A snp molecular marker related to muscle firmness of hu sheep and application thereof

Abstract

The application discloses a SNP marker related to muscle hardness of Hu sheep and application thereof and belongs to the technical field of molecular biology and genetic breeding. The SNP marker is located at 215791399 bp of chromosome No. 2 of a sheep reference genome ARS-UI_Ramb_v2.0, and the base mutation is G>T (rs425254845). Whole genome resequencing and determination data of longissimus dorsi muscle hardness of 6-month-old Hu sheep show that the SNP marker has a significant influence on the longissimus dorsi muscle hardness of the Hu sheep, and the G allele has lower hardness. Therefore, the rs425254845 can be applied to the molecular marker selection breeding of the muscle hardness trait of the Hu sheep, the selection efficiency of meat quality of the Hu sheep is improved, and the cultivation process of a new strain of low-hardness and high-quality meat Hu sheep is accelerated.

Description

Technical Field

[0001] This invention belongs to the fields of genetic breeding and molecular biology, specifically relating to a SNP molecular marker related to muscle hardness in Hu sheep and its application. Background Technology

[0002] The Hu sheep is an important local sheep breed in my country, characterized by early sexual maturity, high reproductive capacity, strong adaptability, and suitability for indoor feeding, playing a vital role in the development of my country's meat sheep industry. With rising living standards, the demand for mutton has shifted from simply pursuing quantity to emphasizing meat quality and palatability. Meat texture traits are important objective indicators for evaluating the sensory quality of meat, mainly including firmness, elasticity, cohesiveness, adhesiveness, and chewiness. Among these, muscle firmness is a crucial parameter reflecting tenderness and chewiness, directly impacting consumers' sensory evaluation of mutton quality and market acceptance.

[0003] Currently, breeding work on Hu sheep mainly focuses on reproductive performance, growth performance, and carcass traits, while research on the genetic improvement of meat quality, especially muscle texture traits, is relatively weak. Muscle firmness typically requires collecting muscle samples after slaughter and measuring them using a texture analyzer; it cannot be measured directly while the animal is alive. Therefore, traditional breeding methods struggle to perform early selection and precise improvement of muscle firmness in Hu sheep. This results in low efficiency in selecting for meat quality and makes it difficult to quickly develop new breeds of low-firmness, high-quality meat-producing Hu sheep.

[0004] Single nucleotide polymorphisms (SNPs) are among the most widely used genetic markers in animal molecular breeding. Genome-wide association studies (GWAS) can screen for genetic variation sites significantly associated with target complex traits across the entire genome, providing a basis for marker-assisted selection and genomic selection. If SNP markers significantly associated with muscle firmness in Hu sheep can be identified, genotyping can be performed on live Hu sheep using blood, ear tissue, or hair follicle samples to predict their genetic potential for muscle firmness, enabling early selection of low-firmness, high-quality meat-producing Hu sheep.

[0005] To date, there are no reports on the correlation between specific SNP sites on the SPAG16 gene of Hu sheep and muscle firmness traits, nor are there any reports on the use of this SNP marker for early selection of Hu sheep for muscle firmness. Therefore, developing a SNP molecular marker related to muscle firmness in Hu sheep is of great significance for improving the efficiency of genetic improvement of Hu sheep meat quality and accelerating the breeding of new high-quality meat-producing Hu sheep breeds. Summary of the Invention

[0006] To address the shortcomings of existing technologies that rely on post-slaughter meat texture analysis for determining the muscle firmness trait in Huzhou sheep, which prevents early selection in vivo, and lack molecular markers significantly associated with muscle firmness for assisted breeding, this invention uses genome-wide association analysis to screen and obtain the SNP marker rs425254845 located in the intron region of the SPAG16 gene, confirming its significant association with the muscle firmness trait in Huzhou sheep. This SNP marker can be used for molecular detection of the muscle firmness trait in Huzhou sheep, prediction of genetic potential, and early screening of superior breeding sheep, providing a reliable genetic marker and technical means for molecular breeding of Huzhou sheep meat quality. This invention aims to provide an SNP molecular marker associated with muscle firmness in Huzhou sheep and its applications.

