Use of or11h12 in diagnosis and treatment of esophageal squamous cell carcinoma

Abstract

The present application relates to the biomedical technology field, specifically to a kind of OR11H12 in the application of diagnosis and treatment of esophageal squamous carcinoma.The present application research finds that OR11H12 gene and / or OR11H12 protein is highly expressed in the cancer tissue of esophageal squamous carcinoma patient and esophageal squamous carcinoma cell, and OR11H12 gene and / or OR11H12 protein has the effect of significantly promoting esophageal squamous carcinoma cell proliferation.The present application first discloses the new function of OR11H12 as oncogene in esophageal squamous carcinoma, provides diagnosis biomarker and prognosis evaluation index for ESCC.And, it is first proposed to treat ESCC with OR11H12 as target, so as to provide direct basis and explicit target for the development of targeted drug (such as RNAi drug, small molecule inhibitor, etc.) for ESCC.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of OR11H12 in the diagnosis and treatment of esophageal squamous cell carcinoma. Background Technology

[0002] Esophageal cancer is one of the most common malignant tumors. Nearly half of the world's new esophageal cancer cases and deaths occur in China each year. Esophageal squamous cell carcinoma (ESCC) is the main pathological type of esophageal cancer in my country, accounting for 95.5% of all cases. According to statistics from the National Cancer Center in 2022, there are 224,000 new cases of esophageal cancer and 188,000 deaths annually in my country, posing a serious burden on the health of the Chinese people.

[0003] Currently, the clinical diagnosis of ESCC mainly relies on endoscopy, imaging examinations, tissue biopsies, and molecular marker detection. However, invasive methods such as endoscopy are difficult to use for large-scale early screening due to poor patient compliance. Although combined detection of serum tumor markers (such as CYFRA21-1, CEA, SCC, and CA199) is widely used for ESCC diagnosis, prognosis, and follow-up, the sensitivity and specificity of these markers in ESCC, especially early-stage ESCC, are not ideal. Therefore, efficient and specific early diagnostic molecular markers have become the primary bottleneck in improving the early detection rate of ESCC.

[0004] The development and progression of ESCC is the result of the combined effects of multiple genes and factors. Numerous studies have demonstrated that specific changes in many genes play a crucial role in tumorigenesis and development. Therefore, the development of molecularly targeted anti-tumor drugs for ESCC has always been a hot research topic in this field. Utilizing molecular biotechnology to study and discover the functions of ESCC-specific genes, starting from molecular targets, will be of great significance for the diagnosis and treatment of ESCC.

[0005] In terms of treatment, ESCC treatment mainly includes surgical resection, radiotherapy, chemotherapy, and targeted therapy. In recent years, immunotherapy has also shown potential. However, due to the insidious early symptoms of ESCC, most patients are diagnosed at an advanced stage. Coupled with the inherent aggressiveness and tendency to develop treatment resistance, the overall prognosis for patients remains poor. The fundamental reason is the very limited selection of molecularly targeted therapies for ESCC, stemming from insufficient understanding of the key genes and signaling pathways driving its development. Therefore, in-depth research into the molecular mechanisms of ESCC and the discovery and validation of new and effective therapeutic targets are urgent needs for developing novel targeted drugs and improving patient prognosis.

[0006] In summary, the existing technologies have the following shortcomings: (1) lack of highly sensitive and specific molecular markers for early diagnosis and prognostic assessment of ESCC; (2) limited understanding of key driver genes in the development of ESCC, resulting in a lack of effective molecular targets for targeted drug development. Summary of the Invention

[0007] Purpose of the Invention: The purpose of this invention is to address the lack of specific genes with key functions in esophageal squamous cell carcinoma (ESCC) as biomarkers and targets, and to provide the application of OR11H12 in the diagnosis and treatment of ESCC. This invention discloses for the first time the function and application of a novel target molecule, OR11H12, in esophageal squamous cell carcinoma.

[0008] Technical solution: The objective of this invention is achieved through the following technical solution: This invention provides the application of the OR11H12 gene and / or its expression product in the preparation of products for diagnosing esophageal squamous cell carcinoma, wherein the nucleotide sequence of the OR11H12 gene is shown in SEQ ID NO.1.

