A genetic test kit for reducing the incidence of complications from anesthetics and methods of use
Patent Information
- Application Number
- CN202611041417.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-07-14
- Publication Date
- 2026-08-21
AI Technical Summary
[0005]本发明的目的在于提供一种降低麻醉剂并发症发生的基因检测试剂盒及使用方法,以解决现有技术中缺乏能够快速、精准检测恶性高热相关风险基因位点的专用试剂盒的问题,实现了辅助诊断恶性高热易感性、指导麻醉剂安全使用以降低并发症发生
[0053] This invention discloses a gene detection kit and method for reducing the incidence of anesthetic complications. By designing specific primers and probes targeting the RYR1 gene rs193922802 and rs193922816 loci and the CACNA1S gene rs77226819 locus, and combining them with primers and probes for the internal control gene GAPDH and an optimized PCR reaction system, it achieves rapid and accurate genotyping of multiple SNP loci closely related to the risk of malignant hyperthermia in a single reaction based on allele-specific amplification and fluorescent probe detection technology. The kit and method of this invention effectively solve the problem of the lack of dedicated and efficient detection tools in existing technologies. They feature high sensitivity, high accuracy, ease of operation, and intuitive interpretation, enabling clinicians to assess the risk of malignant hyperthermia after using specific anesthetics based on the patient's genotype information, thereby guiding the individualized and safe use of anesthetics and effectively reducing the occurrence of anesthetic complications.
Smart Images

Figure CN122609711A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of gene detection technology, and in particular relates to a gene detection kit and its method of use for reducing the occurrence of anesthetic complications. Background Technology
[0002] Malignant hyperthermia (MH) is a rare but serious anesthetic complication characterized by a rapid increase in body temperature following the administration of certain anesthetic drugs during the perianesthesia period. It is often accompanied by muscle rigidity, tachycardia, arrhythmias, metabolic disturbances, hypercapnia, cyanosis, and a range of potential cardiac and respiratory emergencies. Without specific antipyretics, routine clinical cooling and treatment measures are insufficient to control the progression of the disease, ultimately leading to death from multiple organ failure.
[0003] The inheritance pattern of malignant hyperthermia (MH) is primarily autosomal dominant. Studies have confirmed that specific single nucleotide polymorphisms (SNPs) in the lanidine receptor-1 (RYR1) and CACNA1S genes are closely associated with the risk of malignant hyperthermia. Currently, the caffeine-halothane skeletal muscle contraction test is internationally recognized as the gold standard for diagnosing susceptibility to malignant hyperthermia; however, this method is complex, time-consuming, and not yet widely available in China. Genetic testing can serve as a supplementary method for diagnosing susceptibility to malignant hyperthermia, but current technology lacks a dedicated kit that can rapidly, accurately, and cost-effectively detect relevant risk sites.
[0004] To address the above issues, existing technologies urgently need improvement. Summary of the Invention
[0005] The purpose of this invention is to provide a gene detection kit and method of use for reducing the occurrence of anesthetic complications, in order to solve the problem of the lack of a dedicated kit in the prior art that can quickly and accurately detect risk gene loci related to malignant hyperthermia, thereby enabling the auxiliary diagnosis of susceptibility to malignant hyperthermia and guiding the safe use of anesthetics to reduce the occurrence of complications.
[0006] To achieve the above objectives, the technical solution of the present invention is: a gene detection kit for reducing the occurrence of anesthetic complications, comprising the following components:
[0007] Specific primers and probes targeting the target SNP site;
[0008] Primers and probes targeting the internally controlled gene GAPDH;
[0009] And PCR reaction solution.
[0010] Furthermore, the target SNP sites include the rs193922802 and rs193922816 sites of the RYR1 gene, and the rs77226819 site of the CACNA1S gene.