[0007] To achieve the above objectives, the present invention employs the following technical solution: In a first aspect, the present invention provides the application of a reagent for detecting SNP molecular markers related to muscle hardness in Hu sheep in the breeding of Hu sheep. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1. The 149th base from the 5' end of the sequence shown in SEQ ID NO.1 is the SNP site. The SNP site is located at nucleotide 215791399 on chromosome 2 of the sheep reference genome ARS-UI_Ramb_v2.0. The SNP site is G or T, and the muscle hardness of Hu sheep individuals with the GG and GT genotypes is significantly lower than that of Hu sheep individuals with the TT genotype.

[0008] This invention provides a reagent for detecting SNP molecular markers associated with muscle hardness in Hu sheep, and its application in predicting the muscle hardness trait in Hu sheep. The nucleotide sequence of the SNP marker is shown in SEQ ID NO.1, where the SNP site is located at position 149 from the 5' end of the sequence shown in SEQ ID NO.1. The SNP site is located at nucleotide position 215791399 on chromosome 2 of the sheep reference genome ARS-UI_Ramb_v2.0. The SNP site is either G or T, and the muscle hardness of Hu sheep individuals with the GG and GT genotypes is significantly lower than that of Hu sheep individuals with the TT genotype. By simply detecting the genotype of the Hu sheep at this SNP site, muscle hardness can be accurately predicted without slaughter, providing a rapid and reliable molecular method for in vivo assessment of muscle hardness in Hu sheep.

[0009] This invention provides a reagent for detecting SNP markers associated with muscle hardness in Hu sheep, used in the preparation of reagents for predicting the muscle hardness trait in Hu sheep. The nucleotide sequence of the SNP marker is shown in SEQ ID NO.1, where the SNP site is located at position 149 from the 5' end of the sequence shown in SEQ ID NO.1. This SNP site is located at nucleotide position 215791399 on chromosome 2 of the sheep reference genome ARS-UI_Ramb_v2.0. The SNP site is either G or T, and the muscle hardness of Hu sheep individuals with the GG and GT genotypes is significantly lower than that of Hu sheep individuals with the TT genotype. After this reagent is prepared into a standardized predictive reagent product, high-throughput, batch prediction of the muscle hardness trait in Hu sheep can be achieved. This reagent can specifically identify the G / T polymorphism at position 149 of the sequence shown in SEQ ID NO.1, and the correlation between the detection results and the measured muscle hardness values ​​reaches a highly significant level (P<0.01). The widespread application of this reagent product can significantly reduce the technical threshold and detection cost for muscle hardness prediction.

[0010] This invention provides the application of reagents for detecting SNP markers associated with muscle hardness in Hu sheep in the preparation of kits for screening or identifying Hu sheep breeds with low muscle hardness. The nucleotide sequence of the SNP marker is shown in SEQ ID NO.1, where the SNP site is located at the 149th base from the 5' end of the sequence shown in SEQ ID NO.1. The SNP site is located at nucleotide 215791399 on chromosome 2 of the sheep reference genome ARS-UI_Ramb_v2.0. The SNP site is either G or T, and the muscle hardness of Hu sheep individuals with the GG and GT genotypes is significantly lower than that of Hu sheep individuals with the TT genotype.

[0011] This invention provides the application of primers for detecting SNP markers related to muscle hardness in Hu sheep in the preparation of a detection kit. The nucleotide sequence of the SNP marker is shown in SEQ ID NO.1. The SNP site is located at the 149th base from the 5' end of the sequence shown in SEQ ID NO.1. The SNP site is located at nucleotide 215791399 on chromosome 2 of the sheep reference genome ARS-UI_Ramb_v2.0. The SNP site is G or T, and the muscle hardness of Hu sheep individuals with the GG and GT genotypes is significantly lower than that of Hu sheep individuals with the TT genotype.