[0009] SEQ ID NO.1: 1 atgtgtccct tgaccttgca ggtcactggc ctaatgaatg tctctgagcc aaattccagc 61 tttgcttttg taaatgaatt tatactccaa ggtttctctt gtgagtggac aattcagatc 121 ttcctcttct cactctttac tacaatat gcactgacta taacagggaa tggagccatt 181 gcttttgccc tgtggtgtga ccggcgactt cacactccca tgtacatgtt cctgggagat 241 ttctcctttt tagagatatg gtatgtcttt tctacagttc ccaagatgtt ggtcaacttc 301 ctttcagaga aaacaaacat ctcctttgct ggatgttttc tccagtttta tttcttcttc 361 tctttgggta catcagaatg cttgcttttg actgtgatgg cctttgatca gtaccttgct 421 atctgccgtc ccttgcacta tcctaatatc atgactgggc atctctgtgc caaactggtc 481 atactgtgct gggtttgtgg atttctgtgg ttcctgatcc ccattgttct catctctcag 541 atgcccttct gtggcccaaa cattattgac catgttgtgt gtgacccagg gccactattt 601 gcattggatt gtgtttctgc cccaagaatc caactgtttt gctacactct aaactcatta 661 gttatttttg gtaacttcct ctttattatt ggatcctata ctattgtcct gaaagctgtg 721 ttgggtacac cttcaagcac tgggagacat aaggccttct ctacctgtgg gtctcatttg 781 gctgtggtat cactgtgcta tggctctctt atggtcatgt atgtgagccc aggactcgga 841 cattctacgg ggatgcagaa aattgtaact ttgttctatg ctatggtgac cccactcttc 901 aatcccctta tctatagcct ccagaataag gagataaagg cagccctgag gaaagttctg 961 gagttcca acataatcta ag.

[0010] The product was used to detect the expression level of the OR11H12 gene using RT-PCR, real-time quantitative PCR, immunoassay, in situ hybridization, microarray, or high-throughput sequencing platforms.

[0011] Products for diagnosing esophageal squamous cell carcinoma via RT-PCR must include at least one pair of primers that specifically amplify the OR11H12 gene; products for diagnosing esophageal squamous cell carcinoma via real-time quantitative PCR must include at least one pair of primers that specifically amplify the OR11H12 gene. The primer pair specifically amplifying the OR11H12 gene is shown in SEQ ID NO.2.

[0012] SEQ ID NO.2: Forward primer (5' - 3'): GGGTCTCATTTGGCTGTGGTATC Reverse primer (5' - 3'): ATCCCTGTAGAATGTCCGAGTCC.

[0013] Products that diagnose esophageal squamous cell carcinoma through immunoassay include antibodies that specifically bind to the OR11H12 protein; Products for diagnosing esophageal squamous cell carcinoma via in situ hybridization include probes that hybridize with the nucleic acid sequence of the OR11H12 gene; products for diagnosing esophageal squamous cell carcinoma via microarrays include gene chips and protein chips, wherein the gene chip includes probes that hybridize with the nucleic acid sequence of the OR11H12 gene. The probe for hybridization of the nucleic acid sequence of the OR11H12 gene, the protein chip including an antibody that specifically binds to the OR11H12 protein.

[0014] The product for diagnosing esophageal squamous cell carcinoma according to the present invention can be a reagent for detecting OR11H12 gene expression, or a kit, chip, test strip, etc. containing the reagent, or a high-throughput sequencing platform using the reagent.

[0015] In a preferred embodiment of the present invention, the product includes a chip or a reagent kit; wherein the chip includes a gene chip or a protein chip; and the reagent kit includes a gene detection reagent kit or a protein immunoassay reagent kit.

[0016] The gene chip of this invention includes a solid-phase carrier and oligonucleotide probes immobilized on the solid-phase carrier. The oligonucleotide probes include oligonucleotide probes targeting the OR11H12 gene for detecting the transcriptional level of the OR11H12 gene. The protein chip includes a solid-phase carrier and a specific antibody against the OR11H12 protein immobilized on the solid-phase carrier. The gene chip can be used to detect the expression levels of multiple genes, including the OR11H12 gene (e.g., multiple genes associated with esophageal cancer). The protein chip can be used to detect the expression levels of multiple proteins, including the OR11H12 protein (e.g., multiple proteins associated with esophageal cancer). By simultaneously detecting multiple biomarkers associated with esophageal cancer, the accuracy of esophageal cancer diagnosis can be significantly improved.

[0017] The gene detection kit of the present invention includes reagents for detecting the transcriptional level of the OR11H12 gene; the protein immunoassay kit includes a specific antibody against the OR11H12 protein.

[0018] Furthermore, the reagents include those required for detecting OR11H12 gene expression levels using RT-PCR, real-time quantitative PCR, immunoassay, in situ hybridization, or microarray methods.