[0011] Furthermore, the primer and probe sequences used to detect the rs193922802 site are as follows:
[0012] Wild-type reverse primer 2802-WR2: CCGAGTGCTCAGACCCCTGC, as shown in SEQ ID NO:1;
[0013] Mutant reverse primer 2802-MR2: CCGAGTGCTCAGACCCCTGT, as shown in SEQ ID NO:2;
[0014] Forward primer 2802-F: CAGGTGCTCAAGCATGGACAGG, as shown in SEQ ID NO:3;
[0015] Probe 2802-P: TCTGAGCACTCGGAAGGCTCTGA, as shown in SEQ ID NO:4;
[0016] The primer and probe sequences used to detect the rs193922816 site are as follows:
[0017] Wild-type forward primer 2816-WF3: GAGAGGCGTGGAGGAGAGCG, as shown in SEQ ID NO:5;
[0018] Mutant forward primer 2816-MF2: GAGAGGCGTGGAGGAGAATA, as shown in SEQ ID NO:6;
[0019] Reverse primer 2816-R: CCAAAGCTGCAGGGAAGGT, as shown in SEQ ID NO:7;
[0020] Probe 2816-P: ATTTGGTGGTGCGGCTGCTCA, as shown in SEQ ID NO:8;
[0021] The primer and probe sequences used to detect the rs77226819 site are as follows:
[0022] Wild-type forward primer 6819-WF4: TGAGGCCCTGCGGAAGC, as shown in SEQ ID NO:9;
[0023] Mutant forward primer 6819-MF3: TGAGGCCCTGCGGAACT, as shown in SEQ ID NO:10;
[0024] Reverse primer 6819-R: AGGCAGGGAGGGTGGGTT, as shown in SEQ ID NO:11;
[0025] Probe 6819-P: CCATCCTCCGCTCCCTTGTG, as shown in SEQ ID NO:12;
[0026] The primer and probe sequences used to detect the internal control gene GAPDH are as follows:
[0027] Forward primer GAPDH-F: GGCCACTAGGCGCTC, as shown in SEQ ID NO:13;
[0028] Reverse primer GAPDH-R: GCCACCCGCGAACTCA, as shown in SEQ ID NO:14;
[0029] Probe GAPDH-P: CAGGGGCGGGCGCAGG, as shown in SEQ ID NO:15.
[0030] Furthermore, the 5' fluorescent reporter group of each probe is selected from FAM, VIC, HEX, CY5, Texas Red or ROX, and the 3' quencher group is selected from TAMRA, BHQ1, BHQ2, MGB or Dabcyl.
[0031] Furthermore, the 5' fluorescent reporter group of probe 2802-P is FAM, the 5' fluorescent reporter group of probe 2816-P is VIC, the 5' fluorescent reporter group of probe 6819-P is ROX, the 5' fluorescent reporter group of probe GAPDH-P is CY5, the 3' fluorescent reporter group of probes 2802-P, 2816-P and 2816-P are all MGB, and the 3' fluorescent reporter group of probe GAPDH-P is BHQ2.
[0032] Furthermore, it also includes positive control samples and negative control samples.
[0033] The method for obtaining positive control samples is as follows: Based on the wild-type and mutant sequence information of the rs193922802 and rs193922816 sites of the RYR1 gene, the rs77226819 site of the CACNA1S gene, and the GAPDH sequence information published in the NCBI database, plasmids were constructed, the sequence gene fragments were synthesized and inserted into the T vector, and the plasmids were extracted by transforming with Escherichia coli DH5α strain. The positive control samples were obtained by mixing the plasmids in equal proportions.
[0034] The negative control sample was DEPC-treated deionized water.
[0035] Furthermore, the PCR reaction solution contains hot-start Taq enzyme, UNG enzyme, buffer, magnesium ions, and dNTPs.
[0036] PCR reaction solution, wild-type reverse primer for rs193922802, wild-type forward primer for rs193922816, wild-type forward primer for rs77226819, and corresponding universal primers, probes, and GAPDH primers and probes are combined to form PCR reaction system I.
[0037] The PCR reaction solution, the mutant reverse primer for the rs193922802 site, the mutant forward primer for the rs193922816 site, the mutant forward primer for the rs77226819 site, and the corresponding universal primers, probes, and GAPDH primers and probes are combined to form PCR reaction system II.
[0038] This invention also discloses a method for using a gene detection kit for reducing the incidence of anesthetic complications, the method comprising the following steps:
[0039] S1, Extract genomic DNA from the blood sample to be tested;
[0040] S2, add genomic DNA to PCR reaction system I and PCR reaction system II respectively, mix well and then perform PCR amplification;
[0041] S3. After the reaction is complete, genotyping is performed based on the fluorescence amplification signals from the two reaction tubes.