[0012] This invention provides a method for breeding Hu sheep, comprising: Primers were designed based on the nucleotide sequences flanking the SNP marker. Blood or tissue was collected from the Hu sheep to be tested after birth and genomic DNA was extracted. Primers were used to perform genotyping on the Hu sheep to be tested to determine the genotype of the Hu sheep to be tested. Individuals with the G allele are selected, and the breeding trait is muscle hardness; The nucleotide sequence of the SNP marker is shown in SEQ ID NO.1. The 149th base from the 5' end of the sequence shown in SEQ ID NO.1 is the SNP site. The SNP site is located at nucleotide 215791399 on chromosome 2 of the sheep reference genome ARS-UI_Ramb_v2.0. The SNP site is G or T, and the muscle rigidity of Hu sheep individuals with the GG and GT genotypes is significantly lower than that of Hu sheep individuals with the TT genotype.

[0013] Genomic DNA was extracted from the sheep to be tested and amplified by PCR. The PCR amplification products were then sequenced using HISEQ2000, SOLiD, 454 or single-molecule sequencing methods. The genotype of the SNP marker in the sheep to be tested was determined based on the sequencing results, and the muscle hardness trait of the sheep was predicted.

[0014] The muscle rigidity of Hu sheep individuals with the GG and GT genotypes at the SNP marker sites was significantly lower than that of Hu sheep individuals with the TT genotype.

[0015] This invention provides a method for screening Hu sheep with low muscle hardness traits. The method involves detecting SNP markers related to muscle hardness traits in Hu sheep, selecting Hu sheep individuals with genotypes GG or GT as breeding stock for low muscle hardness Hu sheep breeds, and culling Hu sheep individuals with the TT genotype. The sequence of the SNP marker is shown in SEQ ID NO.1, and the 149th base from the 5' end of the sequence shown in SEQ ID NO.1 is G or T.

[0016] The SNP marker is located at nucleotide 215791399 on chromosome 2 of the sheep reference genome ARS-UI_Ramb_v2.0.

[0017] Compared with the prior art, the present invention has the following beneficial effects: This invention is the first to discover that the SNP locus rs425254845, located in the intron region of the SPAG16 gene, is significantly associated with the muscle firmness trait in Hu sheep. Association analysis results show that the muscle firmness of GG and GT individuals is significantly lower than that of TT individuals (P<0.01), indicating that the G allele can serve as a dominant allele for low muscle firmness. The detection reagent developed based on this locus can accurately identify individuals with genetic potential for low muscle firmness in Hu sheep during the live stage, enabling early prediction and targeted selection of meat quality traits. This technology overcomes the limitation that traditional muscle firmness traits must be measured after slaughter, improving the efficiency of selecting superior breeding sheep, reducing breeding costs, and providing a new genetic marker resource for marker-assisted selection of Hu sheep meat quality. The Hu sheep breeding method provided by this invention applies the SNP marker rs425254845, which is significantly associated with muscle firmness in Hu sheep, to the breeding sheep selection process. By detecting the genotype of the target locus, the genetic potential for muscle firmness in individuals can be predicted during the live stage, and GG and GT individuals can be preferentially selected as breeding sheep. This method overcomes the limitation that traditional muscle firmness traits can only be evaluated through slaughter testing, enabling early screening of superior individuals with low muscle firmness. It improves the efficiency and accuracy of breeding sheep selection, reduces breeding costs, and provides a new technical approach for the genetic improvement of Hu sheep meat quality and marker-assisted breeding. The method for screening Hu sheep with low muscle firmness provided by this invention directly uses the genotype detection results at the rs425254845 locus as the screening basis, selecting individuals with the GG or GT genotypes as breeding sheep for the low muscle firmness line, while culling individuals with the TT genotype. The SNP molecular marker rs425254845, which is significantly associated with muscle firmness in Hu sheep, was screened out. The muscle firmness of Hu sheep with different SNP genotypes showed significant differences. The average muscle firmness of the TT genotype was 33.14 N, the average muscle firmness of the GT genotype was 23.00 N, and the average muscle firmness of the GG genotype was 24.51 N, indicating that the muscle firmness of the TT genotype in Hu sheep is significantly higher than that of the GT and GG genotypes. P <0.001), after screening and retaining breeding stock using this method, the average muscle hardness of the Hu sheep population can be significantly reduced, and a new breed of high-quality meat Hu sheep with low muscle hardness can be quickly cultivated. Attached Figure Description

[0018] Figure 1 Manhattan plot of genome-wide SNP effect distribution of muscle stiffness in Hu sheep in Example 1 of this invention; Figure 2 This is a genome-wide SNP quantile map of muscle hardness in Hu sheep in Example 1 of the present invention; Figure 3 This is a graph showing the statistical analysis results of muscle hardness in Hu sheep of each SNP genotype group in Example 2 of the present invention; wherein, express P <0.001. Detailed Implementation

[0019] To enable those skilled in the art to better understand the present invention, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings of the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of the present invention.

