KASP molecular marker combination for detecting the growth potential of pseudogramma polyommata and application thereof

Abstract

The present application belongs to the technical field of molecular marker assisted breeding of aquatic animals, and particularly relates to a KASP molecular marker combination for detecting the growth potential of Nibea albipunctata and application thereof. The present application provides seven SNP sites related to the growth potential of Nibea albipunctata, which are located at 8182577, 8188565, 8233233, 8260773, 8357951, 8404380 and 8411633 sites of Nibea albipunctata reference genome chr05B, and the base polymorphism types thereof are A / G, A / G, G / A, G / A, G / A, A / G and T / G respectively; the corresponding superior growth genotypes of the seven sites are AA, AA, GG, GG, GG, AA and TT in turn. When the to-be-detected individual simultaneously has the superior growth genotypes of the seven sites, it is determined as a superior growth individual. The present application can be used for detecting the growth potential of Nibea albipunctata and molecular marker assisted breeding.

Description

Technical Field

[0001] This invention belongs to the field of molecular marker-assisted breeding technology for aquatic animals, specifically involving a combination of KASP molecular markers for detecting the growth potential of the yellow-banded trevally and its application. Background Technology

[0002] Yellow-banded jackduck ( Pseudocaranx dentex The yellow-banded trevally (also known as the yellowtail amberjack) is a marine economic fish with high nutritional and economic value. However, in actual aquaculture production, its growth rate is uneven, and there are significant differences between individuals. Traditional phenotypic selection and family selection methods have long breeding cycles, low efficiency, and are easily affected by factors such as the aquaculture environment, stocking density, and batch differences, making it difficult to achieve efficient screening in the early stages. Although modern molecular breeding technologies, represented by whole-genome selection breeding, can significantly improve the accuracy and efficiency of selection, they rely on large-scale sequencing for genotyping, resulting in high costs. In contrast, KASP technology has advantages such as low cost, high throughput, ease of operation, and high accuracy, and is particularly suitable for rapidly converting a few core loci into molecular detection tools that can be directly applied by enterprises. Therefore, developing KASP molecular marker combinations that are stably associated with growth traits such as body weight in the yellowtail amberjack and are easy to detect on a large scale at low cost, and establishing clear judgment rules, is of great significance for improving the breeding efficiency of the yellowtail amberjack. Summary of the Invention

[0003] The purpose of this invention is to provide a combination of KASP molecular markers, screening methods, detection primers, and kits for detecting the growth potential of *Pteranodon yellowii*, in order to solve the problem of the lack of low-cost, practical, and mass-producible molecular detection tools for the growth traits of *Pteranodon yellowii*.

[0004] The technical solution of the present invention is as follows:

[0005] In a first aspect, this invention provides a KASP molecular marker combination for detecting the growth potential of *Pteranodon yelnodon*, comprising seven SNP loci significantly associated with the body weight trait of *Pteranodon yelnodon*, namely BW_KASP1, BW_KASP2, BW_KASP3, BW_KASP4, BW_KASP5, BW_KASP6, and BW_KASP7, located on chromosome 5 of *Pteranodon yelnodon* at chr5B:8182577, chr5B:8188565, chr5B:8188565, chr5B:8188565, chr5B:818257 ...2577, chr5B:8182577, chr5B:8182577, chr5B:8182577, chr5B:8182577, chr5B:8182577, chr5 The r5B loci (8233233, chr5B, 8260773, chr5B, 8357951, chr5B, 8404380, and chr5B, 8411633, reference genome of *Pterygium spp.*: https: / / doi.org / 10.6084 / m9.figshare.32825537) have base polymorphisms of A / G, A / G, G / A, G / A, G / A, A / G, and T / G, respectively. The dominant genotypes for these seven SNP loci are AA, AA, GG, GG, GG, AA, and TT, respectively. When all seven SNP loci of an individual tested are dominant genotypes, it indicates that the individual is of superior growth potential.

[0006] Secondly, this invention provides the application of the KASP molecular marker combination in the preparation of products for detecting the growth potential of yellow-banded trevally and for molecular marker-assisted breeding.

