A snp molecular marker related to eggshell color of jianghan chicken green shell eggs and application thereof

Abstract

The application provides a SNP molecular marker related to eggshell color of Jianghan chicken green shell eggs and application, and belongs to the technical field of molecular biology and breeding. The SNP molecular marker is located at the 65373799th nucleotide of the first chromosome of the international chicken reference genome GRCg6a Primary Assembly version, has C / G polymorphism, and the eggshell of an individual with the SNP molecular marker of GG genotype is darker green. The application further provides a primer combination for detecting the above-mentioned SNP marker and application thereof. By using the SNP molecular marker and the primer combination, a high-efficiency and accurate molecular marker-assisted breeding technology for eggshell color of green shell eggs can be established and used for early selection, so that the population eggshell color is effectively improved, and the economic benefits of breeding are increased.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology and breeding technology, specifically relating to a SNP molecular marker related to the eggshell color of Jianghan chicken green-shelled eggs and its application. Background Technology

[0002] Jianghan chicken is a superior local chicken breed distributed in the Jianghan Plain, characterized by its strong adaptability, tolerance to roughage, and delicious meat. The green-shelled eggs produced by some individuals in this breed are valuable material for breeding high-yield, high-quality green-shelled egg-laying chicken lines. Eggshell color is not only an important visual indicator of breed characteristics but also a key trait directly affecting the market grading and economic value of commercial eggs. Research shows that the eggshell color of green-shelled eggs is mainly formed by the deposition of biliverdin secreted by the shell gland, and its inheritance is controlled by a single major gene on an autosome. Specifically, the promoter region of the SLCO1B3 gene contains an endogenous retrovirus (EAV-HP) insertion sequence. This insertion sequence regulates the ectopic expression of the gene in the shell gland tissue and is the key molecular basis for determining the green-shell trait. Currently, domestic and international researchers have developed molecular markers for identifying the green-shell trait based on this insertion sequence.

[0003] However, existing technologies still have the following limitations in the identification and breeding applications of green-shelled eggs from Jianghan chickens: First, the distinguishing ability of existing molecular markers is limited. Most known molecular markers are limited to qualitative detection of whether a chicken carries the green-shell gene, meaning they can only distinguish between green-shelled and non-green-shelled chickens, but cannot effectively distinguish or quantify the intensity of the green shell color. In actual breeding, the shell color of green eggs exhibits continuous variation from light green to dark green, and the intensity of shell color directly affects consumer preference and the premium pricing power of commercial eggs. Existing markers cannot meet the breeding needs for fine-grained selection of this quantitative trait. Second, existing markers have poor cross-population applicability. Molecular markers related to the green shell trait may show significant differences in linkage disequilibrium among different breeds or geographical populations. Directly applying universal markers developed in other breeds or populations to genotype identification in Jianghan chicken populations can easily lead to problems such as poor genotype-phenotype correspondence and low prediction accuracy, resulting in decreased efficiency of marker-assisted selection and even the risk of misselection. Third, there is a lack of SNP markers directly associated with variations in the depth of green-shelled eggs in Jianghan chickens. To date, there are no reports of SNP molecular markers related to the depth of green-shelled egg color in Jianghan chickens. Due to the lack of specific markers targeting sites of shell color variation, breeders find it difficult to conduct early and precise selection in chicks or embryos. They can only rely on phenotypic observation after hens begin laying eggs for breeding purposes. This not only prolongs the breeding cycle and increases feeding and manual testing costs, but also limits the genetic improvement process for the uniformity of green-shelled egg color in Jianghan chickens.

[0004] Therefore, there is an urgent need to develop an SNP molecular marker that can be stably associated with the depth of the green shell color of Jianghan chicken eggs and is applicable to the early selection of this population. This would overcome the technical difficulties of insufficient marker discrimination, poor population applicability, and inability to screen early in the existing technology, thereby providing a more accurate and efficient technical means for the genetic improvement of the green shell color of Jianghan chicken eggs. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention provides an SNP molecular marker related to the eggshell color of Jianghan chicken green-shelled eggs and its application.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] A SNP molecular marker associated with the eggshell color of green-shelled eggs from Jianghan chickens is located at base 65373799 on chromosome 1 of the international chicken reference genome GRCg6a Primary Assembly version. The base at position 65373799 is either C or G, and this mutation leads to polymorphism.