[0020] Unless otherwise defined, all scientific and technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. For clarity, some terms are defined as follows: SNP (single nucleotide polymorphism) is a type of molecular genetic marker proposed in 1996 by Lander, a researcher at the Human Genome Research Center at MIT. It mainly refers to DNA sequence polymorphism caused by variations in a single nucleotide at the genomic level. The polymorphism exhibited by SNP involves only a single base variation, and can manifest as transitions, transversions, insertions, and deletions.

[0021] TPA (Texture Profile Analysis) is a physical property analysis method that objectively evaluates the textural properties of food by simulating oral chewing movements. In this invention, the TPA model is used to determine the hardness characteristics of the longissimus dorsi muscle of Hu sheep.

[0022] GWAS (Genome-Wide Association Study) is a method that screens for genetic variants that are significantly associated with a target trait across the entire genome, providing a basis for marker-assisted selection.

[0023] Acid removal and aging: refers to the process of placing the carcass of livestock and poultry in a low-temperature environment of 0~4℃ for a certain period of time after slaughter, so that the metabolic products such as lactic acid in the muscle are decomposed or excreted, and the muscle undergoes a series of physiological and biochemical changes, thereby improving the tenderness and flavor of the meat.

[0024] Introns are nucleotide sequence segments located between coding regions in eukaryotic genes that are spliced ​​away during post-transcriptional processing. SNP markers located within introns can also be associated with target traits through linkage disequilibrium effects.

[0025] The Hu sheep used in this embodiment of the invention totaled 2233 individuals, all male Hu sheep lambs, belonging to 6 different breeding batches, and sourced from a core Hu sheep breeding farm in Gansu Province. All animal experiments were conducted in accordance with the "Regulations on the Management of Experimental Animals" and relevant national animal welfare regulations, and the slaughter procedures conformed to standardized slaughter operation specifications.

[0026] This invention provides a SNP marker related to muscle rigidity in Hu sheep, the nucleotide sequence of which is shown in SEQ ID NO.1 in Table 1. The polymorphic site of the SNP marker related to muscle rigidity in Hu sheep is located at position 149 from the 5' end of the sequence shown in SEQ ID NO.1, and the polymorphism is G / T. That is, the SNP marker related to muscle rigidity in Hu sheep is located at position 215791399 bp on chromosome 2 of the sheep reference genome ARS-UI_Ramb_v2.0. SPAG16 Genetically, the molecular marker rs425254845 (ARS-UI_Ramb_v2.0 / Chr2: 215791251-215791551 / “G”: rs425254845) is significantly associated with muscle hardness in Hu sheep and can be used for early prediction of muscle hardness and marker-assisted selection breeding in Hu sheep.

[0027] Table 1: Sequence List

[0028] This invention also provides a method for selecting and breeding Hu sheep with low muscle hardness. The method involves detecting the above-mentioned SNPs in the Hu sheep genome, selecting individuals with the genotype GG or GT as breeding sheep for the low muscle hardness Hu sheep breed, and culling individuals with the TT genotype.

[0029] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Furthermore, it should be understood that after reading the teachings of this invention, those skilled in the art can make various alterations or modifications to the invention, and these equivalent forms also fall within the scope defined by the appended claims.

[0030] The following examples use instruments and equipment conventional in the art. Experimental methods in the following examples, unless otherwise specified, are generally performed under standard conditions or as recommended by the manufacturer. All raw materials used in the following examples are conventional commercially available products with specifications in the art, unless otherwise stated.