[0007] Thirdly, the present invention provides a method for screening superior growth candidate individuals of the yellow-banded trevally using the KASP molecular marker combination, comprising the following steps: extracting DNA from the individual to be tested, performing KASP genotyping on the 7 SNP loci, and determining the genotype of each locus; when the genotypes of the 7 SNP loci are AA, AA, GG, GG, GG, AA and TT in sequence, the individual to be tested is determined to be a superior growth candidate individual.

[0008] Fourthly, the present invention provides detection primers and kits for the KASP molecular marker combination and their applications. The kit includes detection primers for the KASP molecular marker combination, KASP reaction solution, and genotyping result interpretation reagents. Each KASP molecular marker includes two allele-specific primers (Fam and Hex) and one universal primer (Common). The detection primers or the kit can be used to prepare products for detecting the growth potential of *Pteranodon yellowii* and for molecular marker-assisted breeding.

[0009] The nucleotide sequences of the detection primers for the KASP molecular marker combination are as follows:

[0010] The primer nucleotide sequences labeled BW_KASP1 are as follows:

[0011] Specific primer Fam:

[0012] 5'-GAAGGTGACCAAGTTCATGCTAACTTCTGTCTGGCATTAAAAATGA-3', as shown in SEQ ID NO: 1;

[0013] Specific primer Hex:

[0014] 5'-GAAGGTCGGAGTCAACGGATTAACTTCTGTCTGGCATTAAAAATGG-3', as shown in SEQ ID NO: 2;

[0015] The universal primer is 5'-AGCTGTTGTCTGGAGCACTGTTGAT-3', as shown in SEQ ID NO: 3;

[0016] The primer nucleotide sequences labeled BW_KASP2 are as follows:

[0017] Specific primer Fam:

[0018] 5'-GAAGGTGACCAAGTTCATGCTGGCGTGGTGGTGGTGAACCCTT-3', as shown in SEQ ID NO: 4;

[0019] Specific primer Hex:

[0020] 5'-GAAGGTCGGAGTCAACGGATTGGCGTGGTGGTGGTGAACCCTC-3', as shown in SEQ ID NO: 5;

[0021] Common primer: 5'-TACCTTGGTGTATGAGGCATTGAGG-3', as shown in SEQ ID NO: 6;

[0022] The primer nucleotide sequences labeled BW_KASP3 are as follows:

[0023] Specific primer Fam:

[0024] 5'-GAAGGTGACCAAGTTCATGCTCTGTAAGATCTGAAATGGCCACATG-3', as shown in SEQ ID NO: 7;

[0025] Specific primer Hex:

[0026] 5'-GAAGGTCGGAGTCAACGGATTCTGTAAGATCTGAAATGGCCACATA-3', as shown in SEQ ID NO: 8;

[0027] Common primer: 5'-CATGTTATCTGAAGGTGATGTAACG-3', as shown in SEQ ID NO: 9;

[0028] The primer nucleotide sequences labeled BW_KASP4 are as follows:

[0029] Specific primer Fam:

[0030] 5'-GAAGGTGACCAAGTTCATGCTGGAGCTTCTTCTTGCACCAGATGC-3', as shown in SEQ ID NO: 10;

[0031] Specific primer Hex:

[0032] 5'-GAAGGTCGGAGTCAACGGATTGGAGCTTCTTCTTGCACCAGATGT-3', as shown in SEQ ID NO: 11;

[0033] Common primer: 5'-CCTTTCCCACCTACCAACAGAGAAA-3', as shown in SEQ ID NO: 12;

[0034] The primer nucleotide sequences labeled BW_KASP5 are as follows:

[0035] Specific primer Fam:

[0036] 5'-GAAGGTGACCAAGTTCATGCTCACATAAAGTGAAGACTGAAAAGCG-3', as shown in SEQ ID NO: 13;

[0037] Specific primer Hex:

[0038] 5'-GAAGGTCGGAGTCAACGGATTCACATAAAGTGAAGACTGAAAAGCA-3', as shown in SEQ ID NO: 14;