[0019] The present invention also provides a tool for diagnosing esophageal squamous cell carcinoma, the tool comprising reagents for detecting OR11H12 gene expression; the reagents comprising primers and / or probes for detecting OR11H12 gene mRNA and antibodies for detecting OR11H12 protein.

[0020] The tools include, but are not limited to, chips, reagent kits, test strips, or high-throughput sequencing platforms.

[0021] The test strip includes reagents for detecting OR11H12 gene expression.

[0022] The high-throughput sequencing platform includes reagents for detecting OR11H12 gene expression.

[0023] In a preferred embodiment of the present invention, the reagent includes primers and / or probes targeting the OR11H12 gene. Primers and probes for detecting the expression level of the OR11H12 gene can be designed based on the nucleotide sequence information of the OR11H12 gene.

[0024] The probe for hybridization with the nucleic acid sequence of the OR11H12 gene described in this invention can be DNA, RNA, a DNA-RNA chimera, or other derivatives. There is no limitation on the length of the probe; any length is acceptable as long as specific hybridization and binding to the target nucleotide sequence are achieved. The probe length can be as short as 25, 20, 15, 13, or 10 base pairs. Similarly, the probe length can be as long as 60, 80, 100, 150, 300 base pairs or longer, even the entire gene. Since different probe lengths have different effects on hybridization efficiency and signal specificity, the probe length is typically at least 14 base pairs and generally does not exceed 30 base pairs. The optimal length for complementarity with the target nucleotide sequence is 15-25 base pairs. The probe's own complementary sequence should preferably be less than 4 base pairs to avoid affecting hybridization efficiency.

[0025] The OR11H12 protein-specific antibodies of this invention include monoclonal antibodies and polyclonal antibodies. These OR11H12 protein-specific antibodies include complete antibody molecules, any fragments of antibodies, or modifications (e.g., chimeric antibodies, scFv, Fab, F(ab')2, Fv, etc.). Any fragment is acceptable as long as it retains its binding ability to the OR11H12 protein. The preparation of antibodies at the protein level is well known, and this invention can use any method to prepare the antibodies.

[0026] In a specific preferred embodiment of the present invention, the primers for detecting OR11H12 gene mRNA include the primer pair shown in SEQ ID NO.2.

[0027] In some implementations, the diagnostic sample is selected from one or more of cells, tissues, serum, or plasma.

[0028] The present invention also provides the use of the OR11H12 gene and / or its expression product in the preparation of a medicament for treating esophageal squamous cell carcinoma, wherein the nucleotide sequence of the OR11H12 gene is shown in SEQ ID NO.1.

[0029] The drug is a reagent that inhibits OR11H12 gene expression, inhibits OR11H12 functional expression, and / or inhibits the activity of OR11H12 gene expression products.

[0030] The reagents for inhibiting OR11H12 gene expression according to this invention include reagents for inhibiting gene transcription and reagents for inhibiting gene translation; the reagents for inhibiting the activity of OR11H12 gene expression products include reagents for inhibiting OR11H12 gene mRNA and reagents for inhibiting OR11H12 protein. The reagents for inhibiting OR11H12 gene mRNA include reagents for inhibiting mRNA stability and reagents for inhibiting mRNA translational activity. The reagents for inhibiting OR11H12 protein include reagents for inhibiting OR11H12 protein stability, reagents for inhibiting OR11H12 protein activity, and reagents for inhibiting OR11H12 protein function.

[0031] The reagents for inhibiting OR11H12 gene mRNA include double-stranded ribonucleic acid targeting OR11H12 gene mRNA; the reagents for inhibiting OR11H12 protein function include tumor vaccines containing OR11H12 antigen protein and antibodies that inhibit OR11H12 protein function. The antibodies may be polyclonal antibodies or monoclonal antibodies.

[0032] In a preferred embodiment of the present invention, the reagent comprises siRNA, sgRNA, shRNA, small molecule inhibitors, and / or antibodies that inhibit the OR11H12 protein and can inhibit the OR11H12 gene.

[0033] The nucleotide sequences of the shRNA and siRNA that inhibit the OR11H12 gene are shown in Table 1.

[0034] Table 1. Target nucleotide sequences of shRNA or siRNA targeting the OR11H12 gene

[0035] The SEQ ID NOs corresponding to each target sequence in Table 1 are as follows: shOR11H12#1 (SEQ ID NO:3), shOR11H12#2 (SEQ ID NO:4), shOR11H12#3 (SEQ ID NO:5), vector (SEQ ID NO:6).

[0036] In this invention, the target nucleotide sequence of the shRNA or siRNA that inhibits the OR11H12 gene can be selected from the sequence shown in SEQ ID NO:3, SEQ ID NO:4 or SEQ ID NO:5; more preferably, the target nucleotide sequence is the sequence shown in SEQ ID NO:3 or SEQ ID NO:4.