[0031] In the following embodiments, the method for SNP marker detection in the tested Hu sheep is not particularly limited. Sequencing, single-strand conformation polymorphism polymerase chain reaction (PCR-SSCP), restriction fragment length polymorphism polymerase chain reaction (PCR-RFLP), and time-of-flight mass spectrometry are all techniques that can be used to detect SNPs. Among these, sequencing is the most accurate, flexible, high-throughput, and short-cycle detection technique. Only a pair of primers needs to be designed upstream and downstream of the SNP site to amplify the product, and then sequencing can directly detect the genotype of the SNP site. Therefore, this invention uses sequencing for SNP marker detection. According to some specific examples of this invention, Hu sheep with the trait of low muscle hardness are screened by detecting the aforementioned SNP markers in the tested Hu sheep.

[0032] In the following embodiments, the method for sequencing the PCR amplification products is not particularly limited, as long as the sequence of the fragment containing the SNP marker related to the muscle stiffness of the Hu sheep can be effectively obtained. According to some specific examples of the present invention, at least one method selected from HISEQ2000, SOLiD, 454, and single-molecule sequencing can be used to sequence the PCR amplification products. This allows for high-throughput, rapid, efficient, and accurate sequencing results.

[0033] The present invention will now be described in further detail with reference to the accompanying drawings: Example 1: Obtaining SNP molecular markers related to muscle stiffness in Hu sheep (1) Laboratory animals and their husbandry management This embodiment used 2233 male Hu sheep lambs, belonging to 6 different feeding batches, and raised in individual pens until they reached 180 days of age before slaughter. All lambs were fasted for 16 hours prior to slaughter, and the slaughter procedure was completed according to standardized slaughtering operation specifications.

[0034] (2) Muscle sample collection and stiffness measurement Immediately after carcass processing, the longissimus dorsi muscle tissue was harvested. Visible fat, fascia, and connective tissue were removed, and approximately 500 g of muscle tissue was collected for textural analysis. All muscle samples were aged at 4°C for 24 hours to minimize the potential impact of post-mortem biochemical changes on subsequent textural analysis.

[0035] Texture Profile Analysis (TPA) was performed on chilled fresh lamb samples using a TMS-Pro food physical property analyzer (Food Technology Corporation, USA). Before testing, the aged meat samples were further trimmed and cut into uniform cubes with sides of approximately 1 cm. A disc probe was used with the following parameters: initial probe height from the stage 13 mm, single-unit compression deformation 40% of the sample height, and probe compression, depressurization, and return rates uniformly set to 30 mm / min. Using chilled fresh meat directly for TPA testing effectively avoids additional phenotypic variations introduced during cooking due to heat-induced protein denaturation, moisture loss, and muscle contraction, better reflecting the inherent histological characteristics of the meat. Especially in large-scale genetic breeding studies, where cooking conditions are difficult to standardize completely within a population, using fresh meat helps reduce the interference of non-genetic environmental errors on phenotypic values. Previous studies have shown that the TPA method can be effectively applied to the texture assessment of fresh meat. Three parallel meat samples were taken from each individual for repeated testing, and the average value was used as the result for the corresponding texture trait of that individual.

[0036] Valid phenotypic data from 2233 individuals were obtained. The completeness of the measurement data was checked, and outliers and missing values ​​were removed. The data were standardized to ensure that the values ​​of different textural traits were within a comparable range. Descriptive statistical results of muscle hardness in Hu sheep are shown in Table 2.

[0037] Table 2: Descriptive Statistics of Muscle Hardness in Hu Sheep

[0038] (3) Genomic DNA extraction and library construction Whole blood (4-5 mL) was collected from 2233 individuals using the jugular vein sampling method in EDTA anticoagulant blood collection tubes, transported at low temperature, and stored in the laboratory at -20°C.

[0039] Genomic DNA was extracted from blood samples of Hu sheep using the phenol-chloroform method. DNA integrity was assessed by agarose gel electrophoresis, and DNA concentration and purity were determined using a spectrophotometer. After quality control, a total of 2233 DNA samples met the sequencing requirements.

[0040] A whole-genome resequencing library was constructed from the above DNA samples, and paired-end sequencing (PE150) was performed using the Illumina HiSeq X Ten sequencing platform. Raw sequencing data were obtained after sequencing and used for subsequent sequence alignment, SNP detection, and genome-wide association analysis to screen for genetic variation sites that are significantly associated with the muscle hardness trait of Hu sheep.