[0039] Common primer: 5'-CTAACTCACCACACTCCCTGATGC-3', as shown in SEQ ID NO: 15;

[0040] The primer nucleotide sequences labeled BW_KASP6 are as follows:

[0041] Specific primer Fam:

[0042] 5'-GAAGGTGACCAAGTTCATGCTGATGTCACTTTATTTAAGTAGGTAT-3', as shown in SEQ ID NO: 16;

[0043] Specific primer Hex:

[0044] 5'-GAAGGTCGGAGTCAACGGATTGATGTCACTTTATTTAAGTAGGTAC-3', as shown in SEQ ID NO: 17;

[0045] Common primer: 5'-TTGTCCAAGCTTTGTTTAACATGCA-3', as shown in SEQ ID NO: 18;

[0046] The primer nucleotide sequences labeled BW_KASP7 are as follows:

[0047] Specific primer Fam:

[0048] 5'-GAAGGTGACCAAGTTCATGCTGGAGGGATGGAGGGAGAAAACATT-3', as shown in SEQ ID NO: 19;

[0049] Specific primer Hex:

[0050] 5'-GAAGGTCGGAGTCAACGGATTGGAGGGATGGAGGGAGAAAACATG-3', as shown in SEQ ID NO: 20;

[0051] The universal primer is 5'-GCTGCCAAACTTCTCACAACACTCT-3', as shown in SEQ ID NO: 21.

[0052] The present invention develops a KASP molecular marker combination and kit for detecting the growth potential of *Pteranodon yellowii*, comprising the following steps:

[0053] (1) Measure growth indicators such as body weight of yellow-banded trevally (age > 6 months, number > 600) from the same breeding population, or measure initial body weight and final body weight separately, calculate growth rate indicators such as average daily weight gain in combination with the breeding time, and collect fin samples.

[0054] (2) Extract DNA from fin samples and perform library construction, sequencing (sequencing depth reaches 15× or more) and genotyping to obtain high-quality SNP genotypes; fit the weight phenotype and genotype in a linear mixed model to perform genome-wide association analysis, screen for significant SNP markers associated with weight traits, and determine the optimal growth genotype;

[0055] (3) Extract 200bp flanking sequences from each of the significant SNP markers associated with the above weight trait, and design two specific primers (Fam and Hex) and one universal primer (Common). Attach fluorescent adapter sequences to the 5' ends of the two specific primers. GAAGGTGACCAAGTTCATGCT is the FAM fluorescent adapter sequence, as shown in SEQ ID NO: 22, and GAAGGTCGGAGTCAACGGATT is the HEX fluorescent adapter sequence, as shown in SEQ ID NO: 23. Extract DNA from the sample to be tested and perform PCR amplification. The PCR reaction system includes 0.0012μL of specific primer Fam (concentration 0.15μM), 0.0012μL of specific primer Hex (concentration 0.15μM), 0.0030μL of universal primer Common (concentration 0.375μM), 0.40μL of 2×KASP Master Mix, 15ng of sample DNA (dry powder), and add ultrapure water to 0.80μL. The PCR reaction program was as follows: 94℃ for 15 min, 1 cycle; 95℃ for 20 s, 65-56℃ for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8℃ per cycle; 94℃ for 20 s, 57℃ for 60 s, 30 cycles. After the PCR reaction, fluorescence signals were scanned using a microplate reader, and data analysis and genotyping were performed. Individuals with the following genotypes were considered superior individuals: BW_KASP1 (genotype AA), BW_KASP2 (genotype AA), BW_KASP3 (genotype GG), BW_KASP4 (genotype GG), BW_KASP5 (genotype GG), BW_KASP6 (genotype AA), and BW_KASP7 (genotype TT). Otherwise, they were considered non-superior individuals.