[0042] Furthermore, in step S2, the conditions for PCR amplification are as follows:
[0043] UNG enzyme reaction: 37℃, 2 min;
[0044] Pre-denaturation: 95℃, 30s;
[0045] Amplification reaction: denaturation at 95℃ for 10s, annealing and extension at 58℃ for 30s, for a total of 40 cycles. Fluorescence signals were collected during the annealing and extension phase.
[0046] Furthermore, in step S3, the rules for genotyping interpretation are as follows:
[0047] Determining the validity of the test: If the positive control sample shows logarithmic amplification "S"-shaped curves in the FAM, VIC, ROX, and CY5 channels in PCR reaction system I and PCR reaction system II, and the negative control sample shows no amplification curve, and the sample shows obvious amplification signal in the CY5 channel, then the test is valid;
[0048] If the test is valid, the genotype at each locus will be determined according to the following rules:
[0049] For the rs193922802 site, the Ct value of PCR reaction system I alone is ≤35 in the FAM channel, indicating GG wild type; the Ct value of PCR reaction system II alone is ≤35, indicating AA homozygous mutant; and the Ct value of both reaction systems is ≤35, indicating GA heterozygous mutant.
[0050] For the rs193922816 site, the Ct value of PCR reaction system I with only VIC channel is ≤35, indicating GG wild type; the Ct value of PCR reaction system II with only VIC channel is ≤35, indicating AA homozygous mutant; and the Ct value of both reaction systems is ≤35, indicating GA heterozygous mutant.
[0051] For the rs77226819 site, the Ct value of PCR reaction system I alone is ≤35 for the CC wild type, the Ct value of PCR reaction system II alone is ≤35 for the TT homozygous mutant, and the Ct value of both reaction systems is ≤35 for the CT heterozygous mutant.
[0052] The beneficial effects of this technical solution are as follows:
[0053] This invention discloses a gene detection kit and method for reducing the incidence of anesthetic complications. By designing specific primers and probes targeting the RYR1 gene rs193922802 and rs193922816 loci and the CACNA1S gene rs77226819 locus, and combining them with primers and probes for the internal control gene GAPDH and an optimized PCR reaction system, it achieves rapid and accurate genotyping of multiple SNP loci closely related to the risk of malignant hyperthermia in a single reaction based on allele-specific amplification and fluorescent probe detection technology. The kit and method of this invention effectively solve the problem of the lack of dedicated and efficient detection tools in existing technologies. They feature high sensitivity, high accuracy, ease of operation, and intuitive interpretation, enabling clinicians to assess the risk of malignant hyperthermia after using specific anesthetics based on the patient's genotype information, thereby guiding the individualized and safe use of anesthetics and effectively reducing the occurrence of anesthetic complications. Attached Figure Description
[0054] Figure 1 This is the amplification curve of the positive control sample in an embodiment of the present invention, wherein... Figure 1 (a) Corresponding to PCR reaction system I, Figure 1 (b) Corresponding PCR reaction system II;
[0055] Figure 2 This is the amplification curve of the negative control sample in an embodiment of the present invention. Detailed Implementation
[0056] The following detailed description illustrates the specific implementation method:
[0057] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0058] In addition, unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be obtained by purchasing them from the market or prepared by existing methods.
[0059] Example 1: Establishment and Optimization of the Detection System
[0060] 1. Collect wild-type and mutant sequence information from the rs193922802 and rs193922816 sites of the RYR1 gene and the rs77226819 site of the CACNA1S gene from NCBI. Synthesize wild-type and mutant plasmids, and dilute the six plasmids to 10⁻⁶ ppm. -4 ng / ul simulates wild-type and mutant samples, with 10 samples at each site. -4 Equal volumes of wild-type and mutant plasmids (ng / ul) were mixed to obtain a heterozygous simulated sample.
[0061] 2. Based on the sequence characteristics of genetic polymorphic sites, design primers and probes for sample detection and amplify and analyze the results.
[0062] (1) Based on the sequence characteristics of the genetic polymorphism sites, the primers and probes used for sample detection were designed, and the ARMS primers, universal primers and probes used in the following PCR detection system were obtained.