[0037] The present invention also provides a pharmaceutical composition for treating esophageal squamous cell carcinoma, the pharmaceutical composition comprising an inhibitor of the OR11H12 gene and / or its expression product as described above.

[0038] The pharmaceutical compositions of the present invention further include a pharmaceutically acceptable carrier, wherein the carrier may be one or a mixture of two or more of the following: excipients, diluents, thickeners, fillers, binders, disintegrants, lubricants, oleic or non-oleic bases, surfactants, suspending agents, gelling agents, adjuvants, preservatives, antioxidants, stabilizers, colorants, or fragrances.

[0039] The pharmaceutical compositions of the present invention can be used to manufacture medicaments for treating esophageal squamous cell carcinoma.

[0040] The pharmaceutical compositions of the present invention are preferably applied to mammals, wherein the mammal is preferably a human patient.

[0041] The pharmaceutical composition of the present invention can be administered to the human patient, for example, by oral administration or injection.

[0042] The pharmaceutical composition of the present invention can also be used in combination with other drugs for treating esophageal cancer, and the combined use of multiple drugs can greatly improve the success rate of treatment.

[0043] In the context of this invention, "OR11H12 gene" includes the OR11H12 gene and any polynucleotides of the OR11H12 gene that have more than 70% homology with the OR11H12 gene (NC_000014.9) DNA sequence in the current international public nucleic acid sequence database Gene Bank, and that encodes a protein with the same function; Preferably, the coding sequence of the OR11H12 gene includes any one of the following DNA molecules: (1) The DNA sequence shown in SEQ ID NO.1 of the sequence listing; (2) A DNA sequence that hybridizes with the DNA sequence defined in (1) under strict conditions and encodes a protein with the same function; (3) A DNA molecule that has 70% or more, preferably 90% or more, homology with the DNA sequence defined in (1) or (2) and encodes a protein with the same function.

[0044] In a specific embodiment of the present invention, the coding sequence of the OR11H12 gene is the DNA sequence shown in SEQ ID NO.1.

[0045] In the context of this invention, the OR11H12 gene expression product includes the OR11H12 protein and a partial peptide of the OR11H12 protein. The partial peptide of the OR11H12 protein contains functional domains associated with esophageal cancer.

[0046] "OR11H12 protein" includes the OR11H12 protein and any functional equivalents of the OR11H12 protein. These functional equivalents include conserved variants of the OR11H12 protein, its active fragments, its active derivatives, allelic variants, natural mutants, induced mutants, and proteins encoded by DNA that can hybridize with OR11H12 DNA under high or low stress conditions.

[0047] Preferably, the OR11H12 protein is a protein having the following amino acid sequence: (1) A protein consisting of the amino acid sequence shown in SEQ ID NO.7 of the sequence listing; SEQ ID NO.7: 1 mcpltlqvtg lmnvsepnss fafvnefilq gftcewtiqi flfslfttty altitgngai 61 afvlwcdwrl htpmymflgn fsfleiwyvs stvpkmlvnf lsekknisfa gcflqfyfff 121 slgtsecllll tvmafdqyla icrpllypni mtghlcaklv ilcwvcgflw flipivlisq 181 mpfcgpniid hvvcdpgprf aldcvsapri qlfcytlssl vifgnflfii gsytlvlkav 241 lgmpsstgrh kafstcgshl avvslcyssl mvmyvspglg hstgmqkiet lfyamvtplf 301 npliyslqnk eikaalrkvl gssnii (2) A protein derived from the amino acid sequence shown in SEQ ID NO.7 by substitution and / or deletion and / or addition of one or more amino acid residues, and having the same function as the amino acid sequence shown in SEQ ID NO.7. The number of substituted, deleted or added amino acids is usually 1-50, preferably 1-30, more preferably 1-20, and most preferably 1-10.

[0048] (3) A polypeptide having at least 80% homology (also known as sequence identity) with the amino acid sequence shown in SEQ ID NO.7, more preferably having at least about 90% to 95% homology with the amino acid sequence shown in SEQ ID NO.7, often consisting of amino acid sequences with 96%, 97%, 98%, or 99% homology.

[0049] In a specific embodiment of the present invention, the OR11H12 protein is a protein having the amino acid sequence shown in SEQ ID NO.7.