[0008] This invention, based on 462 Jianghan chickens (producing green-shelled eggs), measured and recorded eggshell color (expressed using the L, a, b chromaticity system, with a smaller a value indicating a greener color). GWAS analysis was performed using SNP genotyping data obtained from whole-genome sequencing. Further analysis of the GWAS results identified a significant association between nucleotide position 65373799 on chromosome 1 and the eggshell color a value. The results showed that the polymorphism at this SNP site was C / G, and the GG genotype had a smaller a value and a deeper green color, significantly superior to individuals with the CG and CC genotypes.

[0009] Preferring the GG genotype during breeding can significantly improve the eggshell color of green-shelled eggs from Jianghan chickens.

[0010] Preferably, the nucleotide sequence containing the above-mentioned SNP molecular marker is as shown in SEQ ID NO.3, where the 94th base Y in the sequence is the SNP molecular marker site, and Y represents C or G.

[0011] Furthermore, the SNP molecular marker has a nucleotide sequence that is a fragment containing the 94th base in the nucleotide sequence shown in SEQ ID NO.3. By detecting the base site of the specific fragment, the genotype of an individual chicken can be distinguished.

[0012] This invention provides specific primers for the specific amplification of molecular markers described above. In one embodiment of this invention, the specific primers comprise an upstream primer having the nucleotide sequence shown in SEQ ID NO.1 and a downstream primer having the nucleotide sequence shown in SEQ ID NO.2.

[0013] Furthermore, the present invention provides a detection reagent or a kit containing the aforementioned detection reagent for detecting the molecular marker. Preferably, it comprises the specific primers described above.

[0014] Furthermore, this invention also provides the application of the aforementioned molecular markers, specific primers, or detection reagents or kits in identifying eggshell color or in chicken assisted breeding. In identification or assisted breeding, the molecular marker locus genotype GG is selected as the dominant genotype.

[0015] The present invention also provides a method for detecting SNP molecular markers related to the eggshell color of Jianghan chicken green-shelled eggs as described above, which includes the following steps:

[0016] (1) Obtain the genomic DNA of each individual of the chicken breed or strain to be tested;

[0017] (2) Detect the genotype of SNP molecular markers in the genomic DNA;

[0018] (3) Select individuals with the GG genotype and eliminate individuals with the CG and CC genotypes.

[0019] In the method described above, preferably, in step (1), the chicken's genomic DNA is DNA extracted from wing vein blood.

[0020] As described above, preferably, in step (2), the identification method employs PCR amplification, and the amplification product is sequenced and genotyped.

[0021] The SNP molecular markers described above are used in eggshell color marker-assisted selection.

[0022] As described above, preferably, the eggshell color is mainly used in the selection of green-shelled eggs from Jianghan chickens.

[0023] The application of the SNP molecular markers, primer sets, kits, or methods described above in chicken breeding.

[0024] Preferably, the breeding involves screening for individuals with a deeper green shell color.

[0025] Chickens with the SNP molecular marker GG genotype were selected as breeders, as they possess the advantageous trait of improving eggshell color.

[0026] The beneficial effects of this invention are as follows:

[0027] The SNP molecular marker related to eggshell color provided by this invention significantly affects the eggshell color of green-shelled eggs from Jianghan chickens. Determining the genotype of this polymorphism can effectively identify individuals with deep green shells, providing a detection technique for early selection and improving breeding efficiency. This invention also provides a reliable molecular marker for the selection and improvement of eggshell color traits in Jianghan chickens, which is of great significance for its genetic improvement.

[0028] This invention, through the detection of this SNP molecular site, can be used to select GG genotype breeders to improve eggshell color and help improve the economic benefits of breeding. Attached Figure Description

[0029] Figure 1 This is a Manhattan plot of the GWAS results for the eggshell color a value in Embodiment 1 of the present invention;

[0030] Figure 2 The phenotypic values ​​of individuals with different genotypes of the SNP in Example 1 of this invention;

[0031] Figure 3 This is a diagram showing the results of different genotypes determined by the primer pairs designed in Example 2 of this invention. Detailed Implementation

[0032] This invention, based on the applicant team's own Jianghan chicken population (producing green-shelled eggs), measures and records eggshell color. Using SNP genotyping data obtained from whole-genome sequencing, a genome-wide association study (GWAS) of eggshell color traits is conducted. Further analysis of the GWAS results identifies a SNP molecular marker significantly associated with the 'a' value of eggshell color. This SNP molecular marker can be used for marker-assisted selection of eggshell color indicators, enabling early selection and improving breeding efficiency. This invention provides a reliable molecular marker detection method for the genetic improvement of eggshell color traits.

