimus. Background Technology

[0002] Tacrolimus is a macrolide calcineurin inhibitor widely used as a potent immunosuppressant to treat rejection after organ transplantation. Its pharmacokinetic characteristics are complex, its therapeutic window is narrow, and there are significant individual differences in blood drug concentrations. Insufficient dosage can easily induce rejection, while overdose may lead to adverse reactions such as nephrotoxicity and neurotoxicity. Therefore, personalized medication is crucial for the clinical safety and efficacy of tacrolimus. Tacrolimus is mainly metabolized in the body through the hepatic cytochrome P450 (CYP) enzyme system, with the CYP3A subfamily (especially CYP3A4 and CYP3A5) being key enzymes mediating its metabolism. Studies have shown that the expression activity of CYP3A5 exhibits significant genetic polymorphism, which is one of the main factors contributing to individual differences in tacrolimus metabolism. This provides an important theoretical basis for guiding medication through genetic testing.

[0003] The CYP3A5*3 (rs776746) gene polymorphism is a core genetic marker of individual differences in tacrolimus metabolism. This site contains an A>G mutation (c.6986A>G), leading to abnormal mRNA splicing and loss of functional protein expression. Based on genotype, patients can be classified as: CYP3A5*1 / *1 (wild-type, expressing metabolizer), CYP3A5*1 / *3 (heterozygous, intermediate metabolizer), and CYP3A5*3 / *3 (mutant homozygous, non-expressing metabolizer). Numerous clinical studies have confirmed that patients carrying the CYP3A5*1 allele (expressing genotype) have higher CYP3A5 enzyme activity in their hepatocytes, resulting in a faster tacrolimus metabolism rate. At standard doses, blood concentrations are often below the target range, requiring increased dosage to achieve effective immunosuppression. Conversely, patients with the CYP3A5*3 / *3 genotype (non-expressing genotype) have significantly reduced metabolic capacity, leading to higher blood concentrations and a greater risk of toxic side effects. They typically begin treatment at the standard recommended dose, with therapeutic drug monitoring used to guide dose adjustments for each genotype. Currently, authoritative guidelines such as the Clinical Pharmacogenomics Implementation Consortium (CPIC) explicitly recommend CYP3A5*3 genotype testing before tacrolimus administration and optimization of the initial dosing regimen based on the results. However, existing testing methods still have room for improvement in sensitivity, throughput, and cost. Therefore, developing a highly efficient, accurate, and easily clinically applicable gene testing kit is of significant practical value.

[0004] Currently, methods for detecting the CYP3A5*3 gene mainly include polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), sequence-specific PCR, first-generation sequencing, second-generation sequencing, and gene chip methods. However, these methods have certain limitations and application defects. Some are cumbersome to operate, have long detection cycles, and cannot perform high-throughput simultaneous detection of multiple sites in a short time. As a result, the application of polymorphism detection technology in clinical practice is still not ideal and cannot meet clinical testing needs. Therefore, there is an urgent need for a highly efficient, accurate, and easy-to-operate CYP3A5*3 gene detection kit and supporting methods to meet the needs of precision medicine and health management.

[0005] To address the above issues, existing technologies urgently need improvement. Summary of the Invention

[0006] The purpose of this invention is to provide a gene testing kit and method for evaluating tacrolimus, in order to solve the problems of long detection cycle, complex operation and high cost in the existing technology when detecting CYP3A5*3 gene polymorphism, and to achieve rapid, accurate and easy-to-operate genotyping detection.

[0007] To achieve the above objectives, the technical solution of the present invention is as follows: a gene detection kit for evaluating tacrolimus and a method of use, comprising primer pairs, wild-type probes, mutant probes, and PCR reaction solution for detecting the rs776746 site of the CYP3A5*3 gene.

[0008] Furthermore, the primer pair and probe sequences used to detect the rs776746 site of the CYP3A5*3 gene are as follows:

[0009] 3A5-F:TCATATGATGAAGGGTAATGTG, as shown in SEQ IQ NO.1;

[0010] 3A5-R:ATACCCACGTATGTACCACCCAGCT, as shown in SEQ IQ NO.2;

[0011] 3A5-WP:AGGGAAGAGATATTGAAAGACAAAAG, as shown in SEQ IQ NO.3;

[0012] 3A5-MP:AGGGAAGAGATACTGAAAGACAAAAG, as shown in SEQ IQ NO.4;

[0013] Furthermore, the 5' fluorescent group of each probe is selected from any one of FAM, VIC, HEX, CY5, Texas Red or ROX, and the 3' fluorescent quenching group is selected from any one of TAMRA, BHQ1, BHQ2, MGB or Dabcy1.