[0050] It is generally known that modifications to one or more amino acids in a protein do not affect the protein's function. Those skilled in the art will recognize that alterations to a single amino acid or a small percentage of amino acids, or individual additions, deletions, insertions, or substitutions of amino acid sequences, are conserved modifications, where the protein alteration produces a protein with a similar function. Providing tables of conserved substitutions for functionally similar amino acids is well-known in the art.

[0051] An example of a protein modified by adding one or more amino acid residues is a fusion protein of the OR11H12 protein. There are no restrictions on the peptides or proteins fused to the OR11H12 protein, as long as the resulting fusion protein retains the biological activity of the OR11H12 protein.

[0052] The OR11H12 protein of the present invention also includes non-conservative modifications to the amino acid sequence shown in SEQ ID NO. 7, as long as the modified protein retains the biological activity of the OR11H12 protein. In such modified proteins, the number of mutated amino acids is typically 10 or fewer, for example, 6 or fewer, such as 3 or fewer.

[0053] In the context of this invention, "diagnosing esophageal cancer" includes both determining whether a subject already has esophageal cancer and determining whether a subject is at risk of developing esophageal cancer.

[0054] In the context of this invention, "treatment of esophageal cancer" can be categorized by changes in the state of the disease, including disease remission, complete cure of the disease, and treatment effects for evaluating the disease. Beneficial effects

[0055] (1) This invention reveals for the first time the novel function of the olfactory receptor gene OR11H12 as an oncogene in esophageal squamous cell carcinoma (ESCC), providing a novel and highly promising diagnostic biomarker and prognostic assessment indicator for ESCC.

[0056] (2) Based on the above findings, this invention proposes for the first time to treat ESCC by targeting OR11H12, and experimentally confirms that inhibiting its expression can significantly inhibit cancer cell proliferation, thus providing a direct basis and clear target for the development of targeted drugs for ESCC (such as RNAi drugs, small molecule inhibitors, etc.). Attached Figure Description

[0057] Figure 1 OR11H12 is highly expressed in ESCC tissues and is associated with poor prognosis.

[0058] (a) Immunohistochemical staining (IHC) was used to detect the expression of OR11H12 protein in esophageal squamous cell carcinoma tissue and adjacent tissue; (b) Immunohistochemical scoring (IRS) was used to compare the difference in OR11H12 expression between cancer and adjacent tissue; (c) Analysis of OR11H12 expression level and patient prognosis. Figure 2 Differential expression of OR11H12 in normal esophageal epithelial cells and esophageal squamous cell carcinoma cell lines.

[0059] Figure 3 Validation of the stable OR11H12 cell line.

[0060] (a) Western Blot analysis of the effects of KYSE150 knockdown, ECA109 knockdown, and KYSE30 overexpression on stable conversion of lentivirus to OR11H12; (b) qPCR analysis of the effects of KYSE150 knockdown, ECA109 knockdown, and KYSE30 overexpression on stable conversion of lentivirus to OR11H12. Figure 4 The effect of inhibiting / overexpressing the OR11H12 gene on the proliferation ability of esophageal squamous cell carcinoma cells was detected using the CCK-8 assay. Detailed Implementation

[0061] The present invention will now be described in further detail with reference to the accompanying drawings and embodiments. The following embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0062] Experimental methods not specified in the examples are generally performed under standard conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer.

[0063] Experiment 1: Expression level of OR11H12 gene in esophageal squamous cell carcinoma tissue 1. Experimental Materials: ESCC and adjacent normal tissue samples were obtained from ESCC patients who underwent radical surgery at Huai'an First People's Hospital. All specimens were obtained with the approval of the organization's ethics committee.

[0064] 2. Tissue chip fabrication The collected 76 pairs of cancer and adjacent normal tissue specimens were entrusted to Shanghai Chipchao Biotechnology Co., Ltd. for tissue microarray fabrication.

[0065] 3. Immunohistochemistry (IHC) on microarrays After baking, dewaxing, antigen retrieval, removal of endogenous peroxidase interference, blocking, primary antibody incubation, secondary antibody incubation, color development, HE counterstaining, dehydration and sealing, the slides are mounted and then observed under a microscope.

[0066] The antibody information is as follows: primary antibody OR11H12 (Qinke Biotechnology, DF5186), secondary antibody is HRP-labeled goat anti-rabbit IgG (Seville Biotechnology, GB23303). 4. Analysis of IHC Image Results All IHC results were independently interpreted to determine the staining positivity intensity and positive cell ratio. The positivity intensity was divided into three grades: grade 0 (no positive staining), grade 1 (pale yellow with weak positivity), grade 2 (brownish-yellow with moderate positivity), and grade 3 (brownish-brown with strong positivity). The positive cell ratio was divided into four grades: grade 0 (0-5%), grade 1 (6%-25%), grade 2 (26%-50%), grade 3 (51%-75%), and grade 4 (>75%).