[0063] This includes:
[0064] Design primers and probes to detect the rs193922802 site:
[0065] 2802-WR1: CCGAGTGCTCAGACCCTCC;
[0066] 2802-WR2: CCGAGTGCTCAGACCCCTGC;
[0067] 2802-WR3: CCGAGTGCTCAGACCCCACC;
[0068] 2802-WR4: CCGAGTGCTCAGACCCCAGC;
[0069] 2802-MR1: CCGAGTGCTCAGACCCTCT;
[0070] 2802-MR2: CCGAGTGCTCAGACCCCTGT;
[0071] 2802-MR3: CCGAGTGCTCAGACCCACT;
[0072] 2802-MR4: CCGAGTGCTCAGACCCCAGT;
[0073] 2802-F: CAGGTGCTCAAGCATGGACAGG;
[0074] 2802-P: FAM-TCTGAGCACTCGGAAGGCTCTGA-MGB;
[0075] Design primers and probes to detect the rs193922816 site:
[0076] 2816-WF1: GAGAGCGTGGAGGAGAACG;
[0077] 2816-WF2:GAGAGCGTGGAGGAGAATG;
[0078] 2816-WF3: GAGAGCGTGGAGGAGAGCG;
[0079] 2816-WF4:GAGAGCGTGGAGGAGAGAG;
[0080] 2816-MF1:GAGAGCGTGGAGGAGAACA;
[0081] 2816-MF2:GAGAGCGTGGAGGAGAATA;
[0082] 2816-MF3:GAGAGCGTGGAGGAGAGCA;
[0083] 2816-MF4:GAGAGCGTGGAGGAGAGAA;
[0084] 2816-R: CCAAAGCTGCAGGGAAGGT;
[0085] 2816-P: VIC-ATGTGGTGGTGCGGCTGCTCA-MGB;
[0086] Design primers and probes for detecting the rs77226819 site:
[0087] 6819-WF1: TGAGGCCCTGCGGATCC;
[0088] 6819-WF2: TGAGGCCCTGCGGATGC;
[0089] 6819-WF3: TGAGGCCCTGCGGAACC;
[0090] 6819-WF4: TGAGGCCCTGCGGAAGC;
[0091] 6819-MF1: TGAGGCCCTGCGGATCT;
[0092] 6819-MF2: TGAGGCCCTGCGGATGT;
[0093] 6819-MF3: TGAGGCCCTGCGGAACT;
[0094] 6819-MF4: TGAGGCCCTGCGGAAGT;
[0095] 6819-R: AGGCAGGGAGGGTGGGTT;
[0096] 6819-P: ROX-CCATCCTCCGCTCCCTTGTG-MGB;
[0097] Primers and probes for detecting the internal control gene GAPDH:
[0098] GAPDH-F: GGCCACTAGGCGCTC;
[0099] GAPDH-R: GCCACCCGCGAACTCA;
[0100] GAPDH-P: CY5-CAGGGGCGGGCGCAGG-BHQ2.
[0101] (2) The primer and probe combinations for the rs193922802 and rs193922816 sites of the RYR1 gene and the rs77226819 site of the CACNA1S gene were initially screened using the initial screening detection system shown in Table 1 below. The initial screening combinations are shown in Table 2.
[0102] Screening criteria: ① Negative control showed no obvious S-curve; ② Wild-type reaction system amplified wild-type simulated samples with obvious amplification curves, while mutant simulated samples amplified by the wild-type reaction system showed no obvious amplification curves; ③ Mutant reaction system amplified mutant simulated samples with obvious amplification curves, while wild-type simulated samples amplified by the mutant reaction system showed no obvious amplification curves; ④ When multiple groups meet the requirements, the one with the smaller CT value is preferred.
[0103] Table 1: Initial Screening Detection System
[0104]
[0105] Table 2: Initial Screening Combinations
[0106]
[0107] The DNA templates are the wild-type and mutant simulated samples synthesized and diluted in step 1, and DEPC water.
[0108] (3) Perform PCR amplification on the prepared detection system. The PCR reaction procedure is as follows:
[0109] UNG enzyme reaction: 37℃, 2 min
[0110] Pre-denaturation: 95℃, 30s
[0111] Amplification reaction: Denaturation: 95℃, 10 seconds; Annealing extension: 60℃, 30 seconds; Cycle number set to 40.
[0112] (4) Experimental results: After the operation was completed, the threshold line and baseline were set, and the CT values of each well site were analyzed. The experimental results of each group are shown in Table 3 below:
[0113] Table 3:
[0114]
[0115] Based on the CT results and screening criteria, the final selected primer-probe combinations are shown in Table 4 below:
[0116] Table 4:
[0117]
[0118] 3. Based on the initial screening results, the wild-type primers and probes of the target and the internal control fraction were combined, the amount of primers and probes was adjusted, and the optimal annealing temperature was explored to obtain the final reaction system.