[0014] Furthermore, the 5' end fluorescent group of probe 3A5-WP is FAM, and the 5' end fluorescent group of probe 3A5-MP is VIC; the 3' end fluorescent quenching group of each probe is MGB; that is, after fluorescent labeling: 3A5-WP is FAM-AGGGAAGAGATATTGAAAGACAAAAG-MGB; 3A5-MP is VIC-AGGGAAGAGATACTGAAAGACAAAAG-MGB.

[0015] Furthermore, the PCR reaction solution contains hot-start Taq enzyme, UNG enzyme, buffer, magnesium ions, and dNTPs.

[0016] Furthermore, it also includes positive control samples and negative control samples;

[0017] The method for obtaining positive control samples is as follows: construct a plasmid based on the rs776746 gene sequence published in the NCBI database, synthesize the sequence gene fragment, insert the fragment into the T vector, transform it with Escherichia coli DH5α strain and extract the plasmid, and mix the quality control samples in equal proportions to obtain the positive control samples.

[0018] The negative control material was DEPC-treated deionized water.

[0019] Furthermore, the present invention also provides a method for using the aforementioned gene testing kit for evaluating tacrolimus use, comprising the following steps:

[0020] S1. Extract genomic DNA from the sample to be tested;

[0021] S2. Add genomic DNA to the PCR reaction solution to prepare a PCR reaction system. Simultaneously set up positive and negative control reactions in the PCR reaction system.

[0022] S3, PCR amplification;

[0023] S4. After the reaction is complete, perform genotyping based on the fluorescence amplification signal in the reaction tube.

[0024] Furthermore, in step S3, the PCR amplification procedure is as follows:

[0025] React at 25℃ for 10 min to perform UNG enzyme digestion;

[0026] React at 95℃ for 2 minutes to inactivate UNG enzyme and thermally start Taq enzyme;

[0027] The cells were denatured at 98℃ for 10 seconds, then annealed and extended at 60℃ for 30 seconds, during which fluorescence signals were collected. A total of 40 cycles were performed.

[0028] Furthermore, in step S4, the criteria for interpreting genotyping are as follows:

[0029] The positive control showed typical S-shaped amplification curves in both the FAM and VIC channels, with a Ct value ≤ 35; the negative control showed no amplification curve or a Ct value > 37, indicating a valid test result.

[0030] If only the FAM channel shows an S-shaped amplification curve with a Ct value ≤ 35, the genotype of the sample to be tested is CYP3A5*1 / *1 (wild type).

[0031] If both the FAM and VIC channels show S-shaped amplification curves with a Ct value ≤ 35, the genotype of the sample to be tested is CYP3A5*1 / *3 (heterozygous).

[0032] If only the VIC channel shows an S-shaped amplification curve with a Ct value ≤ 35, the genotype of the sample to be tested is CYP3A5*3 / *3 (mutant homozygous type).

[0033] The beneficial effects of this technical solution are as follows:

[0034] This invention provides a gene detection kit and method for evaluating tacrolimus use. By employing primer pairs and probes specific to the rs776746 locus of the CYP3A5*3 gene, combined with PCR reaction solution, it achieves accurate and rapid detection of the genotype at this locus. In particular, by designing wild-type and mutant probes and incorporating an UNG enzyme anti-contamination system, wild-type, heterozygous, and homozygous mutant genotypes can be simultaneously distinguished within a single reaction tube using real-time quantitative PCR technology in the same PCR reaction system, significantly simplifying the operation and shortening the detection cycle. Compared to existing technologies, this kit integrates all necessary reagents, reducing the amount of reagents and the number of reaction tubes, thus lowering the cost per test. The inclusion of positive and negative controls and clear interpretation criteria ensure the accuracy and reliability of the test results, thereby meeting the clinical need for rapid, convenient, economical, and accurate CYP3A5*3 genotyping. Attached Figure Description

[0035] Figure 1 This is a typical amplification curve of a positive control sample in an embodiment of the present invention;

[0036] Figure 2 This is a typical amplification curve of the negative control sample in an embodiment of the present invention. Detailed Implementation

[0037] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. It should be understood that the following embodiments are merely illustrative and explanatory of the present invention and should not be construed as limiting the scope of protection of the present invention. All technologies implemented based on the above content of the present invention are covered within the scope of protection intended by the present invention.

[0038] In addition, unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be obtained by purchasing them from the market or prepared by existing methods.