[0067] The final result is calculated according to the Immunoreactive Score (IRS) = Positive Intensity × Positive Cell Ratio.

[0068] 5. Statistical Analysis Kaplan-Meier survival analysis was used to analyze the relationship between OR11H12 expression levels and prognosis. Cox proportional hazards models were used to analyze the impact of single or multiple factors on patient survival. All experiments were independently repeated three times. Statistical analysis was performed using GraphPad 8.0 and SPSS 26.0. Independent samples t-tests were used to compare differences between two groups, ANOVA analysis was used for multiple group comparisons, and chi-square tests were used to investigate the relationship between categorical variables in two groups. P < 0.05 was considered statistically significant.

[0069] 6. Results like Figure 1 As shown, Figure 1 (a) Figure 1 (b) shows that the protein expression level of OR11H12 was significantly increased in esophageal squamous cell carcinoma tissue compared with adjacent normal tissue, and the difference was statistically significant (P<0.0001). Figure 1 In (c), Kaplan-Meier survival analysis revealed that patients with high expression of OR11H12 in tumor tissue had a worse prognosis and shorter survival.

[0070] Experiment 2: Differential expression of OR11H12 gene in normal esophageal epithelial cells and esophageal squamous cell carcinoma cell lines 1. Research Subjects: The human esophageal squamous cell carcinoma cell lines used in this study were KYSE410, ECA109, KYSE150, KYSE30, and TE1, as well as human esophageal squamous epithelial cells HEEC. KYSE30 and TE1 were purchased from the Cell Bank of the Chinese Academy of Sciences, while the other cell lines were obtained from the Cell Laboratory of Huai'an First People's Hospital.

[0071] 2. Cell culture and passage Human esophageal squamous cell carcinoma cell lines KYSE410, ECA109, KYSE150, KYSE30, and TE1, as well as human esophageal squamous epithelial cells HEEC, were seeded into RPMI-1640 medium (Kaiji Bioscience) containing 10% fetal bovine serum (CLARK Bioscience) and cultured in a 37°C, 5% CO2 incubator. When the cells reached 90% confluence, they were digested and passaged with trypsin (Xin Saimei).

[0072] 3. Extract cell proteins and determine protein concentration. Cells were lysed using RIPA lysis buffer (NewCymex, Cat. NO: WB3100), and the protein supernatant was collected for later use. Protein concentrations were calculated using a BCA protein assay kit (NewCymex, Cat. NO: WB6501). Samples from the experimental group (human esophageal squamous cell carcinoma cell line) and the control group (human esophageal squamous epithelial cells HEEC) were balanced according to the measured concentrations, and samples with higher concentrations were diluted with deionized water to the same concentration.

[0073] 4. Western blot detection The extracted proteins were quantitatively analyzed by SDS-PAGE electrophoresis, followed by membrane transfer, blocking, primary antibody incubation, secondary antibody incubation, and color development.

[0074] Antibody information: Primary antibody OR11H12 (Qinke Biotechnology, DF5186), secondary antibody α-tubulin (Sanying Biotechnology, 11224-1-AP) 5. Results The results are as follows Figure 2 As shown, α-Tubulin expression remained relatively constant across various cell lines. Therefore, it was used as an internal control protein in Western blot experiments to correct for errors in protein quantification and sample loading, ensuring the accuracy of experimental results. α-Tubulin indicated consistent total protein quantification across cell lines, allowing for comparison of OR11H12 protein expression differences among different cell lines. The results showed that OR11H12 expression levels in esophageal squamous cell carcinoma cell lines were significantly higher than in HEEC cells, with the highest expression levels in KYSE150 and ECA109 cells, and the lowest in KYSE30 cells.

[0075] Experiment 3: Validation of OR11H12 knockdown / overexpression stable cell lines 1. Cell culture and passage Human esophageal cancer cell lines ECA109, KYSE150, and KYSE30 were seeded into RPMI-1640 medium containing 10% fetal bovine serum and cultured in a 37°C, 5% CO2 incubator. When the cells reached 90% confluence, they were passaged by trypsin digestion.

[0076] 2. Lentiviral transfection Cells were prepared, adenovirus transfected, and medium was changed. Cells were then passaged and purine-selected for the target cell line (Reference: Cell. 2019 Sep 5;178(6):1478-1492.e20.). The transfection efficiency was detected by RT-qPCR and Western Blot experiments. The OR11H12 overexpression transfection sequence was synthesized by Shanghai Heyuan Biotechnology Co., Ltd., as shown in Table 2.