[0056] Compared with the prior art, the present invention has the following beneficial effects:

[0057] (1) For the first time, significant loci identified by genome-wide association analysis of weight traits in yellow-banded trevally were systematically converted into a combination of 7 KASP markers that can be directly applied;

[0058] (2) The judgment rules are clear and suitable for detecting the growth potential of candidate yellow-banded trevally;

[0059] (3) The KASP marker combination has the advantages of high efficiency, high accuracy and low cost, which can realize the batch detection of the growth potential of Yellow-banded Frog in the early stage, and provide a molecular tool for the breeding of new varieties of Yellow-banded Frog with rapid growth;

[0060] (4) Independent population verification showed that the superior growth individuals selected by the present invention were significantly better than non-superior growth individuals in terms of final weight and average daily weight gain (P<0.05), indicating that the present invention has good application effect. Attached Figure Description

[0061] Figure 1 The KASP genotyping results for BW_KASP1 are shown, including the three genotypes AA, AG, and GG.

[0062] Figure 2 The KASP genotyping results for BW_KASP2 are shown, including the three genotypes AA, AG, and GG.

[0063] Figure 3 The KASP genotyping results for BW_KASP3 are shown, including three genotypes: GG, AG, and AA.

[0064] Figure 4 The KASP genotyping results for BW_KASP4 are shown, including three genotypes: GG, AG, and AA.

[0065] Figure 5 The KASP genotyping results for BW_KASP5 are shown, including three genotypes: GG, AG, and AA.

[0066] Figure 6 The KASP genotyping results for BW_KASP6 are shown, including the three genotypes AA, AG, and GG.

[0067] Figure 7 The image shows the KASP genotyping results for BW_KASP7, which includes three genotypes: TT, GT, and GG. Detailed Implementation

[0068] To enable those skilled in the art to better understand the technical content of this invention, the invention will be further described below with reference to specific embodiments. Where specific techniques or conditions are not specified in the embodiments, they shall be performed in accordance with the techniques or conditions described in the literature in the art or according to the product instructions. Unless otherwise specified, the equipment and reagents used in each embodiment are all commercially available.

[0069] Example 1: Development of KASP molecular marker assemblages for detecting the growth potential of *Pteranodon yellowii*

[0070] (1) Determination of growth traits and sample collection

[0071] 624 individuals were randomly selected from a 10-month-old yellowtail aquaculture group of a certain aquaculture company. After anesthesia, their weight was measured, and a small number of fin samples were cut and preserved at -80℃.

[0072] (2) Genotyping and genome-wide association analysis

[0073] Genomic DNA was extracted from fin samples of all the individuals mentioned above, and library construction and sequencing were performed at a sequencing depth of 20×. After sequencing, SNP genotypes were extracted and further filtered to obtain high-quality SNP genotypes. The body weight phenotype and genotype were fitted into a linear mixed model (MLMA-LOCO model) for genome-wide association analysis (GWAS). The threshold after Bonferroni correction was used, i.e., 1 / N, where N is the total number of SNP markers. Seven SNP markers significantly associated with the body weight trait were identified on chromosome 5 (Table 1), namely chr5B: 8182577, chr5B: 8188565, chr5B: 8233233, chr5B: 8260773, chr5B: 8357951, chr5B: 8404380 and chr5B: 8411633. The effect values ​​(b) for all seven loci were negative. Based on this, the homozygous genotype at locus A2 was determined to be the optimal growth genotype, the heterozygous genotype to be the intermediate genotype, and the homozygous genotype at locus A1 to be the low growth genotype. The optimal growth genotypes for the seven loci were AA, AA, GG, GG, GG, AA, and TT (Table 2). Further KASP transformation of these seven loci was successfully performed on all of them.

[0074] Table 1. Information on 7 SNP loci closely associated with weight trait in Yellow-banded Flea-like Species identified by genome-wide association analysis.

[0075]

[0076] Table 2. KASP marker locus information, dominant genotypes, and statistical results.

[0077]

[0078] Example 2: Construction and Genotyping Validation of the KASP Molecular Marker Genotyping Kit

[0079] The KASP markers corresponding to the seven SNP sites described in Example 1 were named BW_KASP1 to BW_KASP7, and a kit for KASP marker genotyping was constructed. This kit contains detection primers for the seven KASP molecular marker combinations, KASP reaction solution, and genotyping result interpretation reagents; each KASP molecular marker contains two specific primers and one universal primer, and the primer nucleotide sequences are shown in SEQ ID NO: 1-21.