[0039] Example 1: Primer and probe combination design and use;

[0040] Primer and probe combination for identifying CYP3A5*3 (rs776746>A):

[0041] 3A5-F:TCATATGATGAAGGGTAATGTG;

[0042] 3A5-R:ATACCCACGTATGTACCACCCAGCT;

[0043] 3A5-WP: FAM-AGGGAAGAGATATTGAAAGACAAAAG-MGB;

[0044] Primer and probe combination for identifying CYP3A5*3 (rs776746>G):

[0045] 3A5-F:TCATATGATGAAGGGTAATGTG;

[0046] 3A5-R:ATACCCACGTATGTACCACCCAGCT;

[0047] 3A5-MP: VIC-AGGGAAGAGATACTGAAAGACAAAAG-MGB;

[0048] In this embodiment, the fluorescent groups at the 5' ends of each probe are conventionally used fluorescent reporter groups suitable for quantitative PCR analysis, and can be FAM, VIC, HEX, CY5, Texas Red, or ROX. The quenching groups at the 3' ends of each probe are conventionally used fluorescent quenching groups suitable for quantitative PCR, and can be TAMRA, BHQ1, BHQ2, MGB, or Dabcy1. More preferably, the fluorescent groups at the 5' ends are FAM and VIC, and the quenching groups at the 3' ends are all MGB.

[0049] Example 2: Obtaining positive control samples;

[0050] The method for obtaining positive control samples is as follows: construct a plasmid to synthesize a gene fragment based on the CYP3A5*3 gene sequence published in the NCBI database, insert the fragment into a T vector, transform it with Escherichia coli DH5α strain and extract the plasmid, and mix the plasmids of each control sample in equal proportions to obtain the positive control sample.

[0051] Example 3: Preparation of PCR reaction solution;

[0052] The kit of this invention uses a single-tube PCR reaction solution design to indicate different CYP3A5*3 genotypes. The composition of the reaction solution is shown in Table 1:

[0053] Table 1 PCR reaction solution

[0054] Reaction liquid components concentration Taq Hot Start Polymerase 0.5U 10×PCR Buffer 10X dU plus dNTP Mixture (12.5X) 10mM UNG 0.4U 3A5-F 1μM 3A5-R 1μM 3A5-WP 1μM 3A5-MP 1μM Genomic DNA (template) 1-200ng Sterilized deionized water Add to 20 μL

[0055] Example 4: Use of the gene detection kit;

[0056] 1. Sample collection and processing

[0057] Peripheral blood was collected from the patient using a vacuum blood collection tube containing EDTA anticoagulant, yielding 2-5 ml of blood. Nucleic acid extraction was performed using a standard nucleic acid extraction kit, following the instructions in the manual.

[0058] 2. Preparation of the reaction system

[0059] The reaction system was prepared according to the PCR reaction solution in Example 3.

[0060] 3. PCR reaction

[0061] Add the extracted DNA to the prepared reaction system, with a template amount of 1-200 ng. During the PCR reaction, the test sample, positive control, and negative control should be tested in parallel. Each sample only needs to be added to 3 reaction tubes for the reaction.

[0062] 4. Selection of instrument channels and reaction volume

[0063] ① Select the FAM channel (Reporter: FAM, Quencher: MGB) and VIC channel (Reporter: VIC, Quencher: MGB) to detect amplification;

[0064] ② The reaction volume (Sample Volume) is 20 μL.

[0065] ③ Reference Dye: Refer to the instruction manual of each instrument for specific detection channel settings; if using an ABI series PCR instrument, please be sure to select "none" in passive reference.

[0066] 5. PCR reaction procedure

[0067] The conditions for the UNG enzyme reaction are: 25℃, 10 minutes;

[0068] The conditions for UNG enzyme inactivation are: 95℃ for 2 minutes;

[0069] The amplification conditions for the system were as follows: denaturation: 98℃, 10 seconds; annealing: 60℃, 30 seconds, with fluorescence signal acquisition set; extension: 72℃, 30 seconds; cycle number set to 40.

[0070] 6. Experimental Results

[0071] After the reaction procedure is completed, save the results and interpret them. If the amplification curve has a standard "S" shape and the amplification Ct value is ≤35, it is considered detected; otherwise, it is considered undetected.