[0041] (4) Sequencing data processing and SNP detection Quality control of the raw sequencing data was performed using Trimmomatic software. After filtering out low-quality bases and removing adapter sequences, the resulting high-quality reads were aligned with the sheep reference genome (ARS-UI_Ramb_v2.0) using BWA software. The alignment results were then deduplicated using Picard Tools software. SNP detection was performed using the GATK analysis workflow to obtain variant data files in VCF format.

[0042] (5) Genome-wide association analysis (GWAS) Using batch size as a fixed effect and pre-slaughter live weight and the first three principal components as covariates, a kinship matrix was calculated based on genotype data to eliminate interference from inter-individual kinship. A mixed linear model (MLM) using the rMVP software package was employed for GWAS analysis of each texture trait. The specific calculation model is as follows: y = Xa + Zβ + Wu + e; where y is the vector of observed phenotypic values ​​for the texture trait, X and a correspond to the fixed-effects association matrix and its effect vector, respectively; Z and β are the indicator matrix and effect vector of the SNP marker, respectively; W is the random-effects association matrix, u is the vector of individual random genetic effects, and e is the model residual vector.

[0043] The number of effective independent SNPs for the stiffness trait obtained through linkage disequilibrium pruning was 1,358,161. Bonferroni correction was used to determine the threshold: genome-wide significance threshold: P < 3.68 × 10⁻⁶. -8 Significant threshold for indication: P < 7.36 × 10⁻⁶ -7 .

[0044] (6) GWAS results Eleven SNP loci associated with muscle hardness in Hu sheep were identified on chromosome 2 of the Hu sheep population using GWAS results. Figure 1 and Figure 2 Of these, two loci reached genome-wide significance, and nine loci reached suggestive significance. Detailed information on SNP (rs425254845) is as follows (Table 3): Table 3: SNP Information

[0045] Example 2: Detection of the effect of SNP tagging The genotyping results of SNP (rs425254845) in 1610 individuals were extracted using VCFtools software, and the association between different genotypes of this SNP and muscle stiffness was performed using a one-way ANOVA multiple comparison model in Graphpad Prism software (Table 4).

[0046] Table 4: Correlation between SNP and muscle stiffness

[0047] The above results indicate that SNP (rs425254845) significantly affected the muscle stiffness of Hu sheep, with the GG and GT types showing significantly lower muscle stiffness than the TT type (P<0.001) (see...). Figure 3 In breeding practice, GG or GT type individuals can be selected as breeding stock with low muscle hardness.

[0048] Example 3: Breeding Hu sheep with low muscle hardness using SNP markers associated with muscle hardness in Hu sheep This embodiment provides a method for breeding Hu sheep with low muscle stiffness using the SNP (rs425254845) molecular marker. The specific steps are as follows: (1) Primer design and PCR amplification Based on the nucleotide sequences flanking the SNP (rs425254845) molecular marker (as shown in SEQ ID NO.1), specific amplification primers were designed using Primer Premier 5.0 software. The primer sequences are as follows: Upstream primer (F): AAACTCCAGGGGTTGGTGAT (as shown in SEQ ID NO.2) Downstream primer (R): GGTAGGTTATTTCAGCAGGG (as shown in SEQ ID NO.3) The amplification product of the primer pair should contain the SNP site at position 149 from the 5' end of the sequence shown in SEQ ID NO.1.

[0049] (2) Collection of sheep samples and DNA extraction After birth, blood (approximately 2 mL in an EDTA anticoagulant tube) or ear tissue (approximately 0.1 g) was collected from the sheep. Genomic DNA was extracted from the sheep using the standard phenol-chloroform extraction method or a commercially available genomic DNA extraction kit. The integrity of the extracted DNA was assessed by 1% agarose gel electrophoresis, and its purity and concentration (OD) were determined using a UV spectrophotometer. 260 / OD 280 (Between 1.8 and 2.0). The extracted genomic DNA was stored at -20°C for later use.

[0050] (3) PCR amplification Using the extracted genomic DNA of the target sheep as a template, PCR amplification was performed using the primer pairs described above. PCR reaction system: The PCR amplification procedure is as follows: PCR amplification is performed using the genomic DNA of the sheep to be tested as a template.