[0033] The following embodiments are used to further illustrate the present invention, but should not be construed as limiting the present invention. Any modifications or substitutions made to the present invention without departing from its spirit and essence are within the scope of the present invention.

[0034] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, all reagents used in this invention are of analytical grade or higher.

[0035] Example 1: Obtaining SNP sites affecting eggshell color

[0036] 1. Test materials

[0037] Using 462 local Jianghan chickens as the research subjects, the phenotypic data of green-shelled eggs of all individuals were measured, and genomic DNA was extracted from wing vein blood.

[0038] 2. Test methods

[0039] 2.1 DNA Extraction

[0040] DNA extraction can be performed using the commonly used phenol-chloroform crude extraction method (for the phenol-chloroform crude extraction method, see Sambrook J, Fritsch EF, Maniattis T. Molecular Cloning: A Laboratory Manual [M]. 2nd ed. Jin Dongyan, Li Mengfeng. Beijing: Science Press, 1999. 465-467) or other recognized extraction methods with the same efficacy. These methods are commonly reported.

[0041] 2.2 Chicken whole-genome SNP genotyping method based on whole-genome sequencing

[0042] Whole-genome sequencing was performed on 462 individuals at a depth of 10×. Following read alignment, sorting, marker duplication, base quality recorrection, and variant detection, 20.78 million SNP loci were initially identified. Using Plink software, individual deletion rates, SNP deletion rates, and minimum allele frequency (MAF) were calculated, and quality control standards were established, ultimately yielding 8.72 million high-quality SNP markers.

[0043] 2.3 Genome-wide association analysis

[0044] A GWAS analysis of eggshell color a-value was performed using a mixed linear model based on GEMMA software. The analysis model is as follows:

[0045] y = Wa + Xb + u + e

[0046] Where y represents the phenotypic value matrix; W represents the covariance matrix; a represents the vector of corresponding coefficients including the intercept; X represents the SNP genotype vector; b represents the effect size of the SNP; u represents the random effect; and e represents the error effect.

[0047] GWAS results as follows Figure 1 As shown, the SNPs significantly associated with eggshell color a value are concentrated on chromosome 4. Further analysis of the significantly associated SNPs revealed that the most significant association was at SNP (1: 65373799) (C / G), specifically at base position 65373799 on chromosome 1 of the international chicken reference genome GRCg6a Primary Assembly version (P = 1.47 × 10⁻⁶). -10Of the total sample size of 462, 443 were identified as GG, 18 as CG, and 1 as CC. Specific results are shown in Table 1. The results indicate that the polymorphism at this SNP locus is C / G, and the eggshell color a-value of individuals with the GG genotype is significantly higher than that of individuals with the CG genotype. (See Table 1 for details.) Figure 2 The GG genotype can be used as a breeding selection criterion. This polymorphic locus can be used for marker-assisted selection of eggshell color, enabling early selection and improving breeding efficiency. It provides a reliable basis for the genetic improvement of eggshell color traits.

[0048] Table 1. Comparison of eggshell color phenotypic values ​​of green-shelled eggs from different genotypes of Jianghan chickens.

[0049]

[0050] The values ​​in the table are "mean ± standard deviation". Different lowercase letters in the same row indicate significant differences (P < 0.05), and the same letter indicates no significant differences.

[0051] Example 2 Genotyping Identification

[0052] 1. Detection primer design

[0053] For the C / G nucleotide site at position 65373799 of chromosome 1 obtained in Example 1, a primer combination was designed to detect this SNP site for PCR detection. The upstream and downstream primers are shown in SEQ ID NO. 1 and SEQ ID NO. 2, respectively. The amplified product sequence is shown in SEQ ID NO. 3, where the 94th base Y in this sequence is the SNP site, where Y represents C or G, resulting in the C / G polymorphism of the eggshell color a value at this site.