[0077] According to Table 1, shRNAs with target sequences shOR11H12#1 (SEQ ID NO: 3) and shOR11H12#2 (SEQ ID NO: 4) were selected to construct OR11H12 knockdown stable ESCC cell lines, and shRNA with target sequence vector (SEQ ID NO: 6) (i.e., sh-vector) was used as a blank control. According to Table 2, pL-OR11H12 sequences were selected to construct overexpressing ESCC cell lines for cell experiments. Subsequent experiments were uniformly named: the knockdown control group was sh-vector, the knockdown experimental groups were shOR11H12#1 (corresponding to SEQ ID NO: 3) and shOR11H12#2 (corresponding to SEQ ID NO: 4), the overexpression control group was pL-vector, and the pL-vector was an empty vector without the OR11H12 gene coding sequence. The overexpression experimental group pL-OR11H12, its sequence is shown in Table 2 below: Table 2 OR11H12 transfection sequences

[0078] 3. RNA extraction Add Trizol reagent for lysis, vortex, let stand for 15 min, and centrifuge; add 200 μL chloroform reagent, vortex, let stand for 10 min, and centrifuge; take the upper aqueous phase, add an equal volume of isopropanol, vortex to mix, let stand for 10 min, and centrifuge for 10 min; discard the supernatant, add 1 mL of 75% ethanol, mix thoroughly, let stand for 5 min, and centrifuge at 4℃, 12000 rpm for 5 min; discard the supernatant and air dry.

[0079] 4. Determination of RNA concentration and purity RNA concentration was measured on the instrument. The concentrations of the experimental group (shOR11H12#1, shOR11H12#2 / pL-OR11H12) and the control group (sh-vector / pL-vector) were balanced according to the measured concentrations. The samples with high concentrations were diluted with deionized water to the same concentration.

[0080] 5. Reverse transcription, Real-Time PCR (1) The reaction system of the reverse transcription kit (VIC qRT Super kit, Microcommend Biotechnology Co., Ltd., VR105) is 20 μL. The reverse transcription system is shown in Table 3: Table 3 Reverse Transcription System Step 1:

[0081] Mix well and incubate at 42°C for 2 minutes. After the reaction is complete, briefly centrifuge and cool on ice.

[0082] Step 2:

[0083] The PCR reverse transcription instrument was used with the following reaction program: 37℃ for 15 min, 85℃ for 5 s; and cooled to 4℃.

[0084] (2) Primer design: Based on the cDNA sequences in NCBI and Gene Bank, primers were designed by Sangon Biotech Co., Ltd. The primer sequences are shown in Table 4: Table 4 RT-PCR Primer Sequences

[0085] (3) The qPCR reaction system is 20 μL. The qPCR reaction system is shown in Table 5: Table 5 qPCR reaction system

[0086] Reaction program: pre-denaturation 95℃ 3 min, denaturation 95℃ 10 s, annealing and extension 60℃ 30 s, amplification for a total of 40 cycles, melting curve 95℃ 15 s, 60℃ 1 min, 95℃ 15 s.

[0087] (4) Results analysis: GAPDH was used as an internal reference, and the relative expression level of the target gene was calculated using the 2^(-△△CT) method.

[0088] 6. Western blot assay to detect the knockdown / overexpression efficiency of virus-transfected cell lines. The Western blot experimental procedure is the same as in Example 2.

[0089] 7. Results The results are as follows Figure 3 As shown. Figure 3 (a) Western blot experiments showed that, compared with the sh-vector group, the OR11H12 protein content was significantly reduced in cells with knockdown of shOR11H12#1 and shOR11H12#2. Compared with the pL-vector group, the OR11H12 protein content was significantly increased in cells overexpressing pL-OR11H12. Similarly, Figure 3(b) The qPCR experiment showed that, compared with the sh-vector group, the content of OR11H12 mRNA in cells with knockdown of shOR11H12#1 and knockdown of shOR11H12#2 was significantly reduced, and the difference was statistically significant (P < 0.05). Conversely, compared with the pL-vector group, the content of OR11H12 mRNA in cells overexpressing pL-OR11H12 was significantly increased, and the difference was statistically significant (P < 0.05).

[0090] Experiment 4: Determination of the effect of OR11H12 gene expression on the proliferation ability of esophageal squamous cell carcinoma cells. 1. The CCK8 assay kit (Microcomman Biotechnology Co., Ltd., VC5001L) was used to detect the proliferation ability of esophageal squamous cell carcinoma cells. Esophageal squamous cell carcinoma cells were cultured and transfected according to the method in Example 3 above, and the cells were divided into experimental and control groups.