[0051] PCR reaction system (20 μL): 10 μL 2×PCR Master Mix; 0.5 μL upstream primer; 0.5 μL downstream primer; 1 μL DNA template; ddH2O to 20 μL.

[0052] PCR reaction program: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s; 58℃ annealing for 30 s; 72℃ extension for 30 s; 35 cycles; 72℃ final extension for 5 min.

[0053] The PCR amplification products were detected by 1.5% agarose gel electrophoresis. After confirming that the amplified fragments were of the correct size and free of impurities, the products were purified and recovered for later use.

[0054] (4) Genotype detection and determination Genotyping of PCR amplification products was performed using sequencing. The purified PCR amplification products were sent to a professional sequencing company for sequencing using HISEQ2000, SOLiD, 454, or single-molecule sequencing methods. The sequencing results were compared with the sequence shown in SEQ ID NO.1 to determine the genotype of the target Hu sheep at position 149 (5' end) of the sequence shown in SEQ ID NO.1. Genotype was determined based on the peak diagram of the sequencing results. If the locus is G homozygous (i.e., the sequencing peak is a single G peak), it is determined to be the GG genotype; if the locus is T homozygous (i.e., the sequencing peak is a single T peak), it is determined to be the TT genotype; if the locus is G and T heterozygous (i.e., the sequencing peak is a double G and T peak), it is determined to be the GT genotype.

[0055] (5) Breeding of low muscle hardness Hu sheep Based on the above genotype testing results, Hu sheep individuals with genotypes GG or GT were selected as breeding stock for the low muscle hardness Hu sheep breed, while individuals with the TT genotype were culled. The specific selection criteria are as follows: GG genotype individuals: muscle rigidity was significantly lower than that of TT genotype individuals (P<0.001), and they were selected as core breeding sheep for priority retention; GT genotype individuals: muscle hardness was also significantly lower than that of TT genotype individuals (P<0.001), and they can be selected as breeding sheep; Individuals with the TT genotype have significantly higher muscle hardness than those with the GG and GT genotypes and are not recommended for breeding.

[0056] Using the above methods, genotyping can be performed on live Hu sheep (young age) using blood, ear tissue, or hair follicle samples to predict their genetic potential for muscle hardness. This enables early selection of low-hardness, high-quality meat Hu sheep, significantly improving the breeding efficiency of muscle hardness traits in Hu sheep and achieving selective breeding of Hu sheep with strong muscle hardness traits.

[0057] (5) Verification of application effect The above methods were used to conduct genotyping and selective breeding verification on Hu sheep lambs. The results showed that the average muscle hardness of the selected GG and GT genotype individuals after slaughter at 180 days of age was significantly lower than that of the TT genotype individuals culled at the same time. P <0.01). This indicates that using the SNP markers described in this invention for breeding can effectively screen out Hu sheep individuals with low muscle hardness, significantly improving the quality of Hu sheep meat.

[0058] The above content is only for illustrating the technical concept of the present invention and should not be construed as limiting the scope of protection of the present invention. Any modifications made to the technical solution based on the technical concept proposed in this invention shall fall within the scope of protection of the claims of this invention.

Claims

1. The application of a reagent for detecting SNP molecular markers related to muscle hardness in Hu sheep breeding, characterized in that, The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.

1. The 149th base from the 5' end of the sequence shown in SEQ ID NO.1 is the SNP site. The SNP site is located at nucleotide 215791399 on chromosome 2 of the sheep reference genome ARS-UI_Ramb_v2.

0. The SNP site is G or T, and the muscle rigidity of Hu sheep individuals with the GG and GT genotypes is significantly lower than that of Hu sheep individuals with the TT genotype.

2. The application of reagents for detecting SNP molecular markers related to muscle stiffness in Hu sheep in the prediction of muscle stiffness traits in Hu sheep, characterized in that, The nucleotide sequence of the SNP marker is shown in SEQ ID NO.

1. The 149th base from the 5' end of the sequence shown in SEQ ID NO.1 is the SNP site. The SNP site is located at nucleotide 215791399 on chromosome 2 of the sheep reference genome ARS-UI_Ramb_v2.