[0072] The FAM and VIC fluorescence detection signals of the positive control sample formed a logarithmic amplification "S"-shaped curve (see...). Figure 1 );

[0073] The negative control showed no amplification curve (see Figure 2 );

[0074] Example 5: Performance Analysis of Gene Detection Kit

[0075] 1. Accuracy of the reagent kit

[0076] Five positive reference samples P1, P2, P3, P4, and P5 and two negative reference samples N1 and N2 were selected and tested using three batches of the kit from Example 3, following the method of Example 4. Each reference sample was tested three times. The results are shown in Table 2.

[0077] Table 2 Accuracy Test Results

[0078] Sample number CYP3A5*3 Results of the first batch of reagent tests Results of the second batch of reagent tests Results of the third batch of reagent tests Does it meet the requirements? P1 GG + + + yes P2 AG + + + yes P3 GG + + + yes P4 AG + + + yes P5 AA + + + yes N1 - - - - yes N2 - - - - yes

[0079] The accuracy test results showed that the accuracy results for each sample were consistent across three tests, and the test results for the three batches of reagents were consistent and consistent with the expected test results, indicating that the detection system of the kit in Example 3 has good accuracy.

[0080] 2. Detection limit of the kit

[0081] Select one heterozygous detection limit reference L1 and dilute it with TE buffer to 1 ng / μL, 2 ng / μL, 5 ng / μL, 10 ng / μL, 50 ng / μL and 100 ng / μL. Detect it using the three batches of kits from Example 3 according to the method in Example 4. Each concentration reference was tested 10 times. The results are shown in Table 3.

[0082] Table 3 Detection Limit Detection Results

[0083] Sample concentration (ng / μL) Results of the first batch of reagent tests Results of the second batch of reagent tests Results of the third batch of reagent tests Does it meet the requirements? 1 + + + yes 2 + + + yes 5 + + + yes 10 + + + yes 50 + + + yes 100 + + + yes

[0084] The results of 10 tests for each concentration sample were consistent, and the results of the three batches of reagents were consistent and consistent with the expected genotype, indicating that the detection system of the kit in Example 3 has good sensitivity and the detection limit is as low as 1 ng / μL.

[0085] 3. Precision of the reagent kit

[0086] Three precision reference samples J1, J2, and J3 were selected and tested using the three batches of reagent kits from Example 3 according to the method in Example 4. The tests were repeated twice a day for 5 days, and the results are shown in Table 4.

[0087] Table 4 Precision test results

[0088] Sample number CYP3A5*3 Results of the first batch of reagent tests Results of the second batch of reagent tests Results of the third batch of reagent tests Does it meet the requirements? J1 GG + + + yes J2 AG + + + yes J3 AA + + + yes

[0089] The coefficient of variation (CV, %) was calculated using the Ct values ​​of 10 tests in the precision experiment. The CVs corresponding to the two fluorescence signals in the intra-batch analysis reaction wells were all within 5%, and the inter-batch precision was within 5%, indicating that the detection system of the kit in Example 3 has good repeatability.

[0090] 4. Analytical specificity of the kit

[0091] 4.1 Interference Experiment

[0092] Two clinical samples with known genotypes were selected, and endogenous interfering substances cholesterol (13 mmol / L) and urea (7 mmol / L) and exogenous interfering substance chloramphenicol (200 μmol / L) were added. The samples were tested using three batches of the kit from Example 3 according to the method in Example 4. Each sample was tested three times. The results are shown in Table 5. Different interfering substances did not interfere with the test results.

[0093] Table 5 Interference Experiment Detection Results

[0094] Interfering substances Results of the first batch of reagent tests Results of the second batch of reagent tests Results of the third batch of reagent tests Does it meet the requirements? cholesterol + + + yes urea + + + yes Chloramphenicol + + + yes

[0095] 4.2 Cross-reaction

[0096] Plasmids containing the homologous gene CYP2C19 (numbered C1) and plasmids containing the alleles CYP2C9*2 and CYP2C9*5 (numbered C2 and C3) were selected. The above samples were tested using the three batches of kits from Example 3 according to the method in Example 4. Each sample was tested three times. The results are shown in Table 6. The homologous gene and alleles did not cross-react with the detection site.

[0097] Table 6 Cross-reactivity test results

[0098] Sample number Results of the first batch of reagent tests Results of the second batch of reagent tests Results of the third batch of reagent tests Does it meet the requirements? C1 - - - yes C2 - - - yes C3 - - - yes

[0099] In summary, the detection system of the kit has good analytical specificity.

[0100] It should be noted that, in this document, relational terms such as "first" and "second" are used only to distinguish one entity or operation from another, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Furthermore, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such process, method, article, or apparatus.