[0119] PCR reaction system I:
[0120]
[0121] PCR reaction system II:
[0122]
[0123] The PCR reaction procedure is as follows:
[0124] First stage: 37℃, 2 minutes;
[0125] Second stage: 95℃, 30 minutes;
[0126] Third stage: 95℃, 10 seconds; 58℃, 30 seconds, cycle number set to 40; collect fluorescence at 58℃.
[0127] 5. Kit Design: The kit of this invention uses a premixed system, which is divided into PCR reaction system I and PCR reaction system II, which are wild-type tubes and mutant tubes corresponding to the three loci, respectively.
[0128] 6. Obtaining positive control samples: Wild-type and mutant sequence information for the rs193922802 and rs193922816 sites of the RYR1 gene, and the rs77226819 site of the CACNA1S gene, as well as GAPDH sequence information, were collected from NCBI and sent to Shanghai Sangon Biotech for synthesis of wild-type, mutant, and internal control plasmids. The seven plasmids were then diluted to 10⁻⁶ ppm. -4 A positive control sample was obtained by mixing equal volumes of ng / ul.
[0129] Example 2: Use of the gene detection kit
[0130] 1. Sample collection and processing
[0131] Peripheral blood was collected from the patient using a vacuum blood collection tube containing EDTA anticoagulant, yielding 5 ml of blood. Nucleic acid extraction was performed using a standard nucleic acid extraction kit, following the instructions in the manual.
[0132] 2. Preparation of the reaction system
[0133] PCR reaction system I and PCR reaction system II were prepared according to Example 1.
[0134] 3. PCR reaction
[0135] Add the extracted DNA to the prepared reaction system, with a template amount of 1-200 ng. During the PCR reaction, the test sample, positive control, and negative control should be tested in parallel, with each sample added to two reaction tubes simultaneously.
[0136] 4. Selection of instrument channels and reaction volume
[0137] ① Select the FAM channel (Reporter: FAM, Quencher: MGB), VIC channel (Reporter: VIC, Quencher: MGB), ROX channel (Reporter: ROX, Quencher: MGB), and CY5 channel (Reporter: CY5, Quencher: BHQ2) to detect amplification.
[0138] ② The reaction volume (Sample Volume) is 25 μL.
[0139] ③ Reference Dye: Refer to the instrument's instruction manual for specific detection channel settings.
[0140] 5. PCR reaction procedure
[0141] First stage: 37℃, 20 minutes;
[0142] Second stage: 95℃, 30 seconds;
[0143] Third stage: 95℃, 5 seconds; 58℃, 30 seconds, cycle number set to 40; collect fluorescence at 58℃.
[0144] 6. Experimental Results
[0145] After the reaction procedure is completed, save the results and interpret them. If the amplified Ct value is ≤35, it is considered detected; otherwise, it is considered undetected.
[0146] In positive control tubes 1 and 2, the fluorescence detection signals of FAM, VIC, ROX, and CY5 formed logarithmic amplification "S"-shaped curves, as shown in the figure. Figure 1 As shown; negative control tubes 1 and 2 showed no amplification curves, as... Figure 2 As shown;
[0147] Example 3: Determination of Genotype Determination Criteria for Reagent Kit
[0148] The CT values of PCR reaction system I and PCR reaction system II were read according to the detection method in Example 2, and the genotype was determined based on the CT values of the two PCR tubes. Based on the detection results of 120 human peripheral blood gDNA samples, the interpretation criteria for this kit were obtained using ROC curves, as shown in the table below:
[0149] Table 5:
[0150]
[0151] Example 4: Accuracy Performance Evaluation of the Reagent Kit
[0152] Ten clinical samples were selected and tested according to the detection method in Example 2 and the judgment criteria in Example 3. The accuracy was compared using the gold standard Sanger sequencing. The test results are as follows.
[0153] Table 6: Accuracy Test Results
[0154]
[0155] The accuracy test results for each sample were consistent with the comparison results, indicating that the detection system of the kit in Example 2 has good accuracy.
[0156] Example 5: Evaluation of the detection limit performance of the kit
[0157] Three detection limit references, L1, L2, and L3, were selected and diluted with TE buffer to prepare concentrations of 10 ng / μL, 5 ng / μL, 2.5 ng / μL, and 1 ng / μL, respectively. 0.5 g / μL samples were then tested using the method described in Example 2 and the judgment criteria of Example 3. Each concentration reference was tested 20 times. The results are shown in the table below:
[0158] Table 7: Detection Limit Results
[0159]
[0160] Using a detection rate of 95% as the lowest detection limit, the detection limit of the kit of the present invention is calculated to be as low as 1 ng / μL, and the kit of this embodiment has good sensitivity.
[0161] Example 6: Evaluation of reagent kit precision
[0162] Two precision reference samples, J1 (plasmids mixed to achieve heterozygosity at all loci) and J2 (J2 being a clinical sample), were selected and tested according to the method in Example 2. Two batches were tested daily, with each batch tested four times, for a total of five days. The coefficient of variation (CV, %) was calculated using the Ct values of the 40 precision test results. The results are shown in the table below:
[0163] Table 8:
[0164]
[0165] The calculation results show that the intra-batch and inter-batch precision results are both within 5%, indicating that the kit of this embodiment has good reproducibility.
[0166] It should be noted that, in this document, relational terms such as "first" and "second" are used only to distinguish one entity or operation from another, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Furthermore, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such process, method, article, or apparatus.
[0167] The above descriptions are merely embodiments of the present invention. Commonly known structures and characteristics are not described in detail here. Those skilled in the art are aware of all common technical knowledge in the field prior to the application date or priority date, are aware of all existing technologies in that field, and have the ability to apply conventional experimental methods prior to that date. Those skilled in the art can, under the guidance of this application, improve and implement this solution in combination with their own capabilities. Some typical known structures or methods should not be obstacles for those skilled in the art to implement this application. It should be noted that those skilled in the art can make several modifications and improvements without departing from the structure of the present invention. These should also be considered within the scope of protection of the present invention, and will not affect the effectiveness of the implementation of the present invention or the practicality of the patent. The scope of protection claimed in this application should be determined by the content of its claims, and the specific embodiments described in the specification can be used to interpret the content of the claims.
Claims
1. A gene detection kit for reducing the incidence of anesthetic complications, characterized in that, Includes the following components: Specific primers and probes targeting the target SNP site; Primers and probes targeting the internally controlled gene GAPDH; And PCR reaction solution.
2. The gene detection kit for reducing the incidence of anesthetic complications according to claim 1, characterized in that: The target SNP sites include the rs193922802 and rs193922816 sites of the RYR1 gene, and the rs77226819 site of the CACNA1S gene.
3. The gene detection kit for reducing the incidence of anesthetic complications according to claim 2, characterized in that: The primer and probe sequences used to detect the rs193922802 site are as follows: Wild-type reverse primer 2802-WR2: CCGAGTGCTCAGACCCCTGC; Mutant reverse primer 2802-MR2: CCGAGTGCTCAGACCCCTGT; Forward primer 2802-F: CAGGTGCTCAAGCATGGACAGG; Probe 2802-P: TCTGAGCACTCGGAAGGCTCTGA; The primer and probe sequences used to detect the rs193922816 site are as follows: Wild-type forward primer 2816-WF3: GAGAGCGGTGGAGGAGAGCG; Mutant forward primer 2816-MF2: GAGAGCGGTGGAGGAGAATA; Reverse primer 2816-R: CCAAAGCTGCAGGGAAGGT; Probe 2816-P: ATGTGGTGGTGCGGCTGCTCA; The primer and probe sequences used to detect the rs77226819 site are as follows: Wild-type forward primer 6819-WF4: TGAGGCCCTGCGGAAGC; Mutant forward primer 6819-MF3: TGAGGCCCTGCGGAACT; Reverse primer 6819-R: AGGCAGGGAGGGTGGGTT; Probe 6819-P: CCATCCTCCGCTCCCTTGTG; The primer and probe sequences used to detect the internal control gene GAPDH are as follows: Forward primer GAPDH-F: GGCCACTAGGCGCTC; Reverse primer GAPDH-R: GCCACCCGCGAACTCA; Probe GAPDH-P: CAGGGGCGGGCGCAGG.
4. The gene detection kit for reducing the incidence of anesthetic complications according to claim 3, characterized in that: The 5' fluorescent reporter group of each probe is selected from FAM, VIC, HEX, CY5, Texas Red or ROX, and the 3' quencher group is selected from TAMRA, BHQ1, BHQ2, MGB or Dabcyl.
5. A gene detection kit for reducing the incidence of anesthetic complications according to claim 4, characterized in that: It also includes positive control samples and negative control samples. The method for obtaining the positive control sample is as follows: Based on the wild-type and mutant sequence information of the rs193922802 and rs193922816 sites of the RYR1 gene, the rs77226819 site of the CACNA1S gene, and the GAPDH sequence information published in the NCBI database, plasmids were constructed, the sequence gene fragments were synthesized and inserted into the T vector, and the plasmids were extracted by transforming with Escherichia coli DH5α strain. The positive control sample was obtained by mixing the plasmids in equal proportions. The negative control sample is DEPC-treated deionized water.
6. The gene detection kit for reducing the incidence of anesthetic complications according to claim 5, characterized in that: The PCR reaction solution contains hot-start Taq enzyme, UNG enzyme, buffer, magnesium ions, and dNTPs. The PCR reaction solution, the wild-type reverse primer for rs193922802, the wild-type forward primer for rs193922816, the wild-type forward primer for rs77226819, and the corresponding universal primers, probes, and GAPDH primers and probes are combined to form PCR reaction system I. The PCR reaction solution, the mutant reverse primer at rs193922802, the mutant forward primer at rs193922816, the mutant forward primer at rs77226819, and the corresponding universal primers, probes, and GAPDH primers and probes are combined to form PCR reaction system II.
7. A gene detection kit for reducing the incidence of anesthetic complications according to claim 4, characterized in that: The 5' fluorescent reporter group of probe 2802-P is FAM, the 5' fluorescent reporter group of probe 2816-P is VIC, the 5' fluorescent reporter group of probe 6819-P is ROX, the 5' fluorescent reporter group of probe GAPDH-P is CY5, the 3' fluorescent reporter group of probes 2802-P, 2816-P and 2816-P are all MGB, and the 3' fluorescent reporter group of probe GAPDH-P is BHQ2.
8. A method of using a gene detection kit for reducing the occurrence of anesthetic complications as described in any one of claims 1-7, characterized in that, Includes the following steps: S1, Extract genomic DNA from the blood sample to be tested; S2, add genomic DNA to PCR reaction system I and PCR reaction system II respectively, mix well and then perform PCR amplification; S3. After the reaction is complete, genotyping is performed based on the fluorescence amplification signals from the two reaction tubes.
9. The method of use according to claim 7, characterized in that: In step S2, the PCR amplification conditions are as follows: UNG enzyme reaction: 37℃, 2 min; Pre-denaturation: 95℃, 30s; Amplification reaction: denaturation at 95℃ for 10s, annealing and extension at 58℃ for 30s, for a total of 40 cycles. Fluorescence signals were collected during the annealing and extension phase.
10. The method of use according to claim 8, characterized in that: In step S3, the rules for genotyping interpretation are as follows: Determining the validity of the test: If the positive control sample shows logarithmic amplification "S"-shaped curves in the FAM, VIC, ROX, and CY5 channels in PCR reaction system I and PCR reaction system II, and the negative control sample shows no amplification curve, and the sample shows obvious amplification signal in the CY5 channel, then the test is valid; If the test is valid, the genotype at each locus will be determined according to the following rules: For the rs193922802 site, if the Ct value of PCR reaction system I is ≤35 in the FAM channel, it is GG wild type; if the Ct value of PCR reaction system II is ≤35 in the FAM channel, it is AA homozygous mutant; if the Ct value of both reaction systems is ≤35, it is GA heterozygous mutant. For the rs193922816 site, if the Ct value of PCR reaction system I only is ≤35, it is GG wild type; if the Ct value of PCR reaction system II only is ≤35, it is AA homozygous mutant; if the Ct value of both reaction systems is ≤35, it is GA heterozygous mutant. For the rs77226819 locus, the Ct value of PCR reaction system I with ROX channel only is ≤35, indicating CC wild type; the Ct value of PCR reaction system II only is ≤35, indicating TT homozygous mutant; and the Ct value of both reaction systems is ≤35, indicating CT heterozygous mutant.