[0080] The reaction system for PCR amplification using the kit described above is as follows: 0.0012 μL of specific primer Fam (0.15 μM), 0.0012 μL of specific primer Hex (0.15 μM), 0.0030 μL of universal primer Common (0.375 μM), 0.40 μL of 2×KASPMaster Mix, 15 ng of DNA (dry powder) to be tested, and ultrapure water to a final volume of 0.80 μL.

[0081] The PCR amplification procedure using the kit was as follows: 94℃ for 15 min, 1 cycle; 95℃ for 20 s, 65-56℃ for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8℃ per cycle; 94℃ for 20 s, 57℃ for 60 s, 30 cycles. After the PCR reaction, fluorescence signals were scanned using a microplate reader, and genotyping was performed by reading the fluorescence signal data.

[0082] To better assess the effectiveness of KASP marker genotyping, DNA samples were collected from the top 47 and bottom 47 individuals by weight from 624 individuals of the yellow-banded trevally. Two blank controls were also included. Genotyping was performed using the kit described above. Individuals were considered superior if the genotypes of the BW_KASP1, BW_KASP2, BW_KASP3, BW_KASP4, BW_KASP5, BW_KASP6, and BW_KASP7 were all AA, otherwise they were considered inferior. Each KASP marker successfully identified three genotype clusters: homozygous superior growth, heterozygous superior growth, and homozygous inferior growth. Figures 1-7 In the figure, FAM represents the ratio of fluorescence of the Fam primer amplification product to the fluorescence of the underlying Rox primer, and VIC represents the ratio of fluorescence of the Hex primer amplification product to the fluorescence of the underlying Rox primer. As shown in Table 2, the number of dominant genotypes for each KASP marker ranges from 27 to 49, with 26 individuals exhibiting the optimal growth genotype, indicating that these individuals have significant growth potential. Therefore, the KASP marker combinations of this invention can be used for growth trait-assisted breeding, enabling early artificial screening of individuals with high growth potential.

[0083] Example 3: Application of KASP molecular marker combinations in assisted breeding

[0084] To further verify the robustness of this invention in detecting the growth potential of *Pterodon spp.* and in assisting breeding, validation was conducted using an independent population, specifically including the following steps:

[0085] (1) Collection of test samples and growth phenotypes

[0086] Forty 400 yellowtail fry (approximately 4 months old) with a body length of 10-15 cm were randomly collected from a yellowtail aquaculture company. Their initial weight was measured, and each fry was electronically tagged. They were then raised together in the same pond. After 159 days (approximately 9 months old), 188 individuals were randomly collected, their electronic tags were scanned, their final weight was measured, and fin samples were collected and temporarily stored in an ultra-low temperature freezer at -80℃. The average daily gain (ADG) of these 188 individuals was calculated using the formula: (final weight - initial weight) / number of days of rearing.

[0087] (2) Genotyping and growth potential detection based on KASP molecular marker combination kit

[0088] Genotyping of the 188 *Pteranodon fulvidraco* samples was performed using the kit and related experimental methods described in Example 2. The genotypes at each locus were compared with the dominant genotype combinations. Individuals with genotypes at the seven loci that were, in order, AA, AA, GG, GG, GG, AA, and TT were identified as candidates for superior growth. The results showed that 28 samples met the criteria for the superior growth genotype combinations and possessed excellent growth potential. The average final weight of these 28 individuals was 391.9 ± 100.4 g, with an average daily weight gain of 2.3 ± 0.6 g / d. The average final weight of the other non-superior growth individuals was 252.6 ± 120.1 g, with an average daily weight gain of 1.4 ± 0.7 g / d. The average final weight and average daily weight gain of individuals with superior growth were significantly higher than those with inferior growth (P<0.05), indicating that the KASP molecular marker combination provided by this invention can be used for growth potential detection and molecular marker-assisted breeding of yellow-banded trevally, which helps to achieve early screening of individuals with excellent growth potential.