[0101] The above descriptions are merely embodiments of the present invention. Commonly known structures and characteristics are not described in detail here. Those skilled in the art are aware of all common technical knowledge in the field prior to the application date or priority date, are aware of all existing technologies in that field, and have the ability to apply conventional experimental methods prior to that date. Those skilled in the art can, under the guidance of this application, improve and implement this solution in combination with their own capabilities. Some typical known structures or methods should not be obstacles for those skilled in the art to implement this application. It should be noted that those skilled in the art can make several modifications and improvements without departing from the structure of the present invention. These should also be considered within the scope of protection of the present invention, and will not affect the effectiveness of the implementation of the present invention or the practicality of the patent. The scope of protection claimed in this application should be determined by the content of its claims, and the specific embodiments described in the specification can be used to interpret the content of the claims.

Claims

1. A genetic testing kit for evaluating tacrolimus use, characterized in that, This includes primer pairs, wild-type probes, mutant probes, and PCR reaction solutions for detecting the rs776746 site of the CYP3A5*3 gene.

2. The gene detection kit for evaluating tacrolimus use according to claim 1, characterized in that: The primer pair and probe sequences used to detect the rs776746 site of the CYP3A5*3 gene are as follows: 3A5-F:TCATATGATGAAGGGTAATGTG; 3A5-R:ATACCCACGTATGTACCACCCAGCT; 3A5-WP:AGGGAAGAGATATTGAAAGACAAAAG; 3A5-MP: AGGGAAGAGATACTGAAAGACAAAAG.

3. A gene detection kit for evaluating tacrolimus use according to claim 2, characterized in that: The 5' fluorescent group of each probe is selected from any one of FAM, VIC, HEX, CY5, Texas Red or ROX, and the 3' fluorescent quenching group is selected from any one of TAMRA, BHQ1, BHQ2, MGB or Dabcy1.

4. A gene detection kit for evaluating tacrolimus use according to claim 3, characterized in that: The 5' end fluorescent group of probe 3A5-WP is FAM, and the 5' end fluorescent group of probe 3A5-MP is VIC; the 3' end fluorescent quencher group of all probes is MGB.

5. A gene detection kit for evaluating tacrolimus use according to claim 1, characterized in that: The PCR reaction solution contains hot-start Taq enzyme, UNG enzyme, buffer, magnesium ions, and dNTPs.

6. A gene detection kit for evaluating tacrolimus use according to claim 1, characterized in that: It also includes positive control samples and negative control samples; The method for obtaining the positive control sample is as follows: construct a plasmid to synthesize a sequence gene fragment based on the rs776746 gene sequence published in the NCBI database, insert the fragment into a T vector, transform and extract the plasmid using Escherichia coli DH5α strain, and mix the quality control sample plasmids in equal proportions to obtain the positive control sample. The negative control sample is DEPC-treated deionized water.

7. A method of using a gene testing kit for evaluating tacrolimus use as described in any one of claims 1-6, characterized in that, Includes the following steps: S1. Extract genomic DNA from the sample to be tested; S2. Add the genomic DNA to the PCR reaction solution to prepare a PCR reaction system, and simultaneously set the positive control reaction and the negative control reaction in the PCR reaction system; S3, PCR amplification; S4. After the reaction is complete, perform genotyping based on the fluorescence amplification signal in the reaction tube.

8. The method of use according to claim 7, characterized in that, In step S3, the PCR amplification procedure is as follows: The UNG enzyme digestion was carried out by reacting at 25°C for 10 minutes. React at 95℃ for 2 min to inactivate the UNG enzyme and thermally start the Taq enzyme; The cells were denatured at 98℃ for 10 seconds, then annealed and extended at 60℃ for 30 seconds, during which fluorescence signals were collected. A total of 40 cycles were performed.

9. A gene detection kit for evaluating tacrolimus use and its method of use according to claim 7, characterized in that, In step S4, the criteria for interpreting the genotype are as follows: The positive control sample showed typical S-shaped amplification curves in both the FAM and VIC channels, and the Ct value was ≤35; the negative control sample showed no amplification curve or had a Ct value >37, and the test results were valid. If only the FAM channel shows an S-shaped amplification curve with a Ct value ≤ 35, the genotype of the sample to be tested is wild-type; If both the FAM and VIC channels show an S-shaped amplification curve with a Ct value ≤ 35, the genotype of the sample to be tested is heterozygous. If only the VIC channel shows an S-shaped amplification curve with a Ct value ≤ 35, the genotype of the sample to be tested is a mutant homozygous type.

Images