[0091] Knockdown groups: Group 1: sh-vector cell group; Group 2: shOR11H12#1 cell group; Group 3: shOR11H12#2; and overexpression groups: Group 1: pL-vector cell group; Group 2: pL-OR11H12 cell group.

[0092] Cell groups were prepared in 96-well plates with 3000 cells per well, 5 replicates per group, and blank control wells. 100 μL of 1640 medium was added to each well. After incubation at 37°C in a 5% CO2 incubator for 0 h, 24 h, 48 h, 72 h, and 96 h, 10 μL of CCK8 solution was added to each well, and the cells were incubated at 37°C in the dark for 1 h 50 min. The OD value of each well was detected and recorded using a microplate reader at 450 nm.

[0093] 2. Statistical methods All experiments were performed in triplicate. The results are expressed as mean ± standard deviation. SPSS 26.0 statistical software was used for statistical analysis. The differences between the two results were analyzed by t-test, and P < 0.05 was considered statistically significant.

[0094] 3. Results The results are as follows Figure 4 As shown, compared with the sh-vector group, the cell proliferation capacity of the shOR11H12#1 and shOR11H12#2 knockdown cell groups was significantly inhibited, and the difference was statistically significant (P<0.05). Conversely, compared with the pL-vector cell group, the proliferation rate of the pL-OR11H12 overexpression cell group was significantly increased, and the difference was statistically significant (P<0.05).

[0095] The above experimental results indicate that OR11H12 gene expression promotes the proliferation of esophageal squamous cell carcinoma cells.

[0096] As described above, although the invention has been shown and described with reference to specific preferred embodiments, it should not be construed as limiting the invention itself. Various changes in form and detail may be made without departing from the spirit and scope of the invention as defined in the appended claims.

Claims

1. The application of the OR11H12 gene and / or its expression product in the preparation of products for diagnosing esophageal squamous cell carcinoma, characterized in that, The nucleotide sequence of the OR11H12 gene is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The product was used to detect the expression level of the OR11H12 gene using RT-PCR, real-time quantitative PCR, immunoassay, in situ hybridization, microarray, or high-throughput sequencing platforms.

3. The application according to claim 2, characterized in that, Products for diagnosing esophageal squamous cell carcinoma via RT-PCR include at least one pair of primers that specifically amplify the OR11H12 gene; products for diagnosing esophageal squamous cell carcinoma via real-time quantitative PCR include at least one pair of primers that specifically amplify the OR11H12 gene, the primer sequences of which are shown in SEQ ID NO.2; products for diagnosing esophageal squamous cell carcinoma via immunoassay include antibodies that specifically bind to the OR11H12 protein; products for diagnosing esophageal squamous cell carcinoma via in situ hybridization include probes that hybridize to the nucleic acid sequence of the OR11H12 gene; products for diagnosing esophageal squamous cell carcinoma via microarrays include gene chips and protein chips, wherein the gene chip includes probes that hybridize to the nucleic acid sequence of the OR11H12 gene, and the protein chip includes antibodies that specifically bind to the OR11H12 protein.

4. The application according to claim 1, characterized in that, The product includes chips or reagent kits; wherein the chips include gene chips and protein chips; and the reagent kits include gene detection kits and protein immunoassay kits.

5. The application as described in any one of claims 1-4, wherein the diagnostic sample is selected from one or more of cells, tissues, serum, or plasma.

6. A tool for diagnosing esophageal squamous cell carcinoma, characterized in that, The tool includes reagents for detecting OR11H12 gene expression; the reagents include primers and / or probes for detecting OR11H12 gene mRNA and antibodies for detecting OR11H12 protein.

7. The use of the OR11H12 gene and / or its expression product in the preparation of a drug for treating esophageal squamous cell carcinoma, characterized in that, The nucleotide sequence of the OR11H12 gene is shown in SEQ ID NO.

1.

8. The application according to claim 7, characterized in that, The drug is a reagent that inhibits OR11H12 gene expression, inhibits OR11H12 gene function and / or reduces the activity of its expression product, the reagent comprising siRNA, sgRNA, shRNA, small molecule inhibitors, and / or antibodies that inhibit OR11H12 protein.

9. The application according to claim 7, characterized in that, The OR11H12 gene inhibitor is shRNA or siRNA, and the shRNA or siRNA sequence is shown in SEQ ID NO: 3 and / or SEQ ID NO:

4.

10. The application according to claim 7 or 8, characterized in that, The drug also includes a pharmaceutically acceptable carrier.

Images