Claims

1. A KASP molecular marker ensemble for detecting the growth potential of *Pteranodon yellowii*, characterized in that, It contains 7 SNP sites, namely BW_KASP1, BW_KASP2, BW_KASP3, BW_KASP4, BW_KASP5, BW_KASP6, and BW_KASP7, located on chromosome 5 of the yellow-banded pseudo-water gorilla at chr5B:8182577, chr5B:8188565, chr5B:8233233, chr5B:8260773, chr5B:8357951, chr5B:8404380, and chr5B:8411633, respectively, with base polymorphism types of A / G, A / G, G / A, G / A, G / A, A / G, and T / G, respectively.

2. The KASP molecular marker ensemble for detecting the growth potential of *Pteranodon yellowii* as described in claim 1, characterized in that, The dominant genotypes of the seven SNP loci are AA, AA, GG, GG, GG, AA and TT, respectively. When all seven SNP loci of an individual are dominant genotypes, it indicates that the individual is a healthy individual.

3. The application of the KASP molecular marker combination for detecting the growth potential of Yellow-banded Frog as described in claim 1 or 2 in the preparation of products for detecting the growth potential of Yellow-banded Frog and molecular marker-assisted breeding.

4. A method for screening superior growth candidate individuals of *Pteranodon yellowii* using the KASP molecular marker combination for detecting the growth potential of *Pteranodon yellowii* as described in claim 1 or 2, characterized in that, Includes the following steps: DNA was extracted from the individual to be tested, and KASP typing was performed on the seven SNP loci to determine the genotype of each locus. When the genotypes of the seven SNP loci were AA, AA, GG, GG, GG, AA and TT in sequence, the individual to be tested was determined to be a candidate individual for optimal growth.

5. A detection primer for the KASP molecular marker combination for detecting the growth potential of *Pteropoda lutea* as described in claim 1, characterized in that, Each KASP molecular marker contains two specific primers and one universal primer; The nucleotide sequences of the primers labeled BW_KASP1 are as follows: specific primer Fam is shown in SEQ ID NO: 1, specific primer Hex is shown in SEQ ID NO: 2, and universal primer Common is shown in SEQ ID NO: 3; BW_KASP2-tagged primer nucleotide sequence: The specific primer Fam is shown in SEQ ID NO: 4, the specific primer Hex is shown in SEQ ID NO: 5, and the universal primer Common is shown in SEQ ID NO: 6; BW_KASP3-tagged primer nucleotide sequence: The specific primer Fam is shown in SEQ ID NO: 7, the specific primer Hex is shown in SEQ ID NO: 8, and the universal primer Common is shown in SEQ ID NO: 9; BW_KASP4-tagged primer nucleotide sequence: The specific primer Fam is shown in SEQ ID NO: 10, the specific primer Hex is shown in SEQ ID NO: 11, and the universal primer Common is shown in SEQ ID NO: 12; The nucleotide sequences of the primers labeled BW_KASP5 are as follows: specific primer Fam is shown in SEQ ID NO: 13, specific primer Hex is shown in SEQ ID NO: 14, and universal primer Common is shown in SEQ ID NO: 15; The nucleotide sequences of the primers labeled BW_KASP6 are as follows: specific primer Fam is shown in SEQ ID NO: 16, specific primer Hex is shown in SEQ ID NO: 17, and universal primer Common is shown in SEQ ID NO: 18; The nucleotide sequences of the primers labeled BW_KASP7 are as follows: specific primer Fam is shown in SEQ ID NO: 19, specific primer Hex is shown in SEQ ID NO: 20, and universal primer Common is shown in SEQ ID NO:

21.

6. A detection kit for the KASP molecular marker combination for detecting the growth potential of *Pteranodon yellowii* as described in claim 1, characterized in that, The kit includes detection primers, KASP reaction solution, and genotyping result interpretation reagents for the KASP molecular marker combination as described in claim 5.

7. The application of the detection primers of claim 5 or the detection kit of claim 6 in the preparation of products for detecting the growth potential of *Pterodon spp.* and for molecular marker-assisted breeding.

Images