[0054] Specifically as follows:

[0055] SEQ ID NO. 1: 5'-TAATGGGTAGCCTAATCC-3'

[0056] SEQ ID NO. 2: 5'-TTATGGTGTCCTCCTGCT-3'

[0057] SEQ ID NO. 3: TAATGGGTAGCCTAATCCTAAGAACAACAATTTGACAGAATCACAGTTTATGAGGTGATCCGAACTGAGAATGTTGTCATTGCTTCTACCAGTYGGTCTCAAAAGTCACCTAGTGTGAGGGCATAAAAGGAA CTTGGACTCATGTGGTGTAGGTCTAGGAGTATTTAGGCAGAAAGCCCTTTCAGCTAGAGGGTTGGTGACCTGACTGCATAAAAAAAGTAGATTCTCAGATTTGAAGAAACCATGAGGAGCAGGAGGACACCATAA

[0058] 2. DNA template

[0059] Based on the whole-genome DNA sequencing results, genomic DNA from individuals with SNP sites of GG, CG, and CC genotypes was selected as templates.

[0060] 3. PCR amplification of the target fragment

[0061] The PCR reaction mixture (20 μL) consisted of: 0.1 µL r-Taq, 2 µL 10×Buffer, 1.6 µL dNTP Mix, 1.0 µL each of two forward and reverse primers (10 µmol / L), 2.0 µL DNA template (50 ng / µL), and 12.3 µL ddH2O. The PCR program was as follows: 95 °C pre-denaturation for 3 min, 95 °C denaturation for 30 s, annealing at 53 °C for 30 s, and extension at 72 °C for 30 s, for a total of 35 cycles; followed by 72 °C for 5 min and storage at 4 °C.

[0062] 4. Sequence sequencing and identification

[0063] The PCR amplification products were subjected to Sanger sequencing at Aoke (Wuhan) Biotechnology Co., Ltd., with gene fragments undergoing both forward and reverse sequencing. The obtained sequences were compared with the chicken reference genome GRCg6a Primary Assembly to identify corresponding SNP marker mutations, such as... Figure 3 As shown.

Claims

1. A SNP molecular marker associated with the eggshell color of green-shelled eggs of Jianghan chicken, located at position 65373799 on chromosome 1 of the international chicken reference genome GRCg6a Primary Assembly version, with a base of C or G at this site, and the mutation leading to polymorphism.

2. The SNP molecular marker as described in claim 1, characterized in that, The nucleotide sequence containing the SNP molecular marker is shown in SEQ ID NO.3, and a C / G polymorphism occurs at the 94th base of the sequence.

3. The SNP molecular marker as described in claim 1 or 2, characterized in that, The nucleotide fragment containing the SNP molecular marker is any consecutive nucleotide fragment containing the 94th base in the sequence shown in SEQ ID NO.

3.

4. A specific primer pair for amplifying the SNP molecular marker according to any one of claims 1 to 3, comprising an upstream primer having the nucleotide sequence shown in SEQ ID NO. 1 and a downstream primer having the nucleotide sequence shown in SEQ ID NO.

2.

5. A detection reagent for detecting the SNP molecular marker according to any one of claims 1 to 3, comprising the specific primer pair according to claim 4.

6. A kit for detecting the SNP molecular marker according to any one of claims 1 to 3, comprising the specific primer pair according to claim 4 and / or the detection reagent according to claim 5.

7. The use of the specific primer pair of claim 4, the detection reagent of claim 5, or the kit of claim 6 in the preparation of reagents or tools for identifying the eggshell color trait of Jianghan chicken green-shelled eggs.

8. The application as described in claim 7, characterized in that, The eggshell color trait of Jianghan chicken green-shelled eggs is identified by detecting the genotype of the SNP molecular markers described in any one of claims 1 to 3.

9. A method for breeding and improving the shell color of green-shelled eggs from Jianghan chickens, characterized in that, Includes the following steps: (1) Obtain the genomic DNA of the Jianghan chicken individual to be tested; (2) Detect the genotype of the SNP molecular marker of any one of claims 1 to 3 in the genomic DNA using the specific primer pair of claim 4, the detection reagent of claim 5, or the kit of claim 6; (3) Select individuals with the GG genotype as breeding parents and eliminate individuals with the CC and CG genotypes.

10. The breeding method as described in claim 9, characterized in that, The GG genotype is a dominant genotype associated with the green-shelled egg color of Jianghan chickens. The breeding method described above can significantly improve the proportion of green-shelled eggs and the stability of eggshell color in offspring.

Images