0. The SNP site is G or T, and the muscle rigidity of Hu sheep individuals with the GG and GT genotypes is significantly lower than that of Hu sheep individuals with the TT genotype.

3. The application of reagents for detecting SNP markers related to muscle hardness in Hu sheep in the preparation of reagents for predicting the muscle hardness trait of Hu sheep, characterized in that, The nucleotide sequence of the SNP marker is shown in SEQ ID NO.

1. The 149th base from the 5' end of the sequence shown in SEQ ID NO.1 is the SNP site. The SNP site is located at nucleotide 215791399 on chromosome 2 of the sheep reference genome ARS-UI_Ramb_v2.

0. The SNP site is G or T, and the muscle rigidity of Hu sheep individuals with the GG and GT genotypes is significantly lower than that of Hu sheep individuals with the TT genotype.

4. The application of reagents for detecting SNP markers related to muscle stiffness in Hu sheep in the preparation of kits for screening or identifying Hu sheep breeds with low muscle stiffness, characterized in that... The nucleotide sequence of the SNP marker is shown in SEQ ID NO.

1. The 149th base from the 5' end of the sequence shown in SEQ ID NO.1 is the SNP site. The SNP site is located at nucleotide 215791399 on chromosome 2 of the sheep reference genome ARS-UI_Ramb_v2.

0. The SNP site is G or T, and the muscle rigidity of Hu sheep individuals with the GG and GT genotypes is significantly lower than that of Hu sheep individuals with the TT genotype.

5. The application of primers for detecting SNP markers related to muscle stiffness in Hu sheep in the preparation of a detection kit, characterized in that, The nucleotide sequence of the SNP marker is shown in SEQ ID NO.

1. The 149th base from the 5' end of the sequence shown in SEQ ID NO.1 is the SNP site. The SNP site is located at nucleotide 215791399 on chromosome 2 of the sheep reference genome ARS-UI_Ramb_v2.

0. The SNP site is G or T, and the muscle rigidity of Hu sheep individuals with the GG and GT genotypes is significantly lower than that of Hu sheep individuals with the TT genotype.

6. A method for breeding Hu sheep, characterized in that, include: Primers were designed based on the nucleotide sequences flanking the SNP marker. Blood or tissue was collected from the Hu sheep to be tested after birth, and genomic DNA was extracted. Primers were used to perform genotyping on the Hu sheep to be tested to determine their genotype. Individuals with the G allele are selected, and the breeding trait is muscle hardness; The nucleotide sequence of the SNP marker is shown in SEQ ID NO.

1. The 149th base from the 5' end of the sequence shown in SEQ ID NO.1 is the SNP site. The SNP site is located at nucleotide 215791399 on chromosome 2 of the sheep reference genome ARS-UI_Ramb_v2.

0. The SNP site is G or T, and the muscle rigidity of Hu sheep individuals with the GG and GT genotypes is significantly lower than that of Hu sheep individuals with the TT genotype.

7. The method for breeding Hu sheep according to claim 6, characterized in that, Genomic DNA was extracted from the sheep to be tested and amplified by PCR. The PCR amplification products were then sequenced using HISEQ2000, SOLiD, 454 or single-molecule sequencing methods. The genotype of the SNP marker in the sheep to be tested was determined based on the sequencing results, and the muscle hardness trait of the sheep was predicted.

8. The method for breeding Hu sheep according to claim 6, characterized in that, The muscle rigidity of Hu sheep individuals with the GG and GT genotypes at the SNP marker sites was significantly lower than that of Hu sheep individuals with the TT genotype.

9. A method for screening Hu sheep with low muscle stiffness, characterized in that, SNP markers associated with muscle hardness in Hu sheep were detected. Hu sheep individuals with genotypes GG or GT were selected as breeding stock for the low muscle hardness Hu sheep strain, while Hu sheep individuals with the TT genotype were culled. The sequence of the SNP marker is shown in SEQ ID NO.1, and the 149th base from the 5' end of the sequence shown in SEQ ID NO.1 is G or T.

10. The method according to claim 9, characterized in that, The SNP marker is located at nucleotide 215791399 on chromosome 2 of the sheep reference genome ARS-UI_Ramb_v2.